ID: 1158183636

View in Genome Browser
Species Human (GRCh38)
Location 18:54746287-54746309
Sequence GGTCGGATGAGACAAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158183630_1158183636 20 Left 1158183630 18:54746244-54746266 CCATAAGTTAGATCTCAGGTATG 0: 1
1: 0
2: 4
3: 1
4: 95
Right 1158183636 18:54746287-54746309 GGTCGGATGAGACAAAAATCAGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158183636 Original CRISPR GGTCGGATGAGACAAAAATC AGG Intronic
907368106 1:53979294-53979316 GCTAGGGTGAGACTAAAATCTGG + Intergenic
908738275 1:67299453-67299475 AGTTGGATAAGACAAAATTCTGG + Intergenic
910399592 1:86825474-86825496 GGTCAGAGGAGAGACAAATCTGG - Intergenic
913103384 1:115591171-115591193 GGATGGATGATATAAAAATCTGG + Intergenic
916938415 1:169655599-169655621 AGTGGGAGGAGTCAAAAATCTGG - Intergenic
918452043 1:184668381-184668403 GGTGGGATGAGACAAGCAACTGG + Intergenic
922092867 1:222414096-222414118 GGTAGGATGAAACAAAAAGCTGG - Intergenic
1069256563 10:66338668-66338690 GGAAGGATGAGACAAAGATCAGG + Intronic
1073582860 10:104683627-104683649 GTTTGGCTGGGACAAAAATCAGG - Intronic
1077630493 11:3808237-3808259 GGGCGGATGAGAAAGAAATCCGG + Intronic
1077973000 11:7215555-7215577 GGATGCAGGAGACAAAAATCTGG - Intergenic
1079292653 11:19202139-19202161 GGTTGGGGGAGACAAAACTCAGG - Intronic
1080477667 11:32610335-32610357 GGAGAGTTGAGACAAAAATCAGG - Intronic
1080593743 11:33748908-33748930 GGGTGGTAGAGACAAAAATCTGG + Intronic
1080596629 11:33778907-33778929 GATGGGGTGACACAAAAATCTGG + Intergenic
1080598888 11:33802812-33802834 GATGGGTTGAGAGAAAAATCTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1085057593 11:73415684-73415706 GCTTGGGTGACACAAAAATCAGG + Intronic
1087159515 11:94935319-94935341 GGTAGGAGGAGAAGAAAATCAGG + Intergenic
1087167405 11:95019375-95019397 GGTCACATGAGACAAACATCAGG - Intergenic
1098562685 12:71893668-71893690 GATCGGTTTAGGCAAAAATCTGG + Intronic
1101409610 12:104457595-104457617 GGTTGGAAGAGGCAGAAATCAGG - Intronic
1103176103 12:118864833-118864855 GGGCTGATGAGACCAATATCAGG + Intergenic
1114315942 14:21510194-21510216 GGTCTAATTAGACAAAAATAAGG - Intronic
1120305088 14:82759897-82759919 GGTTGGCTAAGACATAAATCTGG + Intergenic
1151673959 17:75588626-75588648 GCTCGGAAGGGACAAAAACCGGG + Intergenic
1152034879 17:77865911-77865933 GGCCCGATGAGACAATTATCCGG - Intergenic
1153151862 18:2105107-2105129 GGCGGGATGAGACAGAAAGCAGG - Intergenic
1154248871 18:12726070-12726092 GGTCTGACGAGACTAAAATCAGG + Intergenic
1154447365 18:14446256-14446278 GGTAGCCTGAGTCAAAAATCAGG - Intergenic
1157948034 18:52003091-52003113 GCTGAGAAGAGACAAAAATCAGG - Intergenic
1158183636 18:54746287-54746309 GGTCGGATGAGACAAAAATCAGG + Intronic
1165425829 19:35744991-35745013 GGTCCAATGAGAAAAAAAGCCGG + Intronic
928488710 2:31758635-31758657 GGTTGATTGAGACAGAAATCTGG + Intergenic
935079183 2:99775568-99775590 GGTAGGAGGAGGGAAAAATCAGG + Intronic
935271915 2:101442241-101442263 TGTTTGATGAAACAAAAATCAGG - Intronic
938482720 2:131674616-131674638 GGTAGCCTGAGTCAAAAATCAGG + Intergenic
939895061 2:147781788-147781810 GGTTGGATTAAACAAAAATAGGG - Intergenic
944186087 2:196950359-196950381 AGTAGGAGGAGACAAAAATAGGG + Intergenic
