ID: 1158190077

View in Genome Browser
Species Human (GRCh38)
Location 18:54817714-54817736
Sequence CTGACTGTGTAGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158190077_1158190080 -6 Left 1158190077 18:54817714-54817736 CCATCCACCTTCTACACAGTCAG 0: 1
1: 0
2: 0
3: 37
4: 326
Right 1158190080 18:54817731-54817753 AGTCAGTGTAGTGAACCTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158190077 Original CRISPR CTGACTGTGTAGAAGGTGGA TGG (reversed) Intronic
900354595 1:2254195-2254217 CTGATTGTGAAGAATCTGGAAGG + Intronic
900664970 1:3809045-3809067 CTCACAGGGTGGAAGGTGGAGGG + Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900841177 1:5049783-5049805 CAGACTGTGTAGAGGCGGGAAGG - Intergenic
900973358 1:6003437-6003459 CTAAGAGTGGAGAAGGTGGACGG - Intronic
902049301 1:13549280-13549302 CTCACAGGGTAGAGGGTGGAAGG + Intergenic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
909428443 1:75556047-75556069 GTGATGGTGTAGAAGGAGGAGGG + Intronic
909980809 1:82098420-82098442 CGAACTGTGGAGAGGGTGGAGGG + Intergenic
911020463 1:93381914-93381936 GTGACTGGGTAGATGGTGAAGGG - Intergenic
911431942 1:97800797-97800819 TTGACTCTACAGAAGGTGGAAGG - Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
916201183 1:162273045-162273067 CTGGCTGTGTATAGGCTGGAGGG + Intronic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
917574154 1:176302808-176302830 CTGACAGTTTAGAAGTTGGTAGG - Intergenic
917584287 1:176410118-176410140 CTGGCTGTGGAGATGGTGCAAGG + Intergenic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
920447858 1:206033484-206033506 CTGACTGTGAAGACAGAGGAAGG - Intergenic
920827039 1:209431935-209431957 CTGTCTGTGCAGCAGGTGCAAGG + Intergenic
920842398 1:209565733-209565755 CTGACTGTGAGTCAGGTGGATGG - Intergenic
922048722 1:221970317-221970339 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
922162968 1:223091660-223091682 CAGACTTGGCAGAAGGTGGAAGG + Intergenic
922935209 1:229417306-229417328 CTGACTGTATAGAGGTGGGAAGG - Intergenic
923876056 1:238048703-238048725 CTCACTGTGTAGATGTTGGTGGG + Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064680153 10:17803195-17803217 CTGAGTGGGTAGGAGGTGGCTGG + Intergenic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1065438041 10:25721598-25721620 CAGACTGTATAGAAGTGGGAAGG - Intergenic
1066283844 10:33944737-33944759 CTGAATATGTAAAAGATGGAAGG + Intergenic
1066687113 10:37991827-37991849 CTTACTGTGTGGAGGCTGGAAGG + Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1070362720 10:75706792-75706814 CTGACTCCGTAAAAGCTGGATGG - Intronic
1071465911 10:85939528-85939550 CTGATTGTGAAGATGGAGGAAGG - Intronic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1072545383 10:96432955-96432977 CTGACTGTGTTGCAGATGGCCGG - Exonic
1075989040 10:126817292-126817314 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1076234183 10:128851048-128851070 CTGAGTTTGTAACAGGTGGAAGG - Intergenic
1076585759 10:131546434-131546456 GTGCCTGTGGAGAAGGTGGAGGG - Intergenic
1077172244 11:1172287-1172309 CTGAGTGTGTAGCAGGATGAAGG + Intronic
1077889071 11:6405702-6405724 ATGGCTGCCTAGAAGGTGGATGG - Intronic
1078004051 11:7519092-7519114 CTGACTGGGAAGATGGTGGCTGG + Intronic
1078826785 11:14937546-14937568 CTGACTGTAGAGATGGGGGAGGG - Intronic
1079105963 11:17572558-17572580 CTGACTGTGTAGAAAGAACAAGG - Intronic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1079536311 11:21519612-21519634 GTGAATGTGTGGGAGGTGGAAGG + Intronic
1079832611 11:25287631-25287653 CTGACTGTTTAGTAGGTCCAGGG - Intergenic
1084185107 11:67467409-67467431 GTGAATGTGAAGGAGGTGGAGGG + Intronic
