ID: 1158197542

View in Genome Browser
Species Human (GRCh38)
Location 18:54905600-54905622
Sequence CTGGATTCACAAATATACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158197542_1158197547 23 Left 1158197542 18:54905600-54905622 CCATTGTATATTTGTGAATCCAG 0: 1
1: 0
2: 0
3: 12
4: 207
Right 1158197547 18:54905646-54905668 TACATTTTTCAAGCAACCAATGG 0: 1
1: 0
2: 4
3: 21
4: 243
1158197542_1158197548 24 Left 1158197542 18:54905600-54905622 CCATTGTATATTTGTGAATCCAG 0: 1
1: 0
2: 0
3: 12
4: 207
Right 1158197548 18:54905647-54905669 ACATTTTTCAAGCAACCAATGGG 0: 1
1: 0
2: 2
3: 9
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158197542 Original CRISPR CTGGATTCACAAATATACAA TGG (reversed) Intronic
903082828 1:20825519-20825541 CTGAATGCACATAAATACAATGG + Intronic
903375536 1:22863439-22863461 CTGGATTCACAAAGGGACAGGGG + Intronic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908977915 1:69920432-69920454 CTGGAAACACTATTATACAAGGG + Intronic
909901045 1:81136023-81136045 CTGGAGTCACATTTACACAAGGG - Intergenic
909916443 1:81325055-81325077 CTGGTTTCTCAAATGTACTATGG - Intronic
911554029 1:99320843-99320865 AAGGTGTCACAAATATACAATGG + Intergenic
912244070 1:107942540-107942562 CAGGATACACAGATATAAAAAGG - Intronic
914779496 1:150772132-150772154 ATGGATTTAGAAATAAACAAAGG - Intergenic
914967261 1:152271049-152271071 ATGGATTCATACATATCCAAAGG - Intergenic
914969107 1:152291064-152291086 ATGGATTCATACATATCCAAAGG + Intergenic
915768344 1:158390675-158390697 CTGGATTCTAAAATTAACAAAGG + Intergenic
916278142 1:163017740-163017762 CTGGTACCACAAAAATACAATGG - Intergenic
919103803 1:193124462-193124484 ATGGATTCAAAGATATAGAAGGG + Intronic
920534049 1:206725996-206726018 CTGGATTGAATTATATACAAAGG + Intronic
921322063 1:213951586-213951608 CTGGTTTCACATATATATCATGG + Intergenic
922131388 1:222783047-222783069 CTGAAACCACAAAAATACAAAGG + Intergenic
922382434 1:225045005-225045027 CAGAAATCACAAGTATACAAAGG - Intronic
922917264 1:229269222-229269244 CTGGAAGAAGAAATATACAAGGG - Intergenic
923307952 1:232705540-232705562 CTGCATACACAAATATAAATTGG + Intergenic
924492032 1:244547680-244547702 ATAGATTCACAAAAATAAAAGGG + Intronic
1064610923 10:17101601-17101623 CTGGATTCATAAAAATAAAATGG - Intronic
1064803667 10:19106454-19106476 CTGGTTGCACAGAAATACAAAGG - Intronic
1064941062 10:20736016-20736038 CTATATTCACATATATAGAAAGG + Intergenic
1067933640 10:50589029-50589051 CAAGATTCACAAATAGACCAGGG - Intronic
1068418424 10:56757437-56757459 CTGGATTCAGTAAAATATAAAGG + Intergenic
1069358198 10:67612078-67612100 CTGGATTAACAAAAGTACAGAGG + Intronic
1070095875 10:73337978-73338000 CTTGATTTTCAGATATACAAAGG - Intronic
1072072765 10:91935634-91935656 CTGAAATAACAAAAATACAATGG - Intronic
1074174390 10:110981816-110981838 CTGAATTCAACAATATAAAAGGG - Intronic
1078115168 11:8441146-8441168 CTGGATTCACAGAAAAACTAAGG + Intronic
1078652614 11:13209785-13209807 ATCCATTCACAAATATACACAGG + Intergenic
1080845051 11:36019736-36019758 CTGGATACAGAAAGAAACAAAGG + Intronic
1084195399 11:67521689-67521711 CTGAATGAACAAATATAAAAGGG + Intronic
