ID: 1158195874

View in Genome Browser
Species Human (GRCh38)
Location 18:54884451-54884473
Sequence GTAATGTGCATTGGCCGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 34}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158195869_1158195874 30 Left 1158195869 18:54884398-54884420 CCAGTCAACAGAGCTTCTTAAAT 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1158195874 18:54884451-54884473 GTAATGTGCATTGGCCGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158195874 Original CRISPR GTAATGTGCATTGGCCGCTT TGG Intronic
908336353 1:63128420-63128442 GTAATGAACATTTGCTGCTTTGG - Intergenic
915902817 1:159858342-159858364 GCCATGTGGATTGGCTGCTTTGG + Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
922603742 1:226875864-226875886 GGAATGTGCAGTGGCTTCTTTGG + Intronic
1069265454 10:66452451-66452473 GGAATGTGCAAGGGCAGCTTGGG - Intronic
1082098267 11:48149255-48149277 GTAATTAGCATTTGCAGCTTGGG + Intronic
1090291148 11:125545998-125546020 GTAATGTGGATTGGCCCCCAGGG + Intergenic
1090602428 11:128387066-128387088 GTAAAGTGGATTGGCCTCTTAGG - Intergenic
1091717786 12:2792244-2792266 GTTAAGTGCATTGGCAGCCTAGG + Intergenic
1115401128 14:32962011-32962033 ATAATGTTCATTTGCAGCTTTGG + Intronic
1118887399 14:69878782-69878804 GTGCTGGGCATTGGCCGCTGGGG - Intronic
1120345986 14:83291086-83291108 GTAATATTGATTGGCAGCTTGGG - Intergenic
1127779400 15:62298161-62298183 GTCATGTGGCTAGGCCGCTTAGG + Intergenic
1131534150 15:93220411-93220433 GTAATGGGCATGAGCTGCTTTGG + Intergenic
1141826359 16:86483424-86483446 GTAATGTGAATTGGCCAATAAGG - Intergenic
1153395826 18:4619498-4619520 GTAATTTGCATTTGCTTCTTGGG - Intergenic
1158195874 18:54884451-54884473 GTAATGTGCATTGGCCGCTTTGG + Intronic
1159973193 18:74678366-74678388 CTAATGTACATTGGGCTCTTAGG + Intronic
1163360212 19:16841210-16841232 ATAAGGTGCATCGGTCGCTTGGG - Intronic
1164233501 19:23311951-23311973 GTAATGTGCCTTTGCTGATTGGG + Intronic
933522100 2:83387027-83387049 GTAATGTTCATTTGCTACTTTGG + Intergenic
948462654 2:238137862-238137884 GAAATGTCCAGTGGCCTCTTGGG + Intergenic
1173188990 20:40862029-40862051 TTAATGGGCAGTGGCCGCTGTGG - Intergenic
1177284233 21:19027483-19027505 TTAATGTCCATTGGATGCTTGGG + Intergenic
950072957 3:10166875-10166897 CTCATGTGATTTGGCCGCTTTGG + Intronic
960203259 3:114863846-114863868 TTAATGTCCCTTGGCCTCTTTGG - Intronic
967828021 3:193894369-193894391 GTAATGAGCCCTGGACGCTTAGG - Intergenic
982382816 4:154767458-154767480 GTAATGTGAATTGGCGGCAAAGG - Intergenic
1001160925 5:169312104-169312126 GAAATCTGCATTGGAAGCTTTGG - Intergenic
1018698135 6:166406385-166406407 GCAATTTGCATCGGCCTCTTTGG - Intergenic
1049758180 8:144320102-144320124 GTACCGTCCATTGGCAGCTTTGG - Intronic
1059629114 9:116100493-116100515 GTAATGTTCATTGGATGCTTAGG - Intergenic
1187031138 X:15489776-15489798 GTAATGTTGATTGGCCACTGAGG - Intronic
1196611671 X:117721926-117721948 TTAATGTGCATTTGCCCCATAGG + Intergenic
1198441408 X:136666926-136666948 GTAATATTAATTGGCCTCTTTGG - Exonic
1199947849 X:152682018-152682040 GTCATGTGCATTCGCCGTGTGGG - Intergenic
1199961830 X:152786436-152786458 GTCATGTGCATTCGCCGTGTGGG + Intergenic