ID: 1158190819

View in Genome Browser
Species Human (GRCh38)
Location 18:54826699-54826721
Sequence CACAGTGACCACTGTGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 264}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158190817_1158190819 9 Left 1158190817 18:54826667-54826689 CCTTTTCTAGAAGTTGCAGTGAG 0: 1
1: 0
2: 1
3: 22
4: 622
Right 1158190819 18:54826699-54826721 CACAGTGACCACTGTGAGCTCGG 0: 1
1: 0
2: 1
3: 22
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158190819 Original CRISPR CACAGTGACCACTGTGAGCT CGG Intronic
900955121 1:5882079-5882101 CGCAGTGACGGCTGTGAGCGTGG - Intronic
901024527 1:6272074-6272096 CTGAGTGCCCACTGTGGGCTAGG + Intronic
902629533 1:17696499-17696521 CACAGTGAGGAGTGTGAGCTGGG + Intronic
902930208 1:19725853-19725875 CCCAGTGACCACGCTGTGCTCGG - Intronic
903694184 1:25195371-25195393 TCCAGTGTCCACTGGGAGCTTGG - Intergenic
904041844 1:27589965-27589987 CCTAGTGCCCACTGTGGGCTGGG + Intronic
904371904 1:30053194-30053216 CACAGTGATCCCTGAGAGATGGG + Intergenic
904483386 1:30807754-30807776 CACAGTGACTACTGGAAGCATGG - Intergenic
904498936 1:30902984-30903006 CCCAGGGACCACTCTGTGCTTGG - Intronic
905274245 1:36806869-36806891 CACAGAAACCACTGTGAGGGTGG + Intronic
907423817 1:54365757-54365779 CACAGGAACCAGTGTGAGCAAGG - Intronic
907501794 1:54886679-54886701 CAAAGTGCCCACTGTGTGCAGGG - Intronic
907634563 1:56120751-56120773 CAAAGAGGCCACAGTGAGCTTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912593901 1:110854675-110854697 CACTATGACCACAGTGAGGTGGG - Intergenic
912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG + Intergenic
914419010 1:147511015-147511037 CACAGTGATCACTGTGTCTTGGG - Intergenic
915492874 1:156261187-156261209 CACAATGACTGCTGTGTGCTAGG + Intronic
915860616 1:159440516-159440538 GACAATGACCACAGTGAGGTGGG - Exonic
917730733 1:177872156-177872178 CCAAGAGACCTCTGTGAGCTTGG - Intergenic
919931837 1:202226093-202226115 GAGAGTGACCACTGTGGGCAGGG - Intronic
919975360 1:202607233-202607255 CAGAGTGCCCGCTGTGTGCTTGG - Intronic
921941356 1:220843279-220843301 GACTGGGACCACTGTGAGCCTGG + Intergenic
922727227 1:227928085-227928107 CACACTGACCAGTGTGGGCAAGG - Intronic
1067053435 10:43038192-43038214 CACAATAAGCACAGTGAGCTTGG - Intergenic
1067721636 10:48731936-48731958 CAAAGTGAACAGAGTGAGCTAGG - Intronic
1068606979 10:59016349-59016371 CTCAGGGACCACTGTGACTTTGG - Intergenic
1068611188 10:59062167-59062189 CACACTGACGACTGTGAATTAGG + Intergenic
1068662134 10:59633359-59633381 CACAGTGTCCACTGTGATAATGG + Intergenic
1069181180 10:65360951-65360973 CACCGTCACCACTGTGGGGTTGG + Intergenic
1069643247 10:69970248-69970270 CACAGAGACCACTATGCTCTGGG - Intergenic
1071190077 10:83089602-83089624 CACAGTGGCCTTGGTGAGCTGGG - Intergenic
1072324620 10:94285745-94285767 CACATTCTCCACTCTGAGCTGGG + Intronic
1072807254 10:98431372-98431394 CACTCTGTCCACAGTGAGCTTGG + Intronic
1073117232 10:101098135-101098157 CACAGAGATCAATGGGAGCTGGG - Intronic