1084430218 11:69106796-69106818 CTGAGTGGGAAGATGGTGGAGGG - Intergenic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085519561 11:77130145-77130167 CTGACTGAGCAGAAGGTCAAGGG - Intronic
1085996012 11:81914928-81914950 CTGATTGTGTAGAAGGGATACGG - Intergenic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088619128 11:111664073-111664095 CTTACTGGCTGGAAGGTGGAAGG - Intronic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1091184027 11:133631376-133631398 CAGACTGTATAGAGGTTGGAAGG - Intergenic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1094492264 12:30968311-30968333 GTGCCTGTGTGGAAGCTGGATGG - Intronic
1095282705 12:40374605-40374627 GTCAGTGAGTAGAAGGTGGACGG - Intergenic
1098437313 12:70481668-70481690 GTGGCAGTGTGGAAGGTGGATGG + Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1099720111 12:86350379-86350401 CTAACTGTGTAGCAGGTCCATGG + Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1101049122 12:100842732-100842754 CTTACATGGTAGAAGGTGGAAGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101797464 12:107988666-107988688 GTAACTGGGTAGATGGTGGATGG + Intergenic
1103288623 12:119825295-119825317 CTGACTGTGATGAACGGGGATGG - Exonic
1103717239 12:122952022-122952044 CTCACGCTGCAGAAGGTGGAAGG - Intronic
1104630993 12:130401997-130402019 CTGGCTGAGTAGAATGTGGGTGG + Intronic
1104946650 12:132417632-132417654 CTGACTTTGTGGACCGTGGAGGG - Intergenic
1105911170 13:24869275-24869297 CTTACTGTGTAAAAGGCTGAAGG - Intronic
1106167206 13:27258650-27258672 CTGACTGTGTAGAATCTCAAAGG - Intergenic
1106896881 13:34312752-34312774 ATGACTGGGTGGAAGATGGAAGG + Intergenic
1108709215 13:53016544-53016566 CTGACTGTGAAGGTGGAGGAAGG + Intergenic
1109491373 13:63104865-63104887 CTGGCTCTGAAGATGGTGGAAGG - Intergenic
1110360130 13:74615367-74615389 ATGAATGTGTACCAGGTGGAGGG + Intergenic
1110823739 13:79947266-79947288 CTAACATGGTAGAAGGTGGAAGG - Intergenic
1111565644 13:90011606-90011628 CTGACTTTGTAATAAGTGGATGG - Intergenic
1111710828 13:91812065-91812087 CTGACTGTGAATAAAGTGGCAGG + Intronic
1112002909 13:95228380-95228402 CAGACTGAGTAGGAAGTGGAAGG - Intronic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113429730 13:110239698-110239720 CTGAATATGCAGAAGGTGGCAGG + Intronic
1118071184 14:62248313-62248335 CTGAATCTGTGGAAGGTGCAGGG - Intergenic
1120222209 14:81747153-81747175 TTGACAGGGTAGAAGGTGGCAGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121894368 14:97632041-97632063 ATGCCAGTGGAGAAGGTGGATGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1121960885 14:98258351-98258373 CTCACTTGGCAGAAGGTGGAGGG + Intergenic
1202908805 14_GL000194v1_random:97951-97973 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1124347548 15:28932579-28932601 CTGACAGTGGAGATGGTGGACGG + Intronic
1125141928 15:36418500-36418522 TTGACTGTGTAGTAGGTGCTGGG + Intergenic
1125298259 15:38226048-38226070 CTCACATAGTAGAAGGTGGAAGG - Intergenic
1125450192 15:39799845-39799867 CAGACTGGGTAGAAGAGGGAGGG - Intronic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130321278 15:82844184-82844206 CTGAATGAGTACAAGGGGGATGG + Intronic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132879657 16:2156409-2156431 CTGTCTGTCTAGATGGGGGATGG - Intronic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1134527737 16:14957416-14957438 CTGACTTTGAAGATGTTGGATGG - Intergenic
1138382287 16:56610996-56611018 CTGACTGTGTACCAGGGGGAGGG + Intergenic
1139238562 16:65366560-65366582 CTGACTGTTGGGAAAGTGGATGG - Intergenic
1139638537 16:68274294-68274316 ATGACTGTGTACCAGGTGCAGGG + Intronic
