ID: 1158168832

View in Genome Browser
Species Human (GRCh38)
Location 18:54573650-54573672
Sequence GGTGGTTCCTTTCCATGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158168826_1158168832 24 Left 1158168826 18:54573603-54573625 CCTCAATGGTCTTTACAATTTGG No data
Right 1158168832 18:54573650-54573672 GGTGGTTCCTTTCCATGTTTAGG No data
1158168825_1158168832 29 Left 1158168825 18:54573598-54573620 CCTAGCCTCAATGGTCTTTACAA No data
Right 1158168832 18:54573650-54573672 GGTGGTTCCTTTCCATGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158168832 Original CRISPR GGTGGTTCCTTTCCATGTTT AGG Intergenic