1073448373 10:103594431-103594453 CACAGAGCCCACTAAGAGCTGGG + Exonic
1075223221 10:120602206-120602228 TACGGTGGCCACAGTGAGCTGGG - Intergenic
1077475762 11:2789691-2789713 CACTGGGACCACCGTGGGCTTGG + Intronic
1077986102 11:7352766-7352788 CACAGAGATTACTGTGAGCTAGG + Intronic
1079996783 11:27304102-27304124 GACAGTGACCTCTGAGAGATGGG - Intergenic
1080433060 11:32216200-32216222 CACACTGACCTGTATGAGCTAGG + Intergenic
1080642836 11:34167746-34167768 CACAGAGGCCACTGTTAGCCAGG - Intronic
1082655841 11:55856316-55856338 CATAGTGACCACAGTCAGGTGGG - Intergenic
1082692121 11:56319031-56319053 CACTATGACCACTGTCAGGTGGG - Exonic
1083841243 11:65305511-65305533 CAAAATGACCACTGCAAGCTGGG + Intronic
1083994526 11:66265574-66265596 CTCAGGGCCCACTGTGGGCTGGG + Intronic
1084560841 11:69904778-69904800 CACACTGTCCACTGGGACCTGGG - Intergenic
1088583668 11:111338510-111338532 CTCACTCACCACTGTGATCTTGG + Intergenic
1089899140 11:121963089-121963111 CACACTGACCAGAGTGAGCCAGG - Intergenic
1090703704 11:129317648-129317670 CACAGAGCTCACTGTGTGCTAGG - Intergenic
1091346798 11:134859669-134859691 CACAGTGACCACAGGCATCTTGG - Intergenic
1092832857 12:12462180-12462202 CCCAGTGCTCACTGTGTGCTGGG + Intronic
1092881571 12:12891342-12891364 CACAGTCACCCCTGGAAGCTGGG - Exonic
1093059646 12:14589362-14589384 CCCTGTGCCCACTGTGATCTGGG - Intergenic
1096334036 12:50739563-50739585 TCCAGTGGCCGCTGTGAGCTCGG - Exonic
1097950957 12:65427805-65427827 CTCAGCCACCACAGTGAGCTAGG - Intronic
1099301078 12:80895079-80895101 AACATGGACCATTGTGAGCTTGG + Intronic
1101282325 12:103271130-103271152 CACAGTGACCCCTGTAAAGTGGG + Intronic
1102220511 12:111191248-111191270 CACAATGACCCCTGTGGGCCAGG - Intronic
1102528881 12:113531791-113531813 CACAGCACCCACTGTGTGCTGGG + Intergenic
1104873861 12:132019413-132019435 CACTGTGCCCACTTTAAGCTGGG - Intronic
1107730279 13:43341565-43341587 CACAGAGAGCTCTGTCAGCTAGG + Intronic
1107994452 13:45847019-45847041 CACAGTGACCACCACCAGCTTGG + Intronic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1116862721 14:50007493-50007515 CATAGTTACCACTGGGAGCAGGG - Exonic
1116963984 14:50995402-50995424 ATAAGTGACCACTGTGTGCTAGG - Intronic
1118599783 14:67464019-67464041 CACACTAACCTCTGTGAGCTGGG - Intronic
1121046956 14:90795272-90795294 AACAGTGACCCGTGAGAGCTGGG + Intronic
1121269797 14:92630618-92630640 AACAGTGACAGCAGTGAGCTTGG - Intronic
1122105893 14:99454614-99454636 TACAATGAGCACTGTGTGCTAGG + Intronic
1123065544 14:105617170-105617192 CACAGAGACCTCTGTATGCTGGG + Intergenic
1124491017 15:30155576-30155598 CTGAGTGCCCACTGTGTGCTTGG - Intergenic
1124752520 15:32382755-32382777 CTGAGTGCCCACTGTGTGCTTGG + Intergenic
1125831660 15:42721247-42721269 AACAGTGACCACAGTGCCCTGGG + Intergenic
1127392772 15:58520501-58520523 CACACTCACCTCTGTGTGCTGGG - Intronic
1129188176 15:73923014-73923036 CCGAGTGACCACTGCCAGCTGGG - Intergenic
1131015847 15:89057424-89057446 CACAGTGACCACTGGGAAGTTGG + Intergenic
