ID: 1158183324

View in Genome Browser
Species Human (GRCh38)
Location 18:54742876-54742898
Sequence ACATAGATGCAAAATTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158183324_1158183329 9 Left 1158183324 18:54742876-54742898 CCTTGCAAATTTTGCATCTATGT 0: 1
1: 0
2: 2
3: 23
4: 253
Right 1158183329 18:54742908-54742930 CTGTGAGGTCAGCTTTTGGCAGG 0: 1
1: 0
2: 1
3: 8
4: 170
1158183324_1158183326 5 Left 1158183324 18:54742876-54742898 CCTTGCAAATTTTGCATCTATGT 0: 1
1: 0
2: 2
3: 23
4: 253
Right 1158183326 18:54742904-54742926 CACCCTGTGAGGTCAGCTTTTGG 0: 1
1: 0
2: 0
3: 19
4: 142
1158183324_1158183325 -6 Left 1158183324 18:54742876-54742898 CCTTGCAAATTTTGCATCTATGT 0: 1
1: 0
2: 2
3: 23
4: 253
Right 1158183325 18:54742893-54742915 CTATGTCAACTCACCCTGTGAGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158183324 Original CRISPR ACATAGATGCAAAATTTGCA AGG (reversed) Intronic
904342090 1:29842873-29842895 ACATACAAACAAAATTTGGAAGG + Intergenic
906010690 1:42522006-42522028 TCACAGATACAAAATTTTCAAGG + Intronic
907900401 1:58735911-58735933 CCATACATGCAATATTTGAAAGG - Intergenic
908230186 1:62096947-62096969 ACATAGATACTAAGTTTGAAGGG - Intronic
908306281 1:62821751-62821773 ACATACATGCAAATATTGAAAGG - Intronic
909538231 1:76762105-76762127 ACATAAATGTAACCTTTGCAAGG - Intergenic
911962717 1:104327040-104327062 ACATTGATGCAAAATTTATCAGG - Intergenic
911962848 1:104329133-104329155 ACATTGATGCAAAATTTATCAGG - Intergenic
912242929 1:107929935-107929957 ACAGAGAGACAAACTTTGCATGG + Intronic
913656391 1:120964356-120964378 ACAAAGGTGTAAAGTTTGCAGGG + Intergenic
914007536 1:143745604-143745626 ACAAAGGTGTAAAGTTTGCAGGG + Intergenic
914520943 1:148415585-148415607 ACAAAGGTGTAAAGTTTGCAGGG + Intergenic
914646353 1:149656086-149656108 ACAAAGGTGTAAAGTTTGCAGGG + Intergenic
914777408 1:150750391-150750413 TCATACATGCAAAACTTGCCAGG + Intronic
915707842 1:157863608-157863630 ACATAAATACAAAATTAGCCAGG - Intronic
917108052 1:171514967-171514989 ACATAGATGAAAAATGAGTATGG - Intronic
918014768 1:180622789-180622811 ACAGAGATGGAAGATATGCAGGG - Intergenic
920001323 1:202801419-202801441 ACAAAGATGCAGAATTTGACTGG - Intronic
921251776 1:213304834-213304856 AAAAAGACGCAAAATTTGCTGGG - Intergenic
921290256 1:213650535-213650557 ACATAGATGCAAATGCTGAAAGG - Intergenic
921401754 1:214731541-214731563 AAATCTCTGCAAAATTTGCAGGG - Intergenic
922020328 1:221698069-221698091 ACATGGATGCCAAGTTGGCAAGG + Intergenic
922050434 1:221984225-221984247 ACTTAGAAGAAATATTTGCAGGG + Intergenic
922075885 1:222244153-222244175 ACAAAGATAAAAAATTAGCAAGG + Intergenic
922289276 1:224197144-224197166 ACATAAATGCATTTTTTGCATGG - Intergenic
922669847 1:227501162-227501184 AAATATATGCAAATTTTGCCTGG - Intergenic
923202343 1:231724626-231724648 ACACAGATGCAAACTTTTCCTGG + Intronic
1063077230 10:2729454-2729476 TCATAGATGCAAAATCTCAATGG - Intergenic
1064279066 10:13934528-13934550 AAAGAGAAGCAAACTTTGCAGGG + Intronic