944937083 2:204580464-204580486 GGTCAGATGACAGAAAAATGAGG - Intronic
1169307696 20:4507222-4507244 GGGCAGAAGAGAGAAAAATCTGG - Intergenic
1174108250 20:48178594-48178616 GGTCAGATGAAGCAAAAATTAGG - Intergenic
1174336721 20:49867506-49867528 TGTCGGATGAAACAAGAAGCTGG - Intronic
1175430365 20:58897785-58897807 AGTTGGATGAGATAAAAATAAGG - Intronic
1176348670 21:5772614-5772636 GATCAGATGGGAAAAAAATCTGG - Intergenic
1176355484 21:5893198-5893220 GATCAGATGGGAAAAAAATCTGG - Intergenic
1176448829 21:6844407-6844429 GGTAGCCTGAGTCAAAAATCAGG + Intergenic
1176496157 21:7551841-7551863 GATCAGATGGGAAAAAAATCTGG + Intergenic
1176542991 21:8170684-8170706 GATCAGATGGGAAAAAAATCTGG - Intergenic
1176561942 21:8353729-8353751 GATCAGATGGGAAAAAAATCTGG - Intergenic
1176826999 21:13709430-13709452 GGTAGCCTGAGTCAAAAATCAGG + Intergenic
1183993686 22:41617054-41617076 GTTTGGATGAGAAAAAAAGCTGG - Intronic
1184898802 22:47430837-47430859 GGCAGGATGAGAGAACAATCAGG + Intergenic
1203247860 22_KI270733v1_random:86933-86955 GATCAGATGGGAAAAAAATCTGG - Intergenic
952264069 3:31768353-31768375 GGTCAGATTAGCCAAAAATTGGG - Intronic
963851654 3:150216000-150216022 GGTTGGGTGAGAAAAAAATCAGG + Intergenic
985460977 4:190106589-190106611 GGTGGGAAGAAACATAAATCTGG - Intergenic
987079177 5:14411023-14411045 GGACAGATGAGATAAGAATCTGG - Intronic
988689495 5:33558253-33558275 GGTCAGAAAAAACAAAAATCAGG + Intronic
994399386 5:99260235-99260257 GGTCTGATGAGACAATAATTGGG + Intergenic
995875752 5:116787570-116787592 GGTGGGTTCAGACAGAAATCTGG - Intergenic
1000686566 5:164256805-164256827 TGAAGGATGAGACAAAATTCTGG - Intergenic
1003455656 6:6279402-6279424 GGTCAGATGGGGCAAAAAGCTGG - Intronic
1004275627 6:14233014-14233036 GGTGGGAGGAGAGAGAAATCGGG + Intergenic
1010064666 6:71668402-71668424 GTTCTGAGGAGACAAAACTCTGG + Intergenic
1022437086 7:30398538-30398560 GGTTGGAAGATACAAAAAGCAGG - Intronic
1028485029 7:91348263-91348285 GGAAGGCTGAGACAAAGATCTGG - Intergenic
1028745536 7:94322069-94322091 GCTCAGATGAGACAAAAGACAGG - Intergenic
1038691143 8:29764793-29764815 GGAAGGATGGGACACAAATCTGG - Intergenic
1044187677 8:89275330-89275352 GTTCGCTTGAGACTAAAATCTGG - Intergenic
1046832566 8:118762432-118762454 GGTAGAATGAGGCAAAAAACTGG - Intergenic
1052961838 9:34304890-34304912 GGTAGGAAGAAAAAAAAATCTGG - Intronic
1055320408 9:75078420-75078442 GGTCAGAAGAGACAAATAACTGG - Intronic
1058164698 9:101606354-101606376 GGTAGGAGGAGACCAAACTCAGG + Intronic
1062461350 9:136663802-136663824 GGACGTATGAGACAAAAAGTGGG - Intronic
1203520360 Un_GL000213v1:40110-40132 GGTAGCCTGAGTCAAAAATCAGG - Intergenic
1203464260 Un_GL000220v1:70168-70190 GATCAGATGGGAAAAAAATCTGG - Intergenic
1191007939 X:55730508-55730530 GGTAGTAGGAGAAAAAAATCAGG - Intronic
1191602779 X:63027789-63027811 GCTCAGATGACACAAAAATATGG - Intergenic
1194626104 X:96228191-96228213 GGTGGCATGAGAAAAAAATTAGG + Intergenic
1196988718 X:121303707-121303729 GTTCGGAAGAGACAAAACTTTGG - Intergenic
1197655159 X:129108764-129108786 AGTCAGATGAGACAAATATATGG - Intergenic
1198366433 X:135944948-135944970 GATAGGATGAGGCAGAAATCTGG - Intergenic
1198804759 X:140483083-140483105 GTTCTGTTTAGACAAAAATCTGG + Intergenic
1199507228 X:148577744-148577766 TGTAAGATGAGAGAAAAATCTGG - Intronic