1131620554 15:94063682-94063704 CACAGTGACCATTGTAACCTAGG + Intergenic
1131951916 15:97690372-97690394 TTCAGTGCCCACTGTGTGCTAGG - Intergenic
1132348232 15:101121348-101121370 CCCAGTGTCCAGGGTGAGCTGGG - Intergenic
1132615601 16:839911-839933 CACAGTCCCCACTGTGAACTGGG + Intergenic
1132670473 16:1100425-1100447 CACTGGGACACCTGTGAGCTGGG - Intergenic
1132887390 16:2188647-2188669 AACAGTGCTCACTGTGGGCTGGG - Intronic
1136993596 16:35172717-35172739 CACACTCAGCACTGTGAACTGGG - Intergenic
1137035588 16:35566940-35566962 CACAGTGCCCACTGTAGGCAGGG + Intergenic
1137484152 16:48877626-48877648 CACAGCCACCACGGAGAGCTAGG - Intergenic
1138754782 16:59470037-59470059 CACAGTGATGGCTGTGAGCTTGG - Intergenic
1139526280 16:67518694-67518716 CTCAGTGACCTCTGAGATCTGGG + Intronic
1139662206 16:68428915-68428937 CACAGTCACCATTGTCTGCTGGG - Intronic
1139916282 16:70430421-70430443 AACAGCCACCACTGTGATCTTGG + Intronic
1140790000 16:78382404-78382426 CTGAGTGGCCACGGTGAGCTGGG + Intronic
1141275205 16:82581336-82581358 CATTGTGACCACTGTCAGTTAGG + Intergenic
1141896651 16:86962809-86962831 GACAGTCACCACTGTTTGCTGGG - Intergenic
1142154325 16:88526318-88526340 CAGAATGACCTCTGTGGGCTGGG - Intronic
1142215778 16:88829195-88829217 CTCAGTGAACACTGTGACGTTGG - Intronic
1143048128 17:4099520-4099542 CACAGTCAAACCTGTGAGCTAGG - Intronic
1143749601 17:9018853-9018875 AACAGTCACAACAGTGAGCTCGG - Intergenic
1143965168 17:10751765-10751787 CACAATGCCCACAGTGAGCACGG - Intergenic
1147156498 17:38546839-38546861 CACAGAGCCCACTGTGGGCCAGG + Intronic
1148332987 17:46822892-46822914 CACAGCGGCCCCTGTGATCTCGG - Intronic
1149203495 17:54215769-54215791 CACAGTGAACTCTGTGACCCAGG + Intergenic
1151730881 17:75910416-75910438 CACAGAGCCCAGTGAGAGCTGGG + Intronic
1151830509 17:76546533-76546555 CACAGTGCCCACTATGAGACAGG + Intronic
1152540495 17:80972044-80972066 CAAACTGACCACGGTGAGCCAGG - Intergenic
1158190819 18:54826699-54826721 CACAGTGACCACTGTGAGCTCGG + Intronic
1158667819 18:59448859-59448881 CAGAGTCACCACTGTGTGCCTGG + Intronic
1159654430 18:71014858-71014880 CACATTCACCACTGTTAACTTGG + Intergenic
1159981437 18:74786114-74786136 AACAGTGACAACTGTGACGTCGG - Intronic
1160523670 18:79523042-79523064 CACAGGGACCACGGAGGGCTCGG - Intronic
1160939799 19:1614915-1614937 GACACTGGCCTCTGTGAGCTGGG + Intronic
1162875792 19:13619969-13619991 CAAAATGACCACTGAGGGCTGGG - Intronic
1163066393 19:14799387-14799409 CAAGGTGACCACTGAGAGGTGGG + Exonic
1163262340 19:16198657-16198679 CTCTGTGACCATTGTGACCTTGG - Intronic
1164041238 19:21494417-21494439 CACAGTGACTCCTGTGTGCAGGG - Intergenic
1164127142 19:22328837-22328859 CACAATTTCAACTGTGAGCTGGG - Intergenic
1164206211 19:23060860-23060882 CACAGTGCCCACTGTGGGCAGGG + Intergenic
1164257814 19:23544566-23544588 CACAGTGACTCCTGTGTGCAGGG + Intronic
1164282677 19:23782620-23782642 CACAGTGACTCCTGTGTGCAGGG - Intronic
1164293515 19:23888582-23888604 CACAGTGACTCCTGTGTGCAGGG - Intergenic