1064769296 10:18707356-18707378 ACATATATACAAAATTAGCTGGG - Intergenic
1065225564 10:23540142-23540164 AGATAGAGGAAGAATTTGCATGG + Intergenic
1067958083 10:50815758-50815780 GCACAGATTCAAACTTTGCATGG - Intronic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1078506663 11:11954951-11954973 ACACAGATGCAACATTCTCAGGG - Intronic
1080903815 11:36521118-36521140 CCAAAAATGCAAAATTTGCCAGG - Intronic
1084079416 11:66811112-66811134 ACACACATGCAAAATTAGCCAGG - Intronic
1085528514 11:77177813-77177835 ACATAGATACATGATTTACATGG + Intronic
1086768253 11:90727264-90727286 ACATAAATGCATAATTTTCAGGG - Intergenic
1087395666 11:97593946-97593968 ACAAATATCCAAAATCTGCAAGG + Intergenic
1087556493 11:99728334-99728356 CCAGAGTTGCAATATTTGCATGG - Intronic
1088430773 11:109756498-109756520 CCATTGATGAAAAATTTTCACGG - Intergenic
1094109029 12:26841517-26841539 ACCAAGATGCAAATTTTGAAAGG - Intergenic
1094114153 12:26892049-26892071 GCATAAATACAAAATTTGTATGG + Intergenic
1095548527 12:43403025-43403047 AAACAAATGCAAAATTTGCAAGG + Intronic
1095579906 12:43785537-43785559 ACATAGATATAAAAATTGGAAGG + Intronic
1096128299 12:49136331-49136353 ACACAGATGTAAAATTAGCCGGG - Intergenic
1096832280 12:54323907-54323929 ACATATATACAAAATTAGCCGGG - Intronic
1097256183 12:57676371-57676393 ACATAGAGATAAAATCTGCAAGG + Intergenic
1098262625 12:68686565-68686587 AAATAGTTGCAAAAACTGCAGGG + Intergenic
1099565575 12:84241109-84241131 AAATAAATGCAATAATTGCATGG - Intergenic
1099796316 12:87405101-87405123 ACATAGATACAAATTTTAAATGG + Intergenic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1105488588 13:20862904-20862926 TAATAAATGCAAAATGTGCAAGG - Intronic
1106828545 13:33552223-33552245 AACTAGATACAAAATTAGCAAGG + Intergenic
1106961215 13:35000302-35000324 ATATAGTTGAAAAATTTACATGG + Intronic
1107065149 13:36205631-36205653 ACATAGATGCAAAAATCTAAAGG - Intronic
1108086463 13:46798008-46798030 CCATAGCTACACAATTTGCAGGG - Intergenic
1108536464 13:51385507-51385529 TCATATATGCAAAATTTTCTTGG - Intronic
1108787771 13:53926607-53926629 ACATATATTAAAAATTTACAGGG - Intergenic
1109334709 13:60980086-60980108 ACTTAGATACAAATTTTGTATGG - Intergenic
1110118868 13:71856021-71856043 AAATAGCTGCAAAATTTTGATGG + Intronic
1110589494 13:77238957-77238979 ACAAAAATGCAAAATTAGCCAGG + Intronic
1111259166 13:85712531-85712553 ACGTAGCTGCATAATTTCCATGG - Intergenic
1112209098 13:97356407-97356429 AAAAAAATGCAAAATTTGTAAGG - Intronic
1112572800 13:100608898-100608920 ACCTAGAGACATAATTTGCAAGG - Intronic
1112952027 13:105010690-105010712 ACTTGGATGCAAAATTACCAAGG - Intergenic
1113249914 13:108440949-108440971 AATTGGCTGCAAAATTTGCAGGG + Intergenic
1115146716 14:30235304-30235326 AGATAGATACAAAAGTTGCTTGG + Intergenic
1116147493 14:41093748-41093770 ACAAAAATGCAAAATTAGTAGGG - Intergenic
1116381013 14:44267984-44268006 AAAAAGCTGTAAAATTTGCAAGG - Intergenic
