ID: 1158198392

View in Genome Browser
Species Human (GRCh38)
Location 18:54913048-54913070
Sequence CCAGATAAGCAGATATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158198386_1158198392 -6 Left 1158198386 18:54913031-54913053 CCATATCACCCAAATACCCAGAT 0: 1
1: 0
2: 0
3: 12
4: 141
Right 1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG 0: 1
1: 0
2: 1
3: 11
4: 150
1158198385_1158198392 -1 Left 1158198385 18:54913026-54913048 CCAAACCATATCACCCAAATACC 0: 1
1: 0
2: 15
3: 124
4: 620
Right 1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG 0: 1
1: 0
2: 1
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158198392 Original CRISPR CCAGATAAGCAGATATTGAT GGG Intronic
908428906 1:64036642-64036664 CTAGAAAAGCAGACATTTATTGG - Intronic
908990420 1:70081073-70081095 CCAGATAAACTGATTTTAATAGG + Intronic
909897966 1:81097557-81097579 CTAGAAAAGCAGAAATTGACTGG - Intergenic
911833990 1:102592837-102592859 CCAGATAAGTTCATATTCATGGG - Intergenic
913039545 1:115009146-115009168 CCTGATATGCAGCCATTGATTGG - Intergenic
916281241 1:163053769-163053791 CCAGAGAAGCAGACCTTGAGAGG + Intergenic
917440096 1:175060982-175061004 CAAGAGAAGGAAATATTGATGGG + Intergenic
919055758 1:192567889-192567911 CAAGACAAGTAAATATTGATAGG + Intergenic
919131773 1:193460089-193460111 CCAGATAAAAAGATAAGGATGGG - Intergenic
921009107 1:211123466-211123488 GCAGATGGGCAGATATGGATAGG + Intronic
921534837 1:216333898-216333920 CCAGATAAAGAAATATTGAGAGG + Intronic
923644783 1:235807604-235807626 CCACACACGAAGATATTGATAGG + Intronic
1064356642 10:14624853-14624875 CCAGATCAGTAGATATTCAAGGG + Intronic
1064574633 10:16731880-16731902 TAAGATAAGCCGATATTGTTGGG + Intronic
1064821584 10:19341045-19341067 CAACATAAGCAAATATTTATTGG + Intronic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1070243470 10:74707460-74707482 CCAGGGAAGCATATGTTGATAGG - Intronic
1070341320 10:75500900-75500922 CCAAATAAACAGATTTGGATAGG - Intronic
1071393846 10:85202121-85202143 CTTGATAAACACATATTGATAGG - Intergenic
1072776360 10:98199338-98199360 ATTGATAAGCAGATATTTATTGG - Intronic
1074793530 10:116917173-116917195 ACAGATACTCAGATATTGAGTGG - Intronic
1074847443 10:117410717-117410739 TCAGATAAGCAGATCTTGATGGG - Intergenic
1077330257 11:1981030-1981052 CCAGGAAAGCAGGTCTTGATGGG + Intronic
1077781852 11:5338789-5338811 CCAGAGATGCAGATTTTTATAGG - Intronic
1078567880 11:12432622-12432644 CCAGATAAGCAGTTATTTTTTGG - Intronic
1079790735 11:24735820-24735842 CTAGAATAGCAGATATAGATTGG + Intronic
1079892739 11:26078049-26078071 ACAAATAAGCAGCTATTTATAGG + Intergenic
1080951640 11:37040478-37040500 CCAGAAAAACAGATATGGGTTGG - Intergenic
1083451772 11:62751074-62751096 CCAGATAAGCAGGACTTTATGGG - Exonic
1085718567 11:78893900-78893922 TCAGATAAGCATATATATATTGG - Intronic
1086736327 11:90309799-90309821 ACAGTCAAGCAAATATTGATAGG + Intergenic
1088146315 11:106684261-106684283 CCACATAATCAGATATTAAAAGG + Intronic
1090028675 11:123188823-123188845 CCAGATAACCAGAACTTGAAGGG + Intronic
1202813236 11_KI270721v1_random:36209-36231 CCAGGAAAGCAGGTCTTGATGGG + Intergenic
1094804436 12:34074974-34074996 CCAAAAAATCAGGTATTGATGGG + Intergenic
1094868896 12:34576182-34576204 CCAAAAAATCAGGTATTGATGGG + Intergenic
1095762129 12:45851469-45851491 CCAGCTCAGCAGCTATTGGTTGG + Exonic