1164468715 19:28510327-28510349 CACAGTGCCCAATGCGTGCTTGG + Intergenic
1165633065 19:37317928-37317950 CACACTGGCCACTGTGCACTCGG - Intronic
1167744955 19:51345298-51345320 CACACTGATCACAGAGAGCTTGG + Exonic
1167936931 19:52916712-52916734 CACATTGACAACTGGGGGCTGGG + Intergenic
926012170 2:9417086-9417108 CACTTTGGCCACTGTGAGCAGGG - Intronic
926314540 2:11699693-11699715 CTGAGTGACCACCGTGTGCTGGG + Intronic
926848553 2:17169334-17169356 CACACAGAGCACTTTGAGCTTGG + Intergenic
927848103 2:26481909-26481931 CACAGTGAGCACTTTGATCCAGG + Intronic
928801859 2:35103782-35103804 GACAGAGAACACTGTGAGCTAGG + Intergenic
929361536 2:41097769-41097791 AACAGTGATCCCTGTGAACTGGG + Intergenic
930064032 2:47313897-47313919 CACTGGGACCACTGAGAGCTTGG + Intergenic
931846943 2:66213751-66213773 CTCAGTCACCACAGTGAGGTAGG - Intergenic
934753840 2:96811419-96811441 CACAGTGACCTCTGTGCACACGG + Exonic
935950049 2:108320425-108320447 CACGGTGGCTATTGTGAGCTTGG + Intergenic
937091616 2:119210051-119210073 CACAGTGACCACAATGTACTTGG + Intergenic
938400600 2:130987735-130987757 AGCAGTGAGCACTGTGAGCTAGG + Intronic
941167497 2:162098293-162098315 TTCAGTGACTACTCTGAGCTAGG - Intergenic
943765195 2:191653424-191653446 CACAGTGACTACTATGTGCCAGG - Intergenic
944530563 2:200664034-200664056 AACAGTGATCACTTTGAGCATGG + Intronic
944604789 2:201342998-201343020 GTCGGTGACCACTGTCAGCTAGG + Intronic
945045268 2:205776267-205776289 CACCGTGTCCACTGTGGGCTCGG - Intronic
948080203 2:235199332-235199354 CCCAGTGCCCACAGTGAGCCCGG + Intergenic
1168768324 20:397197-397219 CACAGTTCCCAGAGTGAGCTGGG - Exonic
1170208473 20:13824331-13824353 CACTATGACCCCTGTGAGCACGG + Intergenic
1170745981 20:19099267-19099289 GACACTGTCCACAGTGAGCTCGG - Intergenic
1170953299 20:20955967-20955989 CACAGTAAACACTGTGTGCCTGG + Intergenic
1171332715 20:24355806-24355828 GGCAGAGACCACAGTGAGCTTGG - Intergenic
1171517105 20:25746598-25746620 CACAGCTGCCCCTGTGAGCTGGG + Intergenic
1172093211 20:32447907-32447929 CCTAGTGCCCACTGTGAGTTGGG + Intronic
1175259411 20:57665121-57665143 TACAGTGACTACAGTGAGTTTGG - Intronic
1175883564 20:62274604-62274626 CAGAGTGAGCTCTGTGTGCTGGG - Intronic
1177677653 21:24322621-24322643 GACAGTCACCACTGGGAGCATGG - Intergenic
1178884766 21:36476367-36476389 CTCAGTGCCCACAGTGGGCTGGG - Intronic
1179539195 21:42073245-42073267 CTCAGTGACCACGCCGAGCTAGG - Intronic
1180074517 21:45455920-45455942 CACTGTCCCCACTGAGAGCTTGG + Exonic
1180249150 21:46568166-46568188 CACAGTGCCCTCTGTGAGCAGGG - Exonic
1181106037 22:20576287-20576309 GACAGGGACCACTGTCTGCTAGG - Intronic
1181863011 22:25833955-25833977 CACACTGACAACAGTCAGCTGGG - Intronic
1182330751 22:29550101-29550123 TACTGTGATCACTGTGTGCTGGG + Intronic
1183673392 22:39286285-39286307 CACAGTGGCCCCTCTGTGCTTGG - Intergenic
1184427728 22:44423040-44423062 ACCAGTGAGGACTGTGAGCTCGG - Intergenic
1184564908 22:45285993-45286015 CACACTTACCACTGTGGCCTTGG + Exonic
949894901 3:8761705-8761727 CTGAGTGCCCACTGTGAGCAAGG - Intronic