1117580535 14:57146950-57146972 AGATATATGCAAAATTGGCAAGG + Intergenic
1120113395 14:80584445-80584467 ACATGGATGTAAAATATGGATGG - Intronic
1120568496 14:86089013-86089035 TCAAAGATGTAAAATTTGCAAGG - Intergenic
1124067612 15:26360477-26360499 AAATAGATGCAATATCTTCAGGG - Intergenic
1124154699 15:27215629-27215651 ACACATTTGCAAAACTTGCATGG + Intronic
1125741575 15:41968687-41968709 ACATAGATGCAGAAATTACTTGG + Intronic
1126297590 15:47158132-47158154 ACAAAGGTACAAAATCTGCAGGG + Intergenic
1129773242 15:78216307-78216329 ACAAAGATGCATTCTTTGCAGGG + Intronic
1129937779 15:79464981-79465003 ACATCTTTGCAAAGTTTGCAGGG + Intronic
1132126265 15:99227911-99227933 ACATAGATGCAAAACACGAAGGG - Intronic
1134129376 16:11638742-11638764 AGTTAGATGCTAAATTTCCAGGG - Intergenic
1135308700 16:21388811-21388833 ACAAAAATACAAAATTAGCAGGG - Intergenic
1137306703 16:47207702-47207724 ACAGAGATCCAGAACTTGCAGGG + Intronic
1138150548 16:54652748-54652770 ACAGAGCTGCAAAATTGCCAGGG + Intergenic
1146442499 17:32909542-32909564 AGATAGATACAAATTTTGGAAGG + Intergenic
1150996624 17:70325453-70325475 ACATGGGTGCATATTTTGCATGG - Intergenic
1150996702 17:70326443-70326465 GCATAGGTGCATACTTTGCATGG + Intergenic
1151110869 17:71676129-71676151 ACATAGAATCAAAAGTTTCAGGG - Intergenic
1154208863 18:12361829-12361851 ACAAAGATACAAAATTCACATGG + Intronic
1155612971 18:27689252-27689274 ACATAGACACAAAAATTCCAAGG - Intergenic
1156136471 18:34045676-34045698 ATATAGATAAAAAATTTTCATGG + Intronic
1156303926 18:35859184-35859206 ACCTGGTTGCAAACTTTGCATGG + Intergenic
1156322747 18:36042920-36042942 TCTTAGAAGTAAAATTTGCAAGG - Intronic
1156947375 18:42851497-42851519 GCATAGAAGCAAAAATTGAAAGG + Intronic
1156985652 18:43348104-43348126 ACATACTTGCAACATTTTCAGGG + Intergenic
1157365624 18:47061598-47061620 ACATACCTACTAAATTTGCAGGG - Intronic
1158183324 18:54742876-54742898 ACATAGATGCAAAATTTGCAAGG - Intronic
1158847012 18:61454876-61454898 AGACAGATGCATTATTTGCATGG + Intronic
1160015509 18:75137394-75137416 AAACAGAGGCAAAATTTTCAGGG + Intergenic
1160066563 18:75580573-75580595 ACATAGTTTCACAATATGCATGG - Intergenic
1160066601 18:75581210-75581232 ACACAGTTTCACAATTTGCATGG + Intergenic
1163503498 19:17689556-17689578 TCATAAATGCAGAATGTGCATGG + Intergenic
1165178953 19:33951388-33951410 TCATAGAATCAAAATGTGCAGGG - Intergenic
1165352045 19:35280888-35280910 GCAAAGAGGCAAAATGTGCAAGG + Exonic
1165598736 19:37034669-37034691 AGATAATTGCAAAATTGGCATGG + Intronic
926693654 2:15755059-15755081 ACCTGGATGCAGGATTTGCAAGG - Intergenic
927772106 2:25872097-25872119 ACATAAATTAAAAATTAGCAGGG + Intronic
928765636 2:34642046-34642068 ACATAGTTGAAGAAGTTGCAAGG - Intergenic
930460631 2:51670018-51670040 ACGTAGATGGAAAATTAGAAAGG - Intergenic
931301796 2:60987361-60987383 ACCTTGATGTAATATTTGCAAGG + Intronic
931855299 2:66296785-66296807 ACATAGATTAGAAATTTGCGGGG - Intergenic