1139943401 16:70622132-70622154 CAGACTGTATAGAGGGGGGAAGG + Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1141086090 16:81096417-81096439 CTGACTGGGCAGAGCGTGGAGGG + Intergenic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141447534 16:84071391-84071413 CTGGCTGTGTGGATTGTGGAGGG - Intronic
1142824088 17:2496837-2496859 CTCACAGGGTGGAAGGTGGAAGG - Intronic
1143760843 17:9102971-9102993 GTGACTGTGGAGGAGGTGGCAGG + Intronic
1144121515 17:12158537-12158559 CTGGCTGTGGAGAAAGGGGAAGG - Intergenic
1146096701 17:29937121-29937143 TGGCCTGTGAAGAAGGTGGATGG - Intronic
1146505737 17:33403331-33403353 CTGACTGAGGAGAAGGCAGAAGG - Intronic
1146535036 17:33642604-33642626 CTGACAGGATAGAAGGTTGATGG - Intronic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1147652852 17:42072051-42072073 ATGACTGTGAATGAGGTGGAGGG + Intergenic
1148879335 17:50713778-50713800 ATCAGTGTGTAGCAGGTGGAGGG + Intergenic
1149927579 17:60716904-60716926 CAGACTGTGTTGAAGGTGCTGGG + Intronic
1150656232 17:67041643-67041665 CTGGCTGCGGAGCAGGTGGAAGG - Intergenic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1151553852 17:74836841-74836863 CAGACTGGGTGGAAGGTGGGTGG - Exonic
1152372191 17:79895884-79895906 CTCACTTGGTGGAAGGTGGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1154331238 18:13430517-13430539 CTCACTGTGTACAACGTGGTAGG - Intronic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156646715 18:39171663-39171685 GTGAAGGAGTAGAAGGTGGAGGG + Intergenic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158421133 18:57295534-57295556 CTGACCGGGTGGTAGGTGGAGGG - Intergenic
1159112973 18:64081927-64081949 ATGGCTGTGATGAAGGTGGAGGG + Intergenic
1159781268 18:72663371-72663393 CTGACTGTCCATGAGGTGGAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1161356657 19:3822955-3822977 CCGTCTGTCTGGAAGGTGGAAGG - Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163638133 19:18446946-18446968 ATGACTGTGTGGCAGGTGCAAGG + Intronic
1164236939 19:23345758-23345780 CTGACTGGGAAGATGGTGGCTGG - Intronic
1164774998 19:30845967-30845989 CTGACTGGGTAGGGGGTGGATGG + Intergenic
1165164518 19:33842176-33842198 CTCACTGTATTGAATGTGGAGGG + Intergenic
1165487904 19:36106455-36106477 TTGACTGTATAGAAGGTGAGTGG - Intergenic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925342774 2:3148466-3148488 CTGACTGTGGGGAAGGATGAGGG - Intergenic
925457293 2:4027030-4027052 CTGGCTGAGTGGAAGCTGGAGGG + Intergenic
925763224 2:7206753-7206775 CTGACTTTGCAGCAGCTGGATGG - Intergenic
925942195 2:8831321-8831343 GTGACTATGTAGAGGGTGGGAGG - Intronic
926877405 2:17496840-17496862 CTGACAGTGGAGAAGGTTTAGGG - Intergenic
926933506 2:18063766-18063788 CTCACTGTGTAGAAGATGGGGGG - Intronic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931827896 2:66020213-66020235 AAGACTGTGTAGAAGGTGATTGG + Intergenic
932365601 2:71151098-71151120 CTCACTTGGCAGAAGGTGGAAGG + Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
932829749 2:74977738-74977760 CTGACTGTGGAGAAGTGGAAAGG + Intergenic
934169422 2:89327230-89327252 ATGACTGTGAGGAAGGAGGAAGG + Intergenic
934197872 2:89855355-89855377 ATGACTGTGAGGAAGGAGGAAGG - Intergenic
934790236 2:97053654-97053676 GTGACTGTGAGGAAGGAGGAAGG - Intergenic
934816232 2:97328883-97328905 GTGACTGTGAGGAAGGAGGAAGG + Intergenic
934821464 2:97379601-97379623 GTGACTGTGAGGAAGGAGGAAGG - Intergenic
937301608 2:120846172-120846194 GTGGCTTTGAAGAAGGTGGAAGG - Intronic
937487203 2:122327521-122327543 CTGAGAGTGTAGATGTTGGAAGG + Intergenic
937524111 2:122746096-122746118 CTGACAGTGTAGAAAGTACACGG + Intergenic