952998498 3:38908371-38908393 CACAGTGTCCAGTATGCGCTAGG + Intronic
954410184 3:50367151-50367173 CACACTGACCACTCTATGCTGGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
954967018 3:54620913-54620935 CAAAGTGACAACTGTATGCTAGG - Intronic
955208363 3:56917964-56917986 GACAGTGTCCACTGAGAGGTGGG + Intronic
956580112 3:70801374-70801396 CACTGTGACCATTCTGGGCTGGG - Intergenic
958985067 3:100770804-100770826 CACGGTGACCACAGTGAGGTTGG + Exonic
959327088 3:104950831-104950853 CACTGTGACCTCTGTCACCTGGG - Intergenic
963054241 3:141172004-141172026 CACAATACCCAGTGTGAGCTAGG + Intergenic
963841036 3:150106653-150106675 CAGAATGAACACTGTGAGGTAGG + Intergenic
964026640 3:152081837-152081859 AACAGTGAGAAGTGTGAGCTTGG + Intergenic
965058457 3:163752453-163752475 CAGAGTGAGTACTGTGCGCTGGG + Intergenic
965358698 3:167710154-167710176 CATAGCCACCACAGTGAGCTGGG - Intronic
965387287 3:168060041-168060063 CACAGAGCCCACTGAGAACTTGG + Intronic
965879058 3:173366255-173366277 TAGAGTGCCCACTGTGAGTTAGG + Intergenic
966571624 3:181450450-181450472 CACAGTGACCACCATGATGTAGG + Intergenic
966642488 3:182206202-182206224 AACAGTGAACTCTGTGGGCTGGG + Intergenic
967271414 3:187736613-187736635 CCCTGTGTCCACTGTCAGCTGGG + Intronic
968473777 4:793567-793589 CTCAGTGACACCTGTGTGCTGGG - Intronic
969056182 4:4404331-4404353 AACAGTGGGCACGGTGAGCTGGG - Intronic
969355331 4:6621662-6621684 CACAGTTACCACTGGCAGCCTGG - Exonic
970546694 4:17137530-17137552 CAAACTGACCACTGTGAACCAGG + Intergenic
970652849 4:18197684-18197706 CACACGGACCACTGTGGTCTTGG + Intergenic
971273413 4:25172565-25172587 CAAAGTGACCACTTTGAATTTGG + Intronic
972358345 4:38303511-38303533 GTCAGTGCCCACTGTGATCTTGG - Intergenic
976243036 4:82978600-82978622 TACAGTGTTCACTGTGTGCTAGG - Intronic
980442482 4:132867089-132867111 CACAGAGAAATCTGTGAGCTTGG + Intergenic
981656578 4:147118625-147118647 CTAAGTGACCACTATGTGCTAGG + Intergenic
983826356 4:172266800-172266822 AATAGTGAACACTGTGATCTTGG + Intronic
988931139 5:36036570-36036592 CAAAATGACCATTCTGAGCTGGG - Intronic
994157775 5:96522901-96522923 CCCAGTGACCACACTAAGCTTGG - Intergenic
995336768 5:111008578-111008600 CATAGTGACCTCTGAGAGCCAGG + Intergenic
995420067 5:111954569-111954591 CAAAGTGCCCACTGTTAGATTGG + Intronic
995491356 5:112695206-112695228 AACAATGACCACAGTGATCTGGG - Intergenic
996146434 5:119982558-119982580 CACAGTGACCATGGTCAGATGGG + Intergenic
997585579 5:135041064-135041086 CACCGAGGCCTCTGTGAGCTTGG - Intronic
997591214 5:135073459-135073481 CACACTGACCACAGCGAGCTTGG + Intronic
998733900 5:145112660-145112682 CACAGTGAGCACTGTGTGGAAGG + Intergenic
1000051313 5:157565318-157565340 CACAATGCCCACTGTAAACTGGG + Intronic
1004058932 6:12171501-12171523 CACAGGGGCCACTGTGAGCTTGG - Intergenic
1004058935 6:12171508-12171530 CACAGTGGCCCCTGTGAGAGGGG + Intergenic
1004172298 6:13305043-13305065 CACAGTGAGCATTGTGTTCTTGG - Exonic
1005359847 6:25021484-25021506 CACAGTGACCTGGGTGAGATTGG + Intronic
