ID: 1158186301

View in Genome Browser
Species Human (GRCh38)
Location 18:54775749-54775771
Sequence GGGAGTTTCATGAGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158186301 Original CRISPR GGGAGTTTCATGAGCATTTC AGG (reversed) Intronic
900871166 1:5304387-5304409 GGGATTTTGGTGAGCATTTGGGG - Intergenic
901962775 1:12840627-12840649 GGGATGTTGATGAGAATTTCTGG - Intergenic
901965068 1:12859722-12859744 GGGATGTTGATGAGAATTTCTGG + Exonic
901969338 1:12895113-12895135 GGGATGTTGATGAGAATTTCTGG - Exonic
901988978 1:13097237-13097259 GGGATGTTGATGAGAATTTCTGG - Intergenic
901989966 1:13104930-13104952 GGGATGTTGATGAGAATTTCTGG - Intergenic
901992835 1:13129530-13129552 GGGATGTTGATGAGAATTTCTGG + Intergenic
902020859 1:13344565-13344587 GGGATGTTGATGAGAATTTCTGG - Exonic
903735218 1:25525690-25525712 AGGAGTTTCATGGCCATGTCTGG + Intergenic
904718594 1:32488599-32488621 GGGACTGTCCTGTGCATTTCAGG - Exonic
906216604 1:44044610-44044632 GGGAGTTTCCAGTGCATTGCGGG - Intergenic
906837878 1:49103499-49103521 GGCAGTCTCATGTGCATTTGGGG - Intronic
907683836 1:56590661-56590683 GGGGGTTGCATCAGCATTTCTGG - Intronic
913967466 1:143388915-143388937 TGCACTTTCATGAGCATCTCAGG + Intergenic
914061841 1:144214509-144214531 TGCACTTTCATGAGCATCTCAGG + Intergenic
914117309 1:144751845-144751867 TGCACTTTCATGAGCATCTCAGG - Intergenic
914456432 1:147841277-147841299 GGGATGTTGATGAGAATTTCTGG + Intergenic
914762837 1:150612834-150612856 GGGACTGTCCTGTGCATTTCAGG - Intronic
918469794 1:184860195-184860217 AGGAGTTTAATGGGCATTTTAGG + Intronic
918506513 1:185260583-185260605 GGCAGTTTCATGAGAATGTTGGG + Intronic
924104568 1:240637332-240637354 GGGAATTTGATTTGCATTTCTGG + Intergenic
1063440016 10:6065259-6065281 GGAAGTTTCAGGAGCATTATGGG + Intergenic
1066467312 10:35664411-35664433 TGGTCTTTCATGGGCATTTCTGG + Intergenic
1066755896 10:38712996-38713018 GGGAGTGTCATTATCATTCCTGG + Intergenic
1068739057 10:60448217-60448239 GGGAGATTCATTATTATTTCTGG + Intronic
1069959204 10:72069792-72069814 TGGATTTTTATGAGGATTTCAGG - Intronic
1073633627 10:105174993-105175015 GTGAGTGCCATGAGCATTGCAGG - Intronic
1074961054 10:118446474-118446496 AGCAGTTCCATGAGCAGTTCAGG - Intergenic
1075565541 10:123501213-123501235 GGGATTTTCACTAACATTTCAGG + Intergenic
1077975063 11:7239321-7239343 GGGTGTTTCATCATCCTTTCTGG + Intronic
1079526922 11:21401666-21401688 GGCAGACTCATTAGCATTTCTGG + Intronic
1083050301 11:59770942-59770964 GGGAATTTCATGGACATCTCTGG + Intronic
1083720696 11:64602165-64602187 AGGAGTTTCACGGGCATCTCAGG - Exonic
1083925368 11:65802997-65803019 AGGAGTTTCATAAGCACTTGAGG - Intergenic
1087116091 11:94526369-94526391 GAGAGTTTCAGATGCATTTCTGG + Intergenic
1088777366 11:113098797-113098819 GAAAGTTTCATGAGCATTTCAGG - Intronic
1089575976 11:119444067-119444089 AGCAGTTTCTTGAGCATTTCTGG + Intergenic
1090327702 11:125903707-125903729 GAGATTTTGATCAGCATTTCTGG - Intronic
1095139801 12:38647556-38647578 GGGAGTTTGATGAGCATTTGAGG + Intronic
