ID: 1158190121

View in Genome Browser
Species Human (GRCh38)
Location 18:54818215-54818237
Sequence ATGCCCTTCCTAAAGAGTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158190121 Original CRISPR ATGCCCTTCCTAAAGAGTTA GGG Intronic
905159352 1:36017946-36017968 ATGCCCATCCAGAAGAGTGAAGG + Intronic
912769266 1:112448004-112448026 AAGCTCTTCCTACAGAGATAAGG + Intronic
915976102 1:160390489-160390511 ATGCCCTGCCTACAGAGGTGAGG + Intergenic
916640556 1:166724402-166724424 ATGCCCTTCTACAAGAGTGAAGG - Intergenic
919271553 1:195354943-195354965 AAGCTCTTCCTAAAGATTTTAGG - Intergenic
921650129 1:217668056-217668078 AGCCCCTTTATAAAGAGTTAAGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922847428 1:228698653-228698675 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG + Intronic
1063693970 10:8314927-8314949 ATTCTCCTCCTAAAGAGATAAGG - Intergenic
1063754938 10:8997002-8997024 ATGCCCTTCTTAAAAAGATGTGG - Intergenic
1068000985 10:51334035-51334057 ATGGCCTTATTAAAGAGTTTCGG - Intronic
1068491240 10:57726935-57726957 AAGCATTTCCTGAAGAGTTATGG - Intergenic
1071673151 10:87630367-87630389 ATGCCCATCCAAAAGAATGAAGG - Intergenic
1074606551 10:114975192-114975214 ATGCCCTTCCTGAAGACAAATGG + Exonic
1075230295 10:120670984-120671006 ATGCCTTGACTAAAGAGTAACGG + Intergenic
1079252251 11:18794783-18794805 ATGCCCATCTTAAAGGGCTATGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085345938 11:75768393-75768415 CAGCCCCTCCTAAAGAGTAAAGG + Intronic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1087121027 11:94574397-94574419 CTGCCCTCCCTAAATAGGTATGG + Intronic
1088172639 11:107016601-107016623 AGGCCCTTCCTAAATATTTGTGG - Intronic
1089306362 11:117528742-117528764 ATGCCCATCCCACTGAGTTATGG + Intronic
1095651326 12:44613167-44613189 CTCCCCCTCCTACAGAGTTAGGG + Intronic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1098711973 12:73774195-73774217 ATGCCCATCCAGAAGAGTGAAGG - Intergenic
1100159163 12:91837651-91837673 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
1101755249 12:107616446-107616468 CTGGGCTTCCTAAAGAGGTAGGG - Intronic
1104505820 12:129331209-129331231 TTGCACTTCCTAAAGAGCAATGG + Intronic
1107605414 13:42050452-42050474 ATGCACTTACTAAAGAGTTAGGG + Intronic
1110960105 13:81610618-81610640 ATGCCCTTCTAAAAAAGTGAAGG - Intergenic
1113968453 13:114168849-114168871 ATGCCCTTCCAGAAGAGTGAAGG + Intergenic
1114565654 14:23630861-23630883 AAGCTCTGCCTAAAGAGTTGAGG + Intronic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1121249863 14:92491489-92491511 ATGCCCTTCCTGAAGCCTAAAGG - Intronic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1126908501 15:53393439-53393461 AGGCCCTTCCAATAAAGTTAAGG - Intergenic
1127659586 15:61087785-61087807 ATGCCATTCCCACAGGGTTATGG - Intronic
1127997458 15:64161875-64161897 TTGCCCTTTCTTAAGAGTAATGG - Intronic
1129260280 15:74362982-74363004 ATGCCCTTTCAGAAGAGTGAAGG - Intronic
1140307802 16:73819986-73820008 ATGCCCTTCATAAGGAGGTGAGG + Intergenic
1140424793 16:74851822-74851844 AGTCCCTCCCTAAAGAGTTTTGG - Intergenic
1141164107 16:81648862-81648884 TTGACGTTCCTAAAGAGTGAGGG - Intronic
1143640961 17:8197130-8197152 AAGCCCTTCCCTAAGAGTTCTGG - Intergenic
1144641296 17:16938750-16938772 ATGCCCTTACTAAGGAGGCATGG + Intronic
1144757065 17:17686234-17686256 ATGCCCTTGCTAAAGATCAAAGG - Intronic
1149471325 17:56917370-56917392 ATGTCCTTCATAAAGTGTTGAGG - Intergenic
1150025875 17:61673578-61673600 ATGCCCTGCCCACAGAGGTAGGG - Intergenic
1155991094 18:32280326-32280348 ATGCCCAGCCTACAGAATTAGGG - Intronic
1157213761 18:45764898-45764920 ATGCCCTTCCTCTGCAGTTAAGG - Intergenic
1158190121 18:54818215-54818237 ATGCCCTTCCTAAAGAGTTAGGG + Intronic
1163685768 19:18710920-18710942 ATGGGCTTCCTAAACAGTCAAGG - Intronic
928601669 2:32909531-32909553 ATGGCCTTCCTGCAGATTTAGGG - Intergenic
929262704 2:39883441-39883463 ATTCTCTTCCTTGAGAGTTAGGG + Intergenic
939115782 2:138058630-138058652 AAGCCCTTCCTAAGGACTTTGGG - Intergenic