931999488 2:67871503-67871525 GCATAGATGCAAACTTTGTCAGG - Intergenic
932031523 2:68190989-68191011 ACAAAGCTGCATAATTTGAATGG + Intronic
932335377 2:70928139-70928161 ACAGAGAGACAACATTTGCAGGG + Intronic
933066040 2:77797620-77797642 ACATAAATGCAGAATTTTGAGGG - Intergenic
933485451 2:82916393-82916415 AGATATTTGCAAAATGTGCAAGG + Intergenic
934874146 2:97898986-97899008 AAATAGATGGAAAATCAGCAAGG - Intronic
934988967 2:98907963-98907985 ACATCTCTGCAAATTTTGCAAGG + Intronic
935075402 2:99738290-99738312 ACACAGATGGAAAATATGAAAGG - Intronic
936240100 2:110780631-110780653 ACATAGATGCCTCATTTGCATGG + Intronic
936676235 2:114718733-114718755 ACATGTATGCTAAATTTGTAAGG + Intronic
939850222 2:147295556-147295578 AGGTAGATGCAAAATCTGGATGG - Intergenic
940742841 2:157530845-157530867 ACTTAAAGGCAAAATTTACAAGG + Exonic
941099193 2:161278335-161278357 ACAAAAATAAAAAATTTGCAAGG + Intergenic
941394545 2:164957927-164957949 ATATATATGCAAAAATTCCAAGG + Intergenic
942871923 2:180745127-180745149 ACATATATGCCAGATTTGCCTGG + Intergenic
943279414 2:185912137-185912159 TCAAAGATGCAGAATTTGCTAGG - Intergenic
944213386 2:197229860-197229882 ACATCGATGCAGAATTGGAAAGG + Intronic
946538720 2:220660277-220660299 GAATACAGGCAAAATTTGCAAGG + Intergenic
1169686046 20:8273240-8273262 ACATACATGCAAGATTTGGTAGG - Intronic
1171526661 20:25818182-25818204 AGATAAGTGCAAAATTGGCATGG - Intronic
1171550166 20:26037703-26037725 AGATAAGTGCAAAATTGGCATGG + Intergenic
1176880751 21:14189945-14189967 ACACACATGCAAAATTTCAAAGG - Intronic
1177208324 21:18036934-18036956 AAATAGGTACAAAATCTGCATGG - Intronic
1177474286 21:21598464-21598486 ACATAGAATCAAAATTTGGATGG - Intergenic
1180574970 22:16764868-16764890 AGATAATTGCAAAATTGGCATGG - Intergenic
1182337141 22:29591579-29591601 ACAAAAATGCAAAAATTGCCGGG + Intergenic
1183145556 22:35988204-35988226 ATATAGATCCTAGATTTGCAGGG - Intronic
949444204 3:4115693-4115715 AAAAAGATGAAAAATTAGCAAGG - Intronic
949688368 3:6604592-6604614 TCATAGATGCTAAATTTACTAGG - Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950158720 3:10743110-10743132 AAATAGATGCACAGTTAGCACGG - Intergenic
951926698 3:27915597-27915619 CTATAGATGGAACATTTGCAAGG + Intergenic
951991372 3:28679136-28679158 ACTTAGGTGCAAAAATTGCCAGG + Intergenic
953626010 3:44572023-44572045 ACAGACACGCAAAATTTACAAGG - Exonic
953779337 3:45852601-45852623 ACATACATGCAAATTTGGAAAGG + Intronic
954753220 3:52825175-52825197 AAATAGAAGGAAAAGTTGCAGGG - Intronic
955676943 3:61458678-61458700 AGATAGATGCAAAAATGCCAAGG + Intergenic
960307275 3:116076830-116076852 ACATAAATGCAAAAATTGAAAGG - Intronic
962518682 3:136177816-136177838 ACATATATGCCAATTTTACAGGG + Intronic
963982896 3:151560024-151560046 AGCTAGATGCAAGTTTTGCAGGG + Intergenic
967605819 3:191445128-191445150 ACACAGATGCCAAATGAGCAGGG + Intergenic
971392804 4:26201854-26201876 ACACAGATCAGAAATTTGCAGGG + Intronic
972202680 4:36733987-36734009 AAAAAGATGCAAAATCTCCAGGG - Intergenic