1097858713 12:64495421-64495443 GGGACTGTGATGATCATTTCTGG + Intronic
1099315292 12:81076626-81076648 GGTACTTTCATGAGAATTACAGG + Intronic
1099618526 12:84971704-84971726 GGGACTTCCTTGAGCATTTCAGG - Intergenic
1104330272 12:127838174-127838196 GGGAGTTTCAAGAGTAGTTTTGG - Intergenic
1106055898 13:26236490-26236512 GGGAGTTTCATTTGAATATCAGG - Intergenic
1106294731 13:28401385-28401407 GATAGTTTTATGAGCATTCCTGG - Intronic
1107773358 13:43811812-43811834 GGGAGATTCCATAGCATTTCTGG - Intergenic
1113505167 13:110811742-110811764 GGGAGCTTCCTGGGAATTTCAGG - Intergenic
1114205064 14:20563115-20563137 GAGATTTTCATCTGCATTTCAGG + Intergenic
1114730224 14:24985377-24985399 GGCAGTTTTATGAGCCTTGCAGG + Intronic
1117133517 14:52709553-52709575 GGGATTTTCATGTCCCTTTCAGG + Intronic
1118433109 14:65742226-65742248 GGGAATTTCATCTGCAGTTCGGG - Exonic
1123110084 14:105863131-105863153 TGGGGTTTCCTGAGCATTGCAGG - Intergenic
1123440160 15:20285050-20285072 GGGAGTGTCATTATCATTCCTGG + Intergenic
1123975014 15:25545143-25545165 GGGAGTTTAATCAGCATTACTGG - Intergenic
1124076627 15:26452119-26452141 GGCAGTTTCGTGTGCATTTTTGG + Intergenic
1131629865 15:94165378-94165400 AGGAGTTTCAAGAGCTTTCCGGG - Intergenic
1132987244 16:2773899-2773921 GGGAGTGCCAAGAGCATATCTGG - Intronic
1133422204 16:5655422-5655444 AGGCTTTTCATGAGCATATCTGG + Intergenic
1134322109 16:13173654-13173676 GGGACTGTCCTGTGCATTTCAGG - Intronic
1136451568 16:30356819-30356841 AGGAGTTGCATGAGCACTTTGGG + Intergenic
1136726783 16:32363874-32363896 GGGAGTGTCATTATCATTCCTGG - Intergenic
1138751370 16:59426167-59426189 AAGAGTTTAATGAGCATATCTGG - Intergenic
1141516109 16:84546245-84546267 GGGAGTGTCCTGTGCATTGCAGG + Intronic
1141583576 16:85017909-85017931 GGGATATTCATGAACATTCCTGG + Intergenic
1202999651 16_KI270728v1_random:153884-153906 GGGAGTGTCATTATCATTCCTGG + Intergenic
1203131249 16_KI270728v1_random:1690284-1690306 GGGAGTGTCATTATCATTCCTGG + Intergenic
1142914907 17:3128440-3128462 GGGAGTTTCATGAGGAACTGGGG - Intergenic
1150857959 17:68771358-68771380 GGGAGTGTCATGGGTTTTTCAGG - Intergenic
1157200929 18:45658998-45659020 GGGCCTTTCAGGACCATTTCAGG - Intronic
1158186301 18:54775749-54775771 GGGAGTTTCATGAGCATTTCAGG - Intronic
1160429920 18:78804207-78804229 GGGAGTGTCATGAGCTTGGCGGG + Intergenic
1161671954 19:5617697-5617719 GGGAGTATCCTGTGCATTGCAGG - Intronic
1164738343 19:30558942-30558964 GGTTGTTCAATGAGCATTTCTGG - Intronic
1166010443 19:39937144-39937166 GTGAGTTTCATGGGTGTTTCTGG + Intergenic
1166581189 19:43901634-43901656 TGGAGTTTCAGTAGAATTTCAGG - Intergenic
1166653460 19:44592824-44592846 GGGTCATTCATGAGTATTTCAGG - Intergenic
1168309465 19:55453125-55453147 AGGAGTCTCATTTGCATTTCCGG + Exonic
1202701252 1_KI270712v1_random:166383-166405 TGCACTTTCATGAGCATCTCAGG + Intergenic
924989931 2:305079-305101 TGGAGTTTCAAAAGCATTTGTGG + Intergenic
925526363 2:4806910-4806932 GAGATTTTCTTGAGCACTTCAGG - Intergenic
925987112 2:9225630-9225652 GGGAGTGACATGAGCATAGCTGG + Intronic
926882179 2:17557979-17558001 GGGTGCTGCAGGAGCATTTCTGG + Intronic