1005988784 6:30890872-30890894 CTAAGTGGCCACTGTGGGCTGGG + Intronic
1006190305 6:32203623-32203645 GACACTTCCCACTGTGAGCTTGG + Intronic
1006965515 6:37980141-37980163 GACAGTGACCTCTGAGAGATGGG - Intronic
1007740336 6:44005820-44005842 CACTGACACCACTGTGACCTTGG + Exonic
1007848325 6:44779665-44779687 CACACTGACCTCTGAGAGGTTGG - Intergenic
1008216309 6:48793976-48793998 CACAGTGACCACTGTGATACAGG + Intergenic
1008645956 6:53514974-53514996 CTCAGTGGCCACTGTGTGCCTGG - Intronic
1009587960 6:65630168-65630190 CACAGTGACCATTTTGACATGGG - Intronic
1010058842 6:71598414-71598436 TACAGTGACCACTGAGAGACAGG - Intergenic
1011129017 6:84034997-84035019 GCCAGAGGCCACTGTGAGCTGGG + Intronic
1018729262 6:166636676-166636698 CGGAGTGCCTACTGTGAGCTGGG - Intronic
1019443219 7:1057777-1057799 CACAGCGCCCACCGGGAGCTCGG - Exonic
1019832288 7:3344120-3344142 CACAGTGAAAACTGTGTGCAGGG + Intronic
1020639760 7:10741124-10741146 CACACTAGCCACTGTGAGGTTGG + Intergenic
1021638526 7:22715087-22715109 CAGAGGGTCCACTGTGAGCTAGG - Intergenic
1021807153 7:24368792-24368814 CACAGAGACCACAGGGAGCTGGG + Intergenic
1022817684 7:33929112-33929134 CAGAGTTTGCACTGTGAGCTGGG + Intronic
1024015665 7:45312015-45312037 CACAGTGACAGCTGTGGGCAGGG + Intergenic
1024074948 7:45813495-45813517 CACACTGACCTCTGTCAGCATGG - Intergenic
1024106597 7:46094357-46094379 CACAGTGAAAACTATGAGCCTGG - Intergenic
1024648546 7:51387455-51387477 CACGCTGACCTCTGTCAGCTTGG + Intergenic
1025161184 7:56662439-56662461 CACAGTGTCATCTGTGTGCTGGG - Intergenic
1025780700 7:64599445-64599467 CACAATGGCCACTATGAGCAGGG - Intergenic
1025782190 7:64611652-64611674 CACAATGCCCTCTGTGAGCAGGG - Intergenic
1028680323 7:93521264-93521286 TCCAGTGACCTCTGTGATCTGGG - Intronic
1033252506 7:139773229-139773251 CACGGTGATCACTGTGACTTAGG - Intronic
1034217536 7:149420094-149420116 CACAGAGGGCCCTGTGAGCTGGG + Intergenic
1034314285 7:150115720-150115742 CTCAGTCAGCACTGTGAGCAGGG + Intergenic
1034740788 7:153471625-153471647 TAGAGTGAGCACTGTGAGCCGGG + Intergenic
1035140422 7:156753771-156753793 CACAGAGCTCACTGTGATCTCGG - Intronic
1036673886 8:10813028-10813050 CAAAATGATCACTGTGAGCTGGG - Intronic
1038219136 8:25591135-25591157 CACACTGTACACTCTGAGCTTGG + Intergenic
1039142328 8:34403742-34403764 CACAGTTTGCTCTGTGAGCTGGG + Intergenic
1039942612 8:42104182-42104204 GACAGTGACTCCTGTGAGATAGG + Intergenic
1040018255 8:42717716-42717738 CCCAGACAACACTGTGAGCTAGG - Intronic
1040375481 8:46820754-46820776 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1040378237 8:46847283-46847305 CACAGTGATTTCTGTGAGCATGG - Intergenic
1040379412 8:46857898-46857920 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1041096064 8:54351413-54351435 CAGCGTGCCCACTTTGAGCTTGG + Intergenic
1041717751 8:60947256-60947278 CACAAAGACCACTCTCAGCTAGG + Intergenic
1042791685 8:72614865-72614887 CACAATGGCCCATGTGAGCTAGG + Intronic
1042856538 8:73273351-73273373 CAGAGTGGGCACTGGGAGCTGGG - Intergenic