972472190 4:39417045-39417067 ATATAGAAGCAAAATCTCCAAGG + Intronic
975436037 4:74352845-74352867 AGATAGATACAAAAATAGCATGG - Intergenic
975661716 4:76695383-76695405 ACATAGATGCAATATTTTCTTGG + Intronic
979649215 4:123110288-123110310 ACATAGTTGCAAAATTGGTAAGG + Intronic
979922479 4:126516995-126517017 TCATAGAGGCAAGATTTCCATGG - Intergenic
980280269 4:130709027-130709049 ACATATATGCCAAGATTGCAAGG - Intergenic
981522458 4:145677488-145677510 ACTTTGTTGCAAACTTTGCATGG + Intergenic
981856844 4:149304739-149304761 ACTTAGAAATAAAATTTGCATGG + Intergenic
982495749 4:156089860-156089882 ACATACATGCAAAATATATAGGG + Intergenic
983695426 4:170522888-170522910 ACATATATGTTAAATGTGCATGG - Intergenic
983855259 4:172635521-172635543 TCAAATATGCAAAATTTGAAAGG - Intronic
983983475 4:174028117-174028139 ACATAGATAAAACATTTGGATGG + Intergenic
984854633 4:184184297-184184319 AGATAGAATCAAAATTAGCAAGG + Intronic
984897233 4:184552461-184552483 AGATAATTGCAAAATTGGCATGG + Intergenic
987543661 5:19286237-19286259 ATCTTGATGCATAATTTGCATGG + Intergenic
987713283 5:21532427-21532449 AAAAAAATGCAAAATTTGCCGGG + Intergenic
987873715 5:23652341-23652363 ACAAAGAGGAGAAATTTGCAAGG - Intergenic
988431434 5:31123479-31123501 ATATATAAGCAAAATTAGCAAGG + Intergenic
990697865 5:58442406-58442428 ACATAGAAACAAAATTTGGTAGG - Intergenic
991132942 5:63146297-63146319 ACTGATAAGCAAAATTTGCAAGG + Intergenic
992342132 5:75835399-75835421 ACAGAGATTCAAAATATCCAAGG - Intergenic
994403363 5:99311706-99311728 AAATAGATGAAAAAATTGAAGGG - Intergenic
994838664 5:104892088-104892110 ACATAAATGCTATTTTTGCAAGG - Intergenic
996914002 5:128689926-128689948 ACATAGATGAAACACTTGAATGG - Intronic
998190486 5:140019688-140019710 TCTTAGATGCAAAATTGGAAAGG + Intronic
999574955 5:152965678-152965700 ACACAGATGAAGAACTTGCAAGG + Intergenic
1000923878 5:167170503-167170525 ACTTATTTGCCAAATTTGCATGG + Intergenic
1001929740 5:175664480-175664502 ACAGAGCTGCAAAATGTCCAGGG + Intronic
1002924736 6:1598909-1598931 ACAGAGATGGAAAATATTCAGGG + Intergenic
1003488911 6:6603970-6603992 ACTTAGATGACATATTTGCATGG - Intronic
1003727850 6:8786136-8786158 ACACAGATGCATAATTTGAAAGG + Intergenic
1004120688 6:12818782-12818804 ACATAGGTATAAAATTTCCAAGG + Intronic
1004211900 6:13655909-13655931 ACAAATATACATAATTTGCATGG + Intronic
1004524074 6:16389684-16389706 ACATAGAAGCAAAATTGAAAAGG + Intronic
1004662254 6:17721042-17721064 ACAAAAATGCAAAATTAGCTGGG - Intergenic
1004702563 6:18092818-18092840 AGATTGATGCTAAATTTGAATGG - Intergenic
1004766697 6:18736960-18736982 ACTTAGATGGATAATTTTCAAGG + Intergenic
1004859320 6:19785035-19785057 ATATCGATTCAAAATTTGCTAGG - Intergenic
1004904186 6:20221040-20221062 ACACAGATGCTAAATGTGGATGG - Intergenic
1005532892 6:26725335-26725357 ACATAAAAGCAAAAATTGCAAGG + Intergenic
1005535559 6:26752658-26752680 ACATAAAAGCAAAAATTACATGG - Intergenic