1085831619 11:79907057-79907079 AAGGAGTCACAAATATCCAAAGG - Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087013678 11:93536576-93536598 CTGTATACACAAATACACTATGG - Intronic
1090090376 11:123691467-123691489 CTGGAAGCACCAAGATACAAAGG - Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092935377 12:13357479-13357501 CAGGATTCAGAAATGTACATTGG - Intergenic
1093122828 12:15293672-15293694 CTTGAATCAGAAATATAAAAAGG + Intronic
1094268122 12:28581557-28581579 CTGGATTTGCAAAGATATAAAGG - Intergenic
1097635915 12:62121910-62121932 CTGGTTTCAGTAAAATACAAAGG - Intronic
1097852052 12:64421724-64421746 CTGTATTCACAAATAAAGACAGG - Intronic
1099890802 12:88586384-88586406 CTGCATCCACAAAGCTACAAGGG - Intergenic
1100713817 12:97284915-97284937 CTGAATTCAAAAATAGACACAGG + Intergenic
1100772957 12:97943651-97943673 CTGGGTTCCCACATATAGAATGG - Intergenic
1104355665 12:128083085-128083107 CTAGGTTCACAAATATGCATAGG + Intergenic
1105455526 13:20537782-20537804 ATGAATTGACAAATATACATGGG - Intergenic
1107750418 13:43559215-43559237 CTGAATCCTCAAATATGCAAGGG + Intronic
1108831168 13:54480378-54480400 ATGGATGCACACATATACACAGG - Intergenic
1113364344 13:109662099-109662121 TGAGAGTCACAAATATACAAAGG + Intergenic
1113370587 13:109721688-109721710 CTGGATTAAAAAATAGACTATGG - Intergenic
1115363849 14:32534103-32534125 CTGTATTTAAAAATGTACAAGGG - Intronic
1116377688 14:44224816-44224838 ATGGAATTACAATTATACAAAGG + Intergenic
1117769466 14:59118462-59118484 CTGAATTTACAAATTTAGAAAGG - Intergenic
1119013733 14:71025961-71025983 AAGGATTAACAAATATAGAAAGG - Intronic
1120672823 14:87384032-87384054 CTGGGTTTTCAAATATAGAAAGG - Intergenic
1121691427 14:95880107-95880129 CTGGGTTTACATATATGCAATGG + Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125225884 15:37395857-37395879 CTGGGTGCTGAAATATACAAAGG - Intergenic
1125401331 15:39306836-39306858 CTTGATTCACAAGTGGACAAAGG - Intergenic
1128202913 15:65825110-65825132 TTGGGTTCACAAATGTAAAAAGG - Intronic
1129460493 15:75697981-75698003 CTGGATTCACATACAGACCAAGG + Intronic
1129724370 15:77894055-77894077 CTGGATTCACATACAGACCAAGG - Intergenic
1129864747 15:78897767-78897789 AGGAATACACAAATATACAATGG - Exonic
1133881011 16:9782116-9782138 TTGAATTCACAAATACAGAAAGG - Intronic
1134767912 16:16777869-16777891 CTGGATCTACAGATATACCAAGG - Intergenic
1135055240 16:19226617-19226639 ATGGAGTTACAAATAGACAAGGG + Intronic
1139002584 16:62531137-62531159 CTGGTTCCACAAAAATAAAAGGG - Intergenic
1139768669 16:69254673-69254695 CTGGTATCCCAAATATACAGAGG + Intronic
1140739976 16:77932808-77932830 CTGGATTCACAGAAATCCAAAGG + Intronic
1143397600 17:6614751-6614773 CTGGGTCCAAAAATATTCAATGG + Intronic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1144086150 17:11810411-11810433 CTGGAATCAGAGTTATACAAAGG + Intronic
1144367342 17:14557129-14557151 CTGGAGACACAAGAATACAAAGG + Intergenic
1145100953 17:20076499-20076521 CTGGTTTGACAAATATTTAATGG + Intronic
1149179100 17:53912729-53912751 CTTGGTTCACAAATGGACAATGG + Intergenic