938510901 2:131942307-131942329 CTGATTTTGTAGTAGGTGGCTGG + Intergenic
938613476 2:132973128-132973150 GTGACGGTGTAGAAGGCAGAAGG - Intronic
938783204 2:134603807-134603829 GTGAGTGTATATAAGGTGGAAGG + Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
940195033 2:151084538-151084560 CTGAATGTGTACCAGGTGCAAGG + Intergenic
942931232 2:181495848-181495870 TTGACTGTGTTGAAAATGGATGG + Exonic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
947364262 2:229378069-229378091 CTGACTTTGAAGAAGGCAGAAGG + Intronic
947634782 2:231674428-231674450 CTCACTGTGTACCAGCTGGATGG + Intergenic
947797102 2:232901593-232901615 CTGGCCGTGAGGAAGGTGGAGGG - Intronic
947842396 2:233216425-233216447 CTGACTGTATAGAGGTGGGAAGG + Intronic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948479870 2:238242569-238242591 CTGACAGTGGAGTGGGTGGAGGG + Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
1169889069 20:10433723-10433745 CTGACTGTCTGGAGGGTGCACGG - Intronic
1170028909 20:11923484-11923506 CTGGCTGTGTAGAAGGTGTCTGG - Exonic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170693595 20:18637278-18637300 CTGCCTGTGTGGCAGGGGGAAGG - Intronic
1171238177 20:23544898-23544920 CTCACGTGGTAGAAGGTGGAAGG - Intergenic
1172972502 20:38883588-38883610 CTGCCTGTGTAGGGGGTGGCGGG + Intronic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1175057205 20:56209108-56209130 CTGGCTAGGCAGAAGGTGGAGGG - Intergenic
1175794347 20:61762204-61762226 GTGACTGTGTAGAATGGTGATGG - Intronic
1176231090 20:64033286-64033308 AAGACTGTGGAGAAGGTGGTAGG + Intronic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176628166 21:9112614-9112636 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1178049839 21:28735483-28735505 CTGACTGTCTTGGAGATGGAGGG - Intergenic
1179126657 21:38596895-38596917 GTGACTGAGTTGAAGGTGGGTGG - Intronic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180378983 22:12120793-12120815 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180661691 22:17473058-17473080 TTGAGGGTGGAGAAGGTGGAAGG + Intronic
1182455168 22:30445685-30445707 CTGACTGTGTAGAGGGTCATAGG - Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183612294 22:38917351-38917373 CTGACTCTATGGAAAGTGGAAGG - Intergenic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1185366433 22:50439036-50439058 CTGACTGTGTGGGGGCTGGACGG - Intronic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
952319475 3:32262502-32262524 ATCACTGTGTTGGAGGTGGAAGG + Intronic
953202463 3:40789709-40789731 CTGACTTTGAAGAAGGGGAAAGG + Intergenic
953552590 3:43915232-43915254 CTGGCTGTCTAGAAGGGGGTTGG + Intergenic
954148396 3:48645639-48645661 CTGTCTCTGTAGAGGCTGGAGGG - Exonic
955193009 3:56779316-56779338 ATGACAGTGGAGAAAGTGGATGG + Intronic
955203702 3:56876179-56876201 CTGCATGTGTAAAAGGTGGAAGG + Intronic
955837729 3:63076008-63076030 GTGTGTGTGTAGGAGGTGGAGGG + Intergenic
956313404 3:67907241-67907263 CTGACTTTCTACCAGGTGGAAGG - Intergenic
958183187 3:90085441-90085463 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959080361 3:101794441-101794463 CTGGCTGTGAAGAAGATGGAAGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960471000 3:118065133-118065155 CTCACAGAGCAGAAGGTGGAAGG + Intergenic
961704187 3:128771599-128771621 CTAAATCTGTAAAAGGTGGATGG - Intronic
961752328 3:129104133-129104155 CTGACAGTGTAAAAGGTTCACGG - Intronic
962438731 3:135392196-135392218 CTGACTGTGTGGGATGTGGAAGG + Intergenic
963262722 3:143209179-143209201 GTCACTGTGTAGAAACTGGAAGG + Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
963526371 3:146419734-146419756 CTGATTGTGAAGATGGAGGAAGG - Intronic
