ID: 1158163043

View in Genome Browser
Species Human (GRCh38)
Location 18:54507635-54507657
Sequence CATGGCACTGAGGGGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158163036_1158163043 22 Left 1158163036 18:54507590-54507612 CCTTGAGGAGCACAAAGGGCGCT No data
Right 1158163043 18:54507635-54507657 CATGGCACTGAGGGGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158163043 Original CRISPR CATGGCACTGAGGGGGACGC TGG Intergenic
No off target data available for this crispr