1049389078 8:142358925-142358947 CACAGGGGCCACTGTGGGCTGGG - Intronic
1049695489 8:143982506-143982528 CACAGTGACCGCAGCGAGCCCGG + Intronic
1052657963 9:31389311-31389333 CACGTTGACCACTTTGAACTAGG + Intergenic
1054825105 9:69565754-69565776 CACAATGTCCACTTTCAGCTAGG + Intronic
1055404594 9:75961452-75961474 CACTGTGGCCATTGTGTGCTTGG + Intronic
1057268615 9:93634741-93634763 CCCTGTGCCCACTGTGTGCTGGG + Intronic
1058715622 9:107719698-107719720 ACCAGTGACCACAGTGGGCTTGG - Intergenic
1059533872 9:115063142-115063164 CACAGTGACCGAGGTTAGCTGGG - Exonic
1060586126 9:124787109-124787131 CACGGTGGAGACTGTGAGCTCGG + Exonic
1061630306 9:131868054-131868076 CACAGTGCCCACTGTGAAACTGG - Intronic
1062356391 9:136165907-136165929 CACAGTGATCCCTGAGAGATGGG + Intergenic
1062491055 9:136805105-136805127 CACTGTGAGCACTGTGGGCCCGG - Intronic
1186532419 X:10310772-10310794 CTGACTGACCACTGTGATCTTGG + Intergenic
1187195251 X:17077472-17077494 CACAGTGGCCTCTGTGAGTCCGG + Intronic
1187974765 X:24693974-24693996 CACGGCGACGACTGTGAGATAGG + Exonic
1189381123 X:40503048-40503070 GACAGTGACAACAGTGAGCTTGG - Intergenic
1190044566 X:47101562-47101584 CCCAGTGGCCACTGTGAGGGGGG + Intergenic
1190465078 X:50718089-50718111 CTGAGTGTCCACTGTGTGCTGGG + Intronic
1191950357 X:66584604-66584626 CACAGTGACCTCGATGAGATTGG - Intergenic
1193923825 X:87462117-87462139 CTCAGTGACCACAGAGAGTTAGG + Intergenic
1194006791 X:88504518-88504540 GGCAGTGACCACTGTGGACTTGG + Intergenic
1195572833 X:106415622-106415644 AACAGAGACCATTGTGAGCAAGG + Intergenic
1196035396 X:111138440-111138462 CTCAGTGTCTACTTTGAGCTTGG - Intronic
1196716795 X:118819951-118819973 CACAGTGACCCCAGTTAGCATGG - Intergenic
1198619711 X:138492567-138492589 CACAGTGACCACACTGTGGTAGG + Intergenic
1199039495 X:143094947-143094969 CACAGTGCCCACTGGGAGAAGGG + Intergenic
1200844309 Y:7815651-7815673 GACAGTGCTCACTGTGAGCTGGG + Intergenic
1200859320 Y:7973549-7973571 CACAGAGTCCCCTGTGAGCAGGG + Intergenic
1200869938 Y:8086878-8086900 CACAGTGTCCTCTGTGGGCAGGG + Intergenic
1200890334 Y:8316857-8316879 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1200890994 Y:8323945-8323967 CACAATGACCCCTGTGGGCAGGG - Intergenic
1200891407 Y:8328314-8328336 GACAGTCATTACTGTGAGCTAGG - Intergenic
1200907141 Y:8495412-8495434 CACAGTGTCACCTGTGAGCAAGG - Intergenic
1202254837 Y:22910253-22910275 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1202259960 Y:22960061-22960083 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1202340639 Y:23861282-23861304 CAGAGTGGGCACTGGGAGCTTGG - Intergenic
1202407828 Y:24544002-24544024 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1202412946 Y:24593805-24593827 CACAGTGTCCCCTGTGGGCAGGG - Intergenic
1202457835 Y:25076265-25076287 CACAGTGTCCCCTGTGGGCAGGG + Intergenic
1202462954 Y:25126079-25126101 CACAGTGTCCCCTGTGGGCAGGG + Intergenic
1202530127 Y:25808800-25808822 CAGAGTGGGCACTGGGAGCTTGG + Intergenic