1005537903 6:26776329-26776351 ACATAAAAGCAAAAATTGCAAGG - Intergenic
1006855238 6:37128379-37128401 ACATAGTTTCAGAATTTTCAGGG + Intergenic
1009006598 6:57796283-57796305 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009008771 6:57818735-57818757 ACATAGAAGCAAAAATTGCATGG - Intergenic
1009491956 6:64302500-64302522 CCATAAATGCAAAAGTTGAAAGG - Intronic
1009514128 6:64592449-64592471 ACATAGATGAAAAATAGACAAGG + Intronic
1010835190 6:80578124-80578146 ACATTACTGCAAATTTTGCATGG - Intergenic
1011400843 6:86959744-86959766 ACAGAGATTCAAAATTTGTCAGG - Intronic
1011799669 6:90997602-90997624 ACAAAGATGCAAGATTTGACAGG - Intergenic
1012808820 6:103931298-103931320 ACTAAGATCCAAAATTTACAAGG + Intergenic
1013612768 6:111810556-111810578 ACATAAATGTAAATTTTTCAAGG - Intronic
1015449817 6:133353388-133353410 ACCTAGAAGCAAAATTTGGAAGG - Intronic
1015822886 6:137281979-137282001 AAATAGAGGGAAAATCTGCATGG - Intergenic
1015949761 6:138540288-138540310 ACACAGATGCAATATTCCCAGGG + Intronic
1017885028 6:158591843-158591865 ACATAGATACAAAAGATGGAAGG - Intronic
1017975618 6:159354390-159354412 ACATGGAAGCAACATTTGAATGG + Intergenic
1020185845 7:5958889-5958911 AGTAAGATGCAAAAGTTGCACGG - Intronic
1020297071 7:6765873-6765895 AGTAAGATGCAAAAGTTGCATGG + Intronic
1021807525 7:24372068-24372090 ATATAGCTTCAAAATTTGCTTGG + Intergenic
1022190656 7:28014104-28014126 AAATAGATGCTAAAATTACATGG + Intronic
1024780633 7:52843893-52843915 ACACAGATGCAGAAGTTGAAAGG + Intergenic
1024937274 7:54723019-54723041 AAATAGATGCAAAATAAGAAAGG - Intergenic
1025829296 7:65036002-65036024 AAATATATACAAAATTAGCAAGG - Intergenic
1025916511 7:65870942-65870964 AAATATATACAAAATTAGCAAGG - Intergenic
1026424891 7:70280963-70280985 ACATAGATACACTATTTGCCAGG - Intronic
1027608983 7:80335689-80335711 ACATAAATGCAAACATTGTAAGG - Intergenic
1028368895 7:90068626-90068648 ACTGTGGTGCAAAATTTGCAAGG - Intergenic
1030730732 7:112985221-112985243 ACATTGTTGCCAAATTTGCATGG - Intergenic
1031433681 7:121706160-121706182 GGATAGATGCAAAATTTACTAGG - Intergenic
1031515596 7:122694455-122694477 ACAGTGATGAAAAATATGCATGG + Intronic
1032491485 7:132327599-132327621 ACCTTGATGCATATTTTGCATGG - Intronic
1033336857 7:140461247-140461269 GCATAGGGGCAAAATTTGGAAGG - Intronic
1033491822 7:141851864-141851886 ACAAAGATGAAATCTTTGCAAGG - Intergenic
1033842397 7:145390240-145390262 ACATAGAAGCCAAATTCTCAAGG + Intergenic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1035110831 7:156480278-156480300 ACATAGAAACAGAATCTGCAGGG + Intergenic
1038863695 8:31415395-31415417 TCATAGAGGCAAAATTAGCTAGG - Intergenic
1038986300 8:32814884-32814906 ACATAGATGTAATATATGCCAGG - Intergenic
1039091835 8:33838680-33838702 ACATAGATGCTAAATTTCAAAGG + Intergenic
1041327072 8:56679379-56679401 ACAGAAATACAAAATTTGAATGG + Intergenic
1041567887 8:59301235-59301257 AAATAAATTCTAAATTTGCAGGG - Intergenic
1041614578 8:59891665-59891687 AAAATGATGCAAAATATGCAAGG - Intergenic
