ID: 1158195672

View in Genome Browser
Species Human (GRCh38)
Location 18:54882600-54882622
Sequence GTGCTATCCAGGCTCAACGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158195669_1158195672 22 Left 1158195669 18:54882555-54882577 CCTCTGATACCATTATGTATTTG 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1158195672 18:54882600-54882622 GTGCTATCCAGGCTCAACGAAGG 0: 1
1: 0
2: 0
3: 3
4: 50
1158195670_1158195672 13 Left 1158195670 18:54882564-54882586 CCATTATGTATTTGCTCATGCAC 0: 1
1: 0
2: 0
3: 15
4: 203
Right 1158195672 18:54882600-54882622 GTGCTATCCAGGCTCAACGAAGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158195672 Original CRISPR GTGCTATCCAGGCTCAACGA AGG Intronic
900154995 1:1200355-1200377 GTGCTGGCCAGGCCCCACGATGG - Intergenic
902638261 1:17749499-17749521 GTGCTATCCAGCTTCCAAGATGG + Intergenic
906293281 1:44633574-44633596 GTGCTTTCCAGGGACAACAAGGG + Intronic
910328352 1:86038518-86038540 GTGGTACCCAGCCTCAATGATGG + Intronic
920399226 1:205666865-205666887 GTGCTATCCAGCCTAAAGGGAGG + Intronic
922969126 1:229719473-229719495 GTGAGATCCTGGCTCAACAAAGG - Intergenic
924539159 1:244964881-244964903 GTGCTAACCAGGATTAACCATGG - Intergenic
1067244939 10:44532324-44532346 ATGCTATCCATGCTCACCTATGG + Intergenic
1074885955 10:117693852-117693874 GTGCTCTCCAGGCTCCAGGGTGG - Intergenic
1078087471 11:8242933-8242955 GTGTTCTCCAGGCACAAAGAGGG + Intronic
1081406794 11:42707679-42707701 GTGCTCTCCTGGCTCAGCGGAGG + Intergenic
1100009609 12:89937709-89937731 GTGCTAACCAGGCTCTCAGAGGG - Intergenic
1112073782 13:95885316-95885338 GTTCTCTCAAGGCTCAACAAGGG + Intronic
1121625523 14:95383128-95383150 GAGCCCTCCAGGCTCAAAGATGG + Intergenic
1129464764 15:75717682-75717704 GTGGTAGCCAGGCTCCAAGATGG + Intergenic
1131317154 15:91349434-91349456 GTGATATCCAGCCTCAAAGATGG - Intergenic
1136283577 16:29228649-29228671 GTGCAATGCAGGCTCCATGATGG - Intergenic
1142088607 16:88198160-88198182 GTGCAATGCAGGCTCCATGATGG - Intergenic
1152276743 17:79362475-79362497 GTGCCATCCAGGCCCAGCGCAGG - Intronic
1155173191 18:23282315-23282337 GTTCTATCCAGGATCAACTGGGG - Intronic
1155404586 18:25473965-25473987 TTACCATCCAGGCTCAACAATGG + Intergenic
1158195672 18:54882600-54882622 GTGCTATCCAGGCTCAACGAAGG + Intronic
1158877131 18:61744274-61744296 ATGCAATCCAGGCTCAACTGAGG + Intergenic
1159620932 18:70637578-70637600 GTGCTATCCTGGCTCACAGCAGG + Intronic
1161049610 19:2156170-2156192 GTGCTAGCCAGGCTCAAAGTAGG + Intronic
1164924040 19:32112716-32112738 GTGCAATCTCGGCTCAATGATGG + Intergenic
925894625 2:8461776-8461798 CCTCTATCCAGGCTCAAAGAAGG - Intergenic
929627717 2:43427269-43427291 GTGCTAGCCAGGCTCAACACAGG + Intronic
938336872 2:130508834-130508856 GTGGTATCTCGGCTCCACGAAGG + Exonic
938352951 2:130611801-130611823 GTGGTATCTCGGCTCCACGAAGG - Exonic
948258925 2:236588909-236588931 CTCCTATCCTGGCCCAACGATGG + Intergenic
1175444985 20:59013721-59013743 GTGTCATGCAGGCTAAACGAGGG + Intergenic
1175808130 20:61842217-61842239 GTGCTATTCAGGCGCGATGAAGG + Intronic
1181235855 22:21447224-21447246 GTGCCACCCTGGCTCAAGGAGGG - Exonic
1183792568 22:40084873-40084895 GTGCTAGCCAGCCTCCAAGATGG + Intronic
1184474803 22:44714643-44714665 GAGCTCTTCAGCCTCAACGAGGG + Exonic
1184691473 22:46119270-46119292 GTGCATTCCAGGGTCAAGGAAGG + Intergenic
965311082 3:167129771-167129793 GTGGCAGCCAGGCTCAAGGAAGG + Intergenic
966308752 3:178569536-178569558 GTACTATGGAGGCTCAAGGAGGG - Intronic
970323728 4:14901223-14901245 GTGATATCCCGGCTCAGCCATGG + Intergenic
972404703 4:38734545-38734567 GTGCTATGGAGGCTCAGAGAGGG - Intergenic
973920644 4:55681593-55681615 GTGGTAGCCAGGCTCCAGGATGG + Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1003210214 6:4056740-4056762 GTGCTAATCAGCCTCAACCAAGG - Intronic
1007649321 6:43408279-43408301 GTGGTAGCCAGTCTCCACGATGG + Intergenic
1007971750 6:46058737-46058759 GTACTATAAAGGCTCAACGGTGG + Intronic
1033634965 7:143203831-143203853 GTGGAATCCAGGCTCAAAGCAGG + Intergenic
1035201797 7:157272490-157272512 GTGCCATCCAGGCTCCATGGAGG + Intergenic
1035992829 8:4511064-4511086 GTGCTGACCAGGCTGAAGGATGG - Intronic
1046299275 8:112265483-112265505 GTGCCAGCCAGGCTACACGATGG - Exonic
1047334192 8:123920350-123920372 GGGCCATCCAGGGTCAAAGAAGG - Intronic
1047393261 8:124471764-124471786 CTGCTACCCAGGCTCAAGGCAGG + Intergenic
1047918521 8:129608576-129608598 GTTCCATCCAGCCTCAACTATGG - Intergenic
1201573544 Y:15438568-15438590 GTGCTCACCAGGCTCTATGATGG + Intergenic