926989493 2:18662347-18662369 GGCAGTTTCTTGACCATTTCAGG + Intergenic
931157661 2:59653761-59653783 GTTAGTTACATGAGGATTTCTGG + Intergenic
934172169 2:89549820-89549842 TGCACTTTCATGAGCATCTCAGG + Intergenic
934282481 2:91624172-91624194 TGCACTTTCATGAGCATCTCAGG + Intergenic
934319199 2:91957235-91957257 GGGAGTGTCATTATCATTCCTGG + Intergenic
935262242 2:101365341-101365363 TGGAGTTTCAAGGGCAGTTCTGG - Intronic
935315006 2:101824060-101824082 GGATGTTTCCTGAGCATTTGTGG + Intronic
940385625 2:153068015-153068037 GAGATTTTCATGATCATTTCAGG + Intergenic
941893651 2:170608035-170608057 GGCAACTTCATAAGCATTTCTGG - Intronic
943958233 2:194221811-194221833 CGAAGTTTCAAGAGCATTTAAGG - Intergenic
944909978 2:204301000-204301022 GGGAGTCTCATGTTCACTTCTGG + Intergenic
945256526 2:207807845-207807867 GGGTTTTTCATGAAGATTTCTGG + Intergenic
945878682 2:215304769-215304791 GGGTGTGTCGTGAGCATTTCAGG - Intergenic
1169702007 20:8457239-8457261 GGGAGTAACATGAGCTTTGCAGG + Intronic
1170128700 20:12994941-12994963 GGGAGTCTGATGAGCAATACGGG - Intergenic
1171110292 20:22474413-22474435 AGGAGTTTCAGGAGCAGCTCTGG - Intergenic
1171453459 20:25252566-25252588 CTGAGTTTCATGAGCCATTCTGG - Intronic
1172490108 20:35329601-35329623 GGGTGTGCCATGAGTATTTCTGG - Intronic
1174204734 20:48829984-48830006 GGGCGTGTCCTGTGCATTTCAGG + Intergenic
1179197841 21:39182940-39182962 GAGCGTTTCTGGAGCATTTCTGG - Intronic
1180307378 22:11140881-11140903 GGGAGTGTCATTATCATTCCTGG + Intergenic
1180545898 22:16503104-16503126 GGGAGTGTCATTATCATTCCTGG + Intergenic
1181665325 22:24391563-24391585 GGGAGTGAAATGAGCATTTAAGG - Intronic
1182213275 22:28694296-28694318 GGGAGTGTCATTATCATTCCTGG - Intronic
1182227191 22:28808079-28808101 GGAAGTTTCATCAGCATTCCAGG - Intergenic
1183240861 22:36657406-36657428 GGGAGTAGCATGAGCTTTCCAGG - Intronic
1183399891 22:37596579-37596601 GGGGGTTCCAGGAGTATTTCTGG - Intergenic
950308368 3:11934415-11934437 GAGAGTTTCTTGACCATTGCAGG + Intergenic
951053401 3:18119993-18120015 GGGAGTTTCACTTGCATTTTTGG + Intronic
952273346 3:31853614-31853636 GGGAGTTAATTGAGCATTTTGGG - Intronic
953003250 3:38953856-38953878 GGGAGTTTCAAGAGAAATTTTGG - Intergenic
953486193 3:43298972-43298994 GAGGGTTTCATGAGCCTTTAGGG + Intronic
954764864 3:52905674-52905696 GGGAGATTCAAGAGCTTATCGGG - Intronic
954920737 3:54188697-54188719 GAGATTTTCATGAGTTTTTCAGG + Intronic
955153936 3:56397090-56397112 GAGAGTTTCAGCAGCATGTCGGG + Intronic
956018241 3:64907246-64907268 GGGAGTTTCTTATGGATTTCTGG - Intergenic
957342433 3:78918010-78918032 GGCATTTCCATGTGCATTTCTGG - Intronic
957788304 3:84908567-84908589 GGTGGTTTCATGGGAATTTCAGG - Intergenic
958452508 3:94291705-94291727 GATAGTTTCAGTAGCATTTCTGG + Intergenic
960858426 3:122126714-122126736 AGGAGTTGTAGGAGCATTTCTGG - Intergenic
964244042 3:154629997-154630019 TGGAGTTTCAGGAGCATTGCTGG + Intergenic
964998822 3:162925647-162925669 GGTGGTTTCCTGAGCATTCCTGG + Intergenic
965724482 3:171699797-171699819 GGGCGTTTCAGGAAGATTTCTGG + Exonic