964030606 3:152134922-152134944 CTAAATGTGTAGAAGTAGGAAGG + Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969275497 4:6132902-6132924 ATGAATGTGTAGAAGTTGGCTGG - Intronic
971418828 4:26457184-26457206 GGGACTGAGTAGGAGGTGGAGGG - Intergenic
973056734 4:45668819-45668841 CTGACTGTGTAGAGGCTCTAAGG + Intergenic
973615034 4:52669884-52669906 CTGTCTGCGGAGAAGATGGAGGG - Intergenic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
973955520 4:56059502-56059524 CTGGCTGGGTGGAATGTGGATGG - Intergenic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
974342420 4:60631541-60631563 CTGAATGGGTAAAAGCTGGAAGG - Intergenic
976300242 4:83509528-83509550 CTGACTGGGAAGATGGTGGCTGG + Intronic
978231087 4:106400909-106400931 CTGCCTATGAAGAAGATGGATGG + Intergenic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
979894854 4:126146468-126146490 CAGACTGTGTAGAGGTGGGAAGG + Intergenic
980714850 4:136615576-136615598 CGGACTGTATAGAAGTGGGAAGG - Intergenic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
983987629 4:174079403-174079425 AGGACTGTGTAGAAAGAGGAAGG - Intergenic
985172521 4:187167279-187167301 GGGACTGTGTTAAAGGTGGATGG + Intergenic
1202760601 4_GL000008v2_random:106272-106294 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
989586007 5:43074329-43074351 CTGACTGGGAAGATGGTGGCTGG + Intronic
990325767 5:54673921-54673943 CTGTGTGTGTAGTAGGTGGGTGG - Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
994557231 5:101319283-101319305 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
997867364 5:137476451-137476473 GTGAATATCTAGAAGGTGGAAGG + Intronic
999424111 5:151471990-151472012 CAGACTGTGTGGAAGGGGCAGGG - Intronic
999618560 5:153451041-153451063 CAGACTGTATAGAGGTTGGAAGG + Intergenic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1001241434 5:170074515-170074537 CTGACTCTGGAGAATGTGAATGG - Intronic
1001705001 5:173735235-173735257 CTGACTCTGGAGAGGGTGAAGGG - Intergenic
1003593436 6:7454854-7454876 CTGACAGTGCTGAAGGTGGGGGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1012037420 6:94160366-94160388 CTAACATAGTAGAAGGTGGAAGG - Intergenic
1012165730 6:95948871-95948893 TTGACTGTGAAGACTGTGGAGGG + Intergenic
1015421413 6:133013818-133013840 CTTACGTGGTAGAAGGTGGAAGG - Intergenic
1017709383 6:157153363-157153385 ATCAGTGTGTAGAAGGAGGAGGG - Intronic
1017779025 6:157701989-157702011 CAGACTGTGTAGAGGTGGGAAGG + Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1019875350 7:3806090-3806112 CTGACTTTGAAGATGGTGGGAGG - Intronic
1019913558 7:4116314-4116336 CTGGCTGTCTCGAGGGTGGAGGG - Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1022316268 7:29248123-29248145 CTGACTGTGTTGCAGGTGATGGG + Intronic
1024248958 7:47492053-47492075 CTGACTCTGAAGAAGCTGTAGGG + Intronic
1024290709 7:47801534-47801556 CTGTGTGTGTAGACTGTGGACGG + Intronic
1024405681 7:48976589-48976611 CTGACTCTGAGGAAGGTGGTGGG - Intergenic
1025300613 7:57817229-57817251 CTCACATGGTAGAAGGTGGAAGG - Intergenic
1026231477 7:68487905-68487927 CGGACTTGGTTGAAGGTGGAGGG + Intergenic
1026645155 7:72161075-72161097 CTGACTCTGTAGAAGGGACATGG - Intronic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1027624994 7:80533663-80533685 CTCACTTGGCAGAAGGTGGAAGG - Intronic
1028513140 7:91647074-91647096 TTGAATTTGTAGAAGGTTGAGGG + Intergenic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030427585 7:109398644-109398666 CTGACTCTGTTGATGGTGCAGGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1030811393 7:113976553-113976575 CTCACTGTGTATAAAGTGTATGG + Intronic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1033286752 7:140048044-140048066 CTCTCTGTGTGGCAGGTGGACGG + Intronic