1150070629 17:62147181-62147203 TTGTATTTACAAATTTACAATGG + Intergenic
1153994220 18:10425840-10425862 TTGGCTGCACAAATACACAAAGG + Intergenic
1155763276 18:29592457-29592479 CTGGTATCACAGAAATACAAAGG + Intergenic
1156881132 18:42081195-42081217 CTGAAGTCTCCAATATACAAAGG - Exonic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158666223 18:59435109-59435131 CTGGATTCACATTAAAACAATGG - Exonic
1159162873 18:64666959-64666981 CTGTCTTCATAAAAATACAATGG - Intergenic
1159235161 18:65662080-65662102 CTGAATTCATTAATATAGAAGGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
928014254 2:27639986-27640008 CTTCATTAAAAAATATACAATGG + Intronic
928477085 2:31639051-31639073 ATAGATTCACAAAAATAAAAAGG - Intergenic
932975372 2:76593685-76593707 CAGGATTCACAAATGAAAAATGG - Intergenic
933336983 2:80971078-80971100 CTAGATTAACAAATAAATAAAGG + Intergenic
935393179 2:102576035-102576057 CTGATTCCACAAAAATACAAAGG - Intergenic
936175520 2:110216724-110216746 TGGGATTCACCAGTATACAATGG - Intergenic
936485601 2:112922900-112922922 CAGAATTCAAAAATTTACAAGGG + Intergenic
937200417 2:120200437-120200459 ATGGATGGATAAATATACAATGG + Intergenic
938753517 2:134358488-134358510 CTGGACTCACAAATACAAAAAGG + Intronic
938847461 2:135224425-135224447 CCGGATTCACATCTATACTAAGG - Exonic
939026361 2:137018570-137018592 CTGTATTTATAAGTATACAATGG - Intronic
939301711 2:140350763-140350785 ATGGACTTTCAAATATACAATGG + Intronic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940896194 2:159083740-159083762 ATGAATTCTCAAATATAAAATGG - Intronic
942609470 2:177727937-177727959 CTGGTTTCCCAAATACAAAATGG - Intronic
943617825 2:190114210-190114232 CTGGATTCATAAAGATTGAATGG + Intronic
944986208 2:205180614-205180636 TTGGATTCTTAAATATACAAAGG - Intronic
945344660 2:208699184-208699206 TTTGATTAACAAATATTCAAGGG + Intronic
947076748 2:226353302-226353324 CTGGGCTCACAAATGCACAAGGG - Intergenic
1169186581 20:3622457-3622479 CTTGATTAACAAACATACATTGG - Intronic
1170203467 20:13770161-13770183 ATTCATTCAGAAATATACAAAGG - Intronic
1171181606 20:23094916-23094938 CTGGATCCCCCAATACACAAAGG + Intergenic
1173048429 20:39535473-39535495 CTGCATTCACATATATTCATAGG - Intergenic
1173253058 20:41374764-41374786 CTCGACTCAGAAATAGACAATGG - Intergenic
1176786123 21:13258457-13258479 CTGGAATCATGACTATACAAGGG - Intergenic
1177649925 21:23947504-23947526 CTTAATTCATTAATATACAAAGG - Intergenic
1177984140 21:27952167-27952189 CTGGAATCATGACTATACAAGGG - Intergenic
1178142417 21:29699381-29699403 CTGGACACACAGATATACCAGGG + Intronic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178938989 21:36889273-36889295 CAGGATGCACAAGTATACGAAGG + Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
951340111 3:21475402-21475424 CTGTATTCTCAAATATCTAATGG + Intronic
951729794 3:25797944-25797966 CCCGAATCACAAATGTACAAGGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953934794 3:47032058-47032080 GTACATTCACAAATATACCATGG - Intronic
955129388 3:56149490-56149512 GTAGATTCAAAAATATACACAGG - Intronic
956608546 3:71098359-71098381 ATGGATTAGCAAATGTACAAAGG + Intronic