967279041 3:187804733-187804755 GGCAGTTTCAGGAGTTTTTCAGG + Intergenic
967534762 3:190589583-190589605 GGCAGTTTCCTGAGAATTGCTGG + Intronic
972690414 4:41392015-41392037 GGCATTTTCAAGAGAATTTCAGG - Intronic
972811064 4:42586421-42586443 GACAGTTTGATGAGGATTTCTGG - Exonic
976572663 4:86631635-86631657 GGGATCTTTATGAACATTTCTGG - Intronic
985189567 4:187357497-187357519 TGAAGCTTCTTGAGCATTTCAGG - Intergenic
993897320 5:93552049-93552071 AGGAGCTTAATGAGCATTTGTGG - Intergenic
999812251 5:155138772-155138794 AGGGGTTTCATGAGCTTTCCAGG + Intergenic
1002665514 5:180820867-180820889 GGGAGTTTCATTATCATATCAGG - Intergenic
1003041585 6:2692957-2692979 GGGAATGTCACGAGCATTACAGG + Intronic
1003929090 6:10906104-10906126 GGGGGTTTTATGAGCATCTTGGG + Intronic
1003966518 6:11257210-11257232 GAGAGTATCCTGTGCATTTCAGG + Intronic
1005336198 6:24799089-24799111 GTGAGATTCATGCGCATTACGGG - Intronic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1012215909 6:96583528-96583550 GGGAGCTGCATGAGCCTTTCTGG - Intronic
1017618383 6:156269507-156269529 GAGACTTTCATGAGCATTTCAGG - Intergenic
1021006513 7:15400977-15400999 GGGAGTTTCATTAACCTTTTAGG - Intronic
1023264720 7:38392995-38393017 GGGAGTTTCATCAGCAGAACGGG + Intronic
1036254635 8:7195480-7195502 GGGGGTTCCCTGTGCATTTCAGG - Intergenic
1036362856 8:8092008-8092030 GGGGGTTCCCTGTGCATTTCAGG + Intergenic
1036888105 8:12575065-12575087 GGGGGTTCCCTGTGCATTTCAGG - Intergenic
1036895708 8:12633180-12633202 GGGGGTTCCCTGTGCATTTCAGG - Intergenic
1037515911 8:19631755-19631777 GGCACTTTCTTTAGCATTTCTGG + Intronic
1038134805 8:24773734-24773756 GGTAGTTTGTTGAGCATTGCAGG + Intergenic
1038431617 8:27504888-27504910 GGGGGTATCTGGAGCATTTCAGG + Intronic
1042315547 8:67422568-67422590 GTGGGTTTGATGAGCATCTCTGG + Exonic
1048164498 8:132050459-132050481 GTGAGTTTCATGAACATCCCTGG - Intronic
1048175141 8:132145123-132145145 GGGAATTTCCTGTGCATTGCAGG - Intronic
1053280438 9:36816931-36816953 AGGAATTTCATGAGCATTTTGGG + Intergenic
1055748851 9:79481735-79481757 GGGAGGTTCTTGTGCATTCCTGG + Intergenic
1194287548 X:92029073-92029095 GGGAGTGTAATAAGCCTTTCTGG - Intronic
1194551778 X:95309647-95309669 AGGAGTTTTATCAGCAATTCAGG + Intergenic
1195008029 X:100706077-100706099 GGGATTTTCATGGGCAGTTGTGG - Intronic
1195036505 X:100974951-100974973 GGGAAATTGATGAGCACTTCAGG - Intronic
1197571587 X:128156801-128156823 GGCAGTTGCAGGACCATTTCTGG + Intergenic
1198061722 X:133052664-133052686 GGGACTGCCATGTGCATTTCAGG + Intronic
1200360437 X:155599930-155599952 GGGACTGTCCTGAACATTTCAGG - Intronic
1200605087 Y:5253640-5253662 GGGAGTGTAATAAGCCTTTCTGG - Intronic
1200881265 Y:8214109-8214131 GGGAGTTTCATTCTCCTTTCAGG + Intergenic
1201186735 Y:11412348-11412370 GGGAGTGTCATTATCATTCCTGG + Intergenic
1202056534 Y:20838788-20838810 TGGAGTTTTATAAGAATTTCAGG + Intergenic
1202351979 Y:24002513-24002535 GGGTGTTAGATGAGTATTTCAGG - Intergenic
1202518800 Y:25667606-25667628 GGGTGTTAGATGAGTATTTCAGG + Intergenic