941732115 2:168930164-168930186 ATATCCTTGCTAAAGATTTATGG + Intronic
943372763 2:187036275-187036297 ATGCCCATCCAGAAGAGTGAAGG + Intergenic
943523585 2:188987822-188987844 ATTCCCTTCCTTAAGAGTTCAGG + Intronic
947253069 2:228130242-228130264 TTACCATTCCTAGAGAGTTAGGG - Intronic
1169642214 20:7765740-7765762 AAGCCATTTCTAAAGAATTAAGG + Intergenic
1170582859 20:17711968-17711990 CCGTCCTTCCTAAAGAGTGATGG + Intronic
1173392912 20:42650922-42650944 ATGCACTTCCTCAAGAATTCAGG - Intronic
1174041590 20:47704179-47704201 ATCCCCTTCCTGATGAATTAGGG - Intronic
1177438695 21:21089718-21089740 ATGCACTTGGTAAAGAGTCATGG - Intronic
1181674799 22:24444653-24444675 CTGCCCTTCCCAAAGGGCTACGG + Intergenic
1184096752 22:42320249-42320271 ATGCCCTTCCCAGAGAGCCATGG + Intronic
950604780 3:14068932-14068954 ATGTCCTTCCTATAGAGTGAAGG + Intronic
962963177 3:140330136-140330158 ATTCCCTTCCCAAAGAGTTAGGG - Intronic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
969542488 4:7801956-7801978 ATGCCTTTCCAAAAGGGTTTTGG + Intronic
970201270 4:13609647-13609669 ATGGCATTCTTAAAGAGTAATGG - Intronic
971728592 4:30346670-30346692 ATGCACTTCATAAAGAGCTATGG + Intergenic
975464696 4:74696212-74696234 AAGCCTGTCCTAAAGAATTAAGG - Intergenic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979149698 4:117295204-117295226 GTGCTTTTCCTAAAGAGTTTTGG - Intergenic
983815002 4:172113699-172113721 ATGCGTTTCCTGAAGAGTTTAGG - Intronic
984216805 4:176923396-176923418 ATGCCCTTTCAAAAGAGCTCAGG + Intergenic
989456818 5:41653619-41653641 CTCCCTTTCCTAAACAGTTAAGG + Intergenic
993248789 5:85487644-85487666 ATGCCCTTCCAGAAGAGTGAAGG - Intergenic
997287610 5:132693007-132693029 AAGACTTTCCTTAAGAGTTAAGG + Exonic
997488640 5:134253700-134253722 ATGCAGTTCCTAAAGATTCATGG + Intergenic
997572779 5:134944827-134944849 ATGCCCTTGCTGAAGAGAGAAGG + Intronic
998046323 5:138989990-138990012 ATGCCTTTCCCAAAGAGCCATGG - Intronic
1001662030 5:173400975-173400997 ATCCCCTTCCTTGAGATTTATGG + Intergenic
1002514240 5:179745260-179745282 ATGCCCTCCCTAATGAGATAGGG + Intronic
1002989875 6:2228642-2228664 ATGCCCTTCCTACAGAGAAGTGG - Intronic
1008283097 6:49619293-49619315 ATGACCTTCCTGAAGAAATATGG - Exonic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014762899 6:125377508-125377530 ATGAACTTTCTAAAGAGTAAAGG + Intergenic
1014834638 6:126147075-126147097 ATGACCTTCCTGAAGAGGTGAGG + Intergenic
1018562397 6:165115608-165115630 TTGCCCTACCTAAATATTTAGGG + Intergenic
1020467968 7:8502717-8502739 ATGCACTTCCTAATGAGTTCTGG - Intronic
1020793721 7:12658338-12658360 TTGACCTTTCTAAGGAGTTAAGG - Intergenic
1021931924 7:25589654-25589676 CTGCTCTTCCTAAAGAGTTTGGG + Intergenic
1023486170 7:40689573-40689595 ATGCCCTTCATATAGTGTGAAGG - Intronic
1026143224 7:67723817-67723839 AAGCTCTTTCCAAAGAGTTAGGG + Intergenic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1030583611 7:111389780-111389802 TGGCCCTTCATAGAGAGTTAAGG - Intronic
1032791740 7:135247515-135247537 AAGCTCTTTCTTAAGAGTTAAGG + Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041264477 8:56051118-56051140 ATGGCCGTCTTAAGGAGTTAAGG - Intergenic
1041538719 8:58958335-58958357 ATGTCCGTCTTAAAGAGTTTTGG - Intronic
1043137330 8:76544641-76544663 ATGCCCATCCAGAAGAGTAAAGG - Intergenic
1047553078 8:125897858-125897880 ATGCCTATCTTAAAGAGATATGG + Intergenic
1054896595 9:70320384-70320406 CTGCCCTGCCTAAAGAGATGAGG - Intronic
1055410425 9:76023196-76023218 ATGCTTTTCCAAAAGACTTACGG + Intronic
1055778498 9:79793190-79793212 ATAACCTTCCTAAATAGTTGTGG - Intergenic
1058047265 9:100369934-100369956 ATGTCCATCCAAAAGAGTGAAGG - Intergenic
1059993483 9:119887190-119887212 ATGCCCTGCTTAAAAAGTCAGGG + Intergenic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1188326782 X:28814093-28814115 TTGCTCCTCCTAATGAGTTACGG + Intronic
1198443568 X:136688899-136688921 CTTCCCTTCATAAACAGTTATGG - Intronic
1200153576 X:153963566-153963588 AGCCCCTTCCTCAAGAGCTAGGG - Intronic