957099225 3:75807704-75807726 TTGGAAGCACAAATAAACAAGGG - Intergenic
957368364 3:79256597-79256619 ATGAATTCACAAATTTAGAATGG - Intronic
957617525 3:82550331-82550353 CTGTATTGACAAATAGCCAATGG - Intergenic
957874324 3:86125787-86125809 GTGGATTCACAGATACACAAAGG + Intergenic
958579320 3:95997152-95997174 CTGGATTCCCAGATATAGAAAGG - Intergenic
960354792 3:116637933-116637955 CTGTATTAACTACTATACAACGG + Intronic
961074289 3:123967253-123967275 CTGTTTTCCCAAATGTACAAAGG + Intergenic
961309337 3:125984877-125984899 CTGTTTTCCCAAATGTACAAGGG - Intergenic
962945878 3:140170066-140170088 CAGGAAACAAAAATATACAAGGG + Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965617764 3:170612394-170612416 CTGGACTCATAATTAAACAAAGG - Intronic
968535225 4:1122474-1122496 CTGTTTTCTCATATATACAATGG - Intergenic
970836826 4:20419246-20419268 ATGAAATCACACATATACAAAGG - Intronic
971850820 4:31984644-31984666 CTGTATTCATAAATGTTCAAAGG - Intergenic
971898338 4:32625349-32625371 ATGGAGTGACAAATATAAAATGG - Intergenic
973020218 4:45195626-45195648 CAGGATTAACACATAGACAAAGG - Intergenic
973128746 4:46622321-46622343 CTGAACACACAAAAATACAAAGG - Intergenic
975719596 4:77236908-77236930 CTGGATTCACCACTGTCCAAGGG + Intronic
977325350 4:95568356-95568378 CTGGATTAACAAAGACAAAAAGG - Intergenic
977712221 4:100139497-100139519 ATGGATGCACAAAGATACAGTGG - Intergenic
978794338 4:112694000-112694022 GTGGATACACGAATCTACAAAGG + Intergenic
979837720 4:125393437-125393459 TTAGATCCACAAATATATAATGG + Intronic
981022985 4:140048309-140048331 CTTGATTCAGAAATAAACACAGG + Intronic
984334439 4:178371039-178371061 CTGAAATCACAGAAATACAAAGG - Intergenic
984823157 4:183901757-183901779 CTAGATTCAAAAATGGACAAAGG - Intronic
986236015 5:5911278-5911300 CTGGATTCAGGAAGATACTATGG - Intergenic
986953898 5:13126534-13126556 ATGGATTAAGAAATATATAATGG - Intergenic
987753613 5:22071806-22071828 CTTGAGTCCCAAATCTACAAGGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988950286 5:36250790-36250812 CAGGATTCACAAATAAAGTAAGG - Intronic
991141777 5:63252656-63252678 CTGGATTAATAAATCTAGAAGGG - Intergenic
991166761 5:63571846-63571868 CTGTATTGACAAATACACAAAGG - Intergenic
991234310 5:64376415-64376437 CTGGTTTGACAATTGTACAAAGG + Intergenic
995960946 5:117838874-117838896 CTGACTTCACAAATAAATAATGG - Intergenic
997011045 5:129877913-129877935 TTAGATTCACAAATGAACAATGG - Intergenic
998672029 5:144364164-144364186 CTGGATTCAAAAGCATAGAAGGG - Intronic
998903650 5:146880620-146880642 CTTGATTCAGAAAGATACAGGGG - Intronic
1003596317 6:7477231-7477253 CTGGAGTTACAAATATAAATAGG + Intergenic
1003705873 6:8528394-8528416 GTGGAATCACAGAGATACAATGG + Intergenic
1004254068 6:14046719-14046741 CTGCATGCACAAATATTCAGTGG + Intergenic
1005184728 6:23152725-23152747 CTGGAGATATAAATATACAAAGG - Intergenic
1010652690 6:78473567-78473589 CTGGAGTCAGAAATGTACAGAGG + Intergenic
1011173062 6:84527802-84527824 CTGGATTGGCAAATATTCATTGG - Intergenic
1011708131 6:90023934-90023956 CTGAATTAAGACATATACAAAGG + Intronic
1012132567 6:95515775-95515797 TTGGACACACAAATATAGAAAGG + Intergenic