1034480692 7:151318243-151318265 GTGACTGTGATGCAGGTGGAAGG + Intergenic
1034636850 7:152574541-152574563 TTGTCTGTGTTGAAGGTGAAGGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1036458226 8:8928234-8928256 CTGAATATGTAGAAATTGGATGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1040972762 8:53155036-53155058 GTGATTTTGTAGAAGGTGGGGGG + Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1048120770 8:131579086-131579108 GTGACTGTTAAGAAGGAGGATGG + Intergenic
1048256748 8:132910613-132910635 CTCACTGTGTCCATGGTGGAAGG - Intronic
1048971817 8:139649388-139649410 CTGAGGGTGTAGAATGAGGAAGG + Intronic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1051575909 9:18615307-18615329 CTGCCTGTGTGGCAGGGGGAGGG + Intronic
1052350550 9:27454325-27454347 CTGAGTGTCTACAAGGTGGCAGG + Intronic
1053260196 9:36656263-36656285 CTGACAAAGTAGAAGATGGAGGG - Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053754652 9:41293299-41293321 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054260173 9:62857603-62857625 CAGACAGTGAAGAAGGTGGCAGG - Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1054927253 9:70601458-70601480 CTGACTGTGAAGAGGCAGGAAGG + Intronic
1055058046 9:72041527-72041549 CTGTCTTTGCAGACGGTGGAAGG + Intergenic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055178771 9:73356110-73356132 CTGATTTTGTAGAATGTTGAGGG + Intergenic
1056125861 9:83536439-83536461 ATGAATGTGTAGATGATGGAGGG - Intronic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059530566 9:115031612-115031634 TTGGCTGTGTAGTGGGTGGATGG + Exonic
1059545855 9:115175958-115175980 CGGACTGTGTAGAAGTGGGAAGG + Intronic
1060421423 9:123472316-123472338 CTAACTGGGAAGCAGGTGGAGGG + Intronic
1061522144 9:131125132-131125154 CTTAAAGTGTGGAAGGTGGAAGG - Intergenic
1062205422 9:135334121-135334143 TTGACTGCTTAGAAAGTGGATGG + Intergenic
1202798964 9_KI270719v1_random:155316-155338 CAGACAGTGAAGAAGGTGGCAGG + Intergenic
1203751010 Un_GL000218v1:80294-80316 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1203482976 Un_GL000224v1:24049-24071 CTGTCTCTGTAGTAGTTGGATGG + Intergenic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1203541370 Un_KI270743v1:91158-91180 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186389088 X:9140522-9140544 TTGACTGTGGAGGTGGTGGAAGG - Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1188985364 X:36764019-36764041 AGGACTGTGTAGCAGGTGTATGG - Intergenic
1189718997 X:43895708-43895730 CTCACTTTGTGGAAGGCGGAAGG - Intergenic
1189917275 X:45868261-45868283 CTGACTGTGAAGATGGAGAAAGG + Intergenic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1190931568 X:54953028-54953050 CTGTTTGTGTAGAAGCTGAAGGG + Intronic
1193437787 X:81499648-81499670 CTGGCTATGCAAAAGGTGGAGGG + Intergenic
1193886242 X:86986179-86986201 CAGACTGTGTAGAGGTGGGAAGG - Intergenic
1193939486 X:87662960-87662982 CTGATTCCGTAGAGGGTGGATGG - Intronic
1194359317 X:92929340-92929362 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1194588342 X:95765754-95765776 CTGACTGTGTAGTAGGCGATGGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1198016133 X:132613154-132613176 GTGACTGTGCAGATGGTGTATGG - Intergenic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1200667512 Y:6045175-6045197 CTGGCTGTAAAGAAGGTGGAAGG - Intergenic
1201164663 Y:11197917-11197939 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1201473227 Y:14355712-14355734 CAGACTGTGTAGAGGTTGGAAGG + Intergenic