1041863557 8:62541854-62541876 ACAAAGAAGAAAGATTTGCAGGG - Intronic
1041887063 8:62822436-62822458 ACATACATGCTGATTTTGCATGG + Intronic
1043333714 8:79148260-79148282 GCATAGAGGCAATATTTTCAGGG - Intergenic
1044701696 8:94971045-94971067 TCATAGATGCAAACTCTTCAAGG - Intronic
1045343393 8:101273654-101273676 ACATAGAGGCAAGATGTGGAGGG + Intergenic
1045416199 8:101970390-101970412 CCATTGATGGAAAATTTGCAAGG - Intronic
1047590643 8:126323339-126323361 ACATAGAGGCGACATTTGAATGG + Intergenic
1047673752 8:127177135-127177157 ACCTTGATTTAAAATTTGCATGG + Intergenic
1048693243 8:136991334-136991356 GCAAGGATACAAAATTTGCAAGG - Intergenic
1049177054 8:141200260-141200282 ACATAGATGCAAAATTCCTGGGG + Intergenic
1050318768 9:4429598-4429620 ACATAGATGTAAAATTGTCATGG - Intergenic
1050775188 9:9250910-9250932 ACATAGATGCAAATTCAGCAAGG + Intronic
1053794579 9:41714283-41714305 AGATAAGTGCAAAATTGGCATGG - Intergenic
1054182987 9:61926331-61926353 AGATAAGTGCAAAATTGGCATGG - Intergenic
1054470370 9:65531645-65531667 AGATAAGTGCAAAATTGGCATGG + Intergenic
1054655519 9:67662144-67662166 AGATAAGTGCAAAATTGGCATGG + Intergenic
1058720938 9:107763004-107763026 AAATATAGGCAAAAGTTGCATGG - Intergenic
1058746252 9:107993864-107993886 TGATAAATTCAAAATTTGCAGGG - Intergenic
1059571261 9:115438768-115438790 ACATACATGCAACATTTTCAGGG - Intergenic
1185876674 X:3707489-3707511 ACATAAATGCCAAGTGTGCAGGG - Intronic
1187108102 X:16266088-16266110 ACATAGAAGCAAGATATGCATGG + Intergenic
1187622372 X:21072006-21072028 GTATATATGCTAAATTTGCAAGG - Intergenic
1188207546 X:27379087-27379109 TCACAGATGCAAAATATGAATGG + Intergenic
1188470312 X:30530588-30530610 ACTTCGATGCAAAATTTAGAAGG + Intergenic
1188732298 X:33664875-33664897 AAATAGATGAAACATTTTCAAGG + Intergenic
1190113278 X:47609089-47609111 TTATAGATGAAAAATGTGCAGGG - Intronic
1192815571 X:74587393-74587415 ACATAGAAGCCATGTTTGCAGGG - Exonic
1193621769 X:83761615-83761637 ACATAAATGCATAAATTTCAGGG - Intergenic
1193646538 X:84076386-84076408 ACACAGATGCAAAAATTGTAAGG + Intronic
1194715534 X:97283391-97283413 ACATAGATAACAAGTTTGCAGGG + Intronic
1194737221 X:97526855-97526877 AGATAGATGGAAAAGTTGAATGG - Intronic
1195053447 X:101120083-101120105 ACATACATGCAAATATTGAAAGG + Intronic
1196076286 X:111580289-111580311 ACAAAAATCTAAAATTTGCATGG - Intergenic
1197593511 X:128439088-128439110 ACATAAATGAAAAATTTTAATGG - Intergenic
1198306923 X:135392786-135392808 AAATAAATGAAAAATTTACATGG - Intergenic
1198574709 X:137997535-137997557 ACATTGATGCAAAAAATGAATGG + Intergenic
1199340720 X:146674477-146674499 ATAGAGATGGAAAATTTTCAAGG - Intergenic
1199501019 X:148505616-148505638 AAATAAGTGCAAATTTTGCATGG - Intronic
1199708687 X:150452514-150452536 ACATTGTTGAACAATTTGCATGG - Intronic
1199910510 X:152281863-152281885 ACTTAGCTGAAAAATTTTCAAGG - Intronic
1202071481 Y:20996234-20996256 CCAAATATGCAAAATATGCAAGG + Intergenic