1012488751 6:99753388-99753410 CTGTATTTACAAATATACTTTGG + Intergenic
1012826020 6:104147873-104147895 CTGGAGTCACATAAATTCAAGGG - Intergenic
1014188588 6:118465004-118465026 CTTTATTCACAAATTTATAAGGG - Exonic
1014519290 6:122420533-122420555 CTGGATTCACATATACAAAATGG - Intronic
1015111608 6:129598099-129598121 CTTAATTCACATATTTACAATGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024404629 7:48963857-48963879 CTGGATTTATGAATATGCAATGG + Intergenic
1024964232 7:55007387-55007409 CTTGTTTCACAAAGAGACAAAGG - Intergenic
1033029889 7:137815899-137815921 CTGACATCACAAATATATAAGGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039156859 8:34569794-34569816 CTGGTTTCAAAAATGTACACAGG + Intergenic
1043251121 8:78074468-78074490 CTGTATTCACATATAAACAGAGG - Intergenic
1043874793 8:85473626-85473648 CTGCATACACATATATACATAGG - Intronic
1045627209 8:104068019-104068041 TTGGATTCACACATATACTGGGG + Intronic
1046370601 8:113300827-113300849 CTGAATTCAAAAATTTAAAAAGG + Intronic
1046401675 8:113712897-113712919 CTTGATTCTCAAACTTACAAGGG - Intergenic
1046921709 8:119737080-119737102 TTAGATTCAAAAAGATACAAAGG + Intronic
1048412905 8:134194049-134194071 TTGGACTCACAACTATAAAATGG + Intergenic
1048452759 8:134548536-134548558 CTGAAGTGACAAATATACATGGG + Intronic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051941950 9:22517673-22517695 CTGTTATCAGAAATATACAAAGG + Intergenic
1053362237 9:37496847-37496869 CTGGACTCACAGAGATAAAAAGG - Intronic
1056290875 9:85142737-85142759 CTGGATTCAGAAATTTCCAGTGG - Intergenic
1058713191 9:107698763-107698785 CTGGAATCACAAAGAGACATGGG - Intergenic
1061749223 9:132764490-132764512 CTGGTACCACAGATATACAAAGG + Intronic
1185948970 X:4409265-4409287 GTGGATTCACTAAAATACACAGG - Intergenic
1186916498 X:14228271-14228293 CTAGAAGCACAAATATATAAAGG + Intergenic
1187242358 X:17524933-17524955 TTGGACTAACAAATATAGAAGGG - Intronic
1188401222 X:29747253-29747275 CTGGCTTCAGAAATTCACAATGG - Intronic
1189353006 X:40291102-40291124 CTGGATTTACAAAGAAAAAAGGG + Intergenic
1189894219 X:45636953-45636975 CTAGATTAACAAAGAAACAAAGG + Intergenic
1192872445 X:75197018-75197040 GTGGAATCTCAAATCTACAATGG - Intergenic
1193104811 X:77658648-77658670 CTGTTTTCACATATGTACAATGG - Intronic
1193475572 X:81960806-81960828 CTTGATTCATAAACTTACAAAGG + Intergenic
1194202346 X:90968931-90968953 ATGCATGCACAAATATACAAAGG + Intergenic
1194364999 X:93003982-93004004 CTTCATTCACAAACATAAAAGGG + Intergenic
1195414029 X:104601057-104601079 CTGGATTTACTAATAAATAATGG - Intronic
1196475621 X:116081077-116081099 ATGGAGTCAAAAATATACAAAGG + Intergenic
1197434548 X:126410125-126410147 CTGGTTTCACAAAAATCAAAAGG + Intergenic
1197541457 X:127767888-127767910 CTGATTCCACAAAAATACAAAGG + Intergenic
1199165380 X:144667400-144667422 CTTGATTCACATGTATCCAATGG - Intergenic
1199438324 X:147839905-147839927 TTGCATTTACAAATGTACAATGG - Intergenic
1200548183 Y:4544386-4544408 ATGCATGCACAAATATACAAAGG + Intergenic
1200673226 Y:6120240-6120262 CTTCATTCACAAACATAAAAGGG + Intergenic