1096809023 12:54158078-54158100 CCAGGTAAGCAGACCTTGAGGGG - Intergenic
1099408179 12:82288954-82288976 CCAGTAAAGGAGAAATTGATTGG - Intronic
1100045147 12:90370969-90370991 CCAGATAAGCAGCTTTTCTTGGG + Intergenic
1108262050 13:48668114-48668136 CCAGATAATCAGATTTTCATGGG - Intronic
1109548674 13:63862438-63862460 CCAGATAAGCAAAAGTTGAAGGG + Intergenic
1110278025 13:73661320-73661342 CCACATTTGCAGTTATTGATGGG + Intergenic
1110404412 13:75133874-75133896 CCATATAAGATAATATTGATGGG + Intergenic
1112921142 13:104614325-104614347 CCAGAGAAGAAGATTTTAATTGG - Intergenic
1119493786 14:75061516-75061538 GCAGAAAAACAAATATTGATTGG - Intronic
1120084250 14:80251277-80251299 TCAGATAAGCCGATACTAATTGG + Intronic
1121232276 14:92366494-92366516 GCAGAAGAGAAGATATTGATTGG + Intronic
1122023229 14:98856575-98856597 CAAGGTAGGCAGATATTAATCGG - Intergenic
1126386913 15:48102895-48102917 AAAGATAAGCAGAAGTTGATAGG - Intergenic
1127766745 15:62193340-62193362 CCAGATCTCCAGATATTGAGGGG + Intergenic
1129057286 15:72829680-72829702 CCACAGAAGCAGAGACTGATGGG - Intergenic
1131895551 15:97025275-97025297 CCAGAGAAATAGATATTAATAGG - Intergenic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1136053955 16:27673987-27674009 CCAGATACCCAGATATTTACTGG - Intronic
1145945113 17:28768050-28768072 CCAAGCAAGCAGACATTGATGGG + Intronic
1150940693 17:69690414-69690436 TCAGTTGAGCAAATATTGATGGG + Intergenic
1153312094 18:3686845-3686867 CCAGATAAGATAATATTTATAGG - Intronic
1158198392 18:54913048-54913070 CCAGATAAGCAGATATTGATGGG + Intronic
1158826073 18:61221212-61221234 TAGGACAAGCAGATATTGATTGG - Intergenic
1159670628 18:71216570-71216592 CTAGTTAAGCAGCTATTGGTTGG + Intergenic
1165987068 19:39778737-39778759 CTAAATAAACAGATATTGAATGG + Intronic
925808179 2:7673059-7673081 ACAGAAAAGCAGCTATTAATGGG + Intergenic
925962478 2:9030804-9030826 TCAGAGTAGCAGATTTTGATAGG + Intergenic
926747241 2:16168926-16168948 CCAGATAAGAAGACAATGACAGG + Intergenic
927346920 2:22055494-22055516 CTAGATATGTAGATATAGATGGG - Intergenic
929809379 2:45176342-45176364 CCATATGAGTAGATTTTGATTGG + Intergenic
930493140 2:52102124-52102146 CCAGAATAGCTGATATTGTTTGG - Intergenic
932742255 2:74300693-74300715 ACAGATAAGCATAAATTGGTGGG - Intronic
937732444 2:125249935-125249957 TCTGATAAGCAGATTTTGAGTGG + Intergenic
937861625 2:126715792-126715814 CCAGAAATTCAGATATTTATAGG - Intergenic
939750482 2:146039054-146039076 CTATATAAACAGATATTGACTGG - Intergenic
939895527 2:147786524-147786546 CCTGATAAGCAGAGAAGGATGGG - Intergenic
943049585 2:182899087-182899109 GCAGATAAGCAGATAATTCTGGG - Intergenic
944389216 2:199200215-199200237 CAAAATAAGCAGAGATTGACAGG + Intergenic
944656092 2:201878037-201878059 CCAATTAAGCAGACATAGATGGG - Intronic
1173344643 20:42187678-42187700 CCAGCTGAGTAGATATTGATGGG + Intronic
1177137029 21:17315751-17315773 TCAGATAAGCAAATGTTGAGGGG + Intergenic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
949590691 3:5491216-5491238 CCAGGACAGCAGATAGTGATAGG - Intergenic
951821804 3:26822125-26822147 CCTAATAAGCAGATATAGCTAGG - Intergenic
952656478 3:35792509-35792531 CCTGATAAGAAGACATTGTTGGG - Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
952827477 3:37536341-37536363 CAAGATATGCAGACATTGAGAGG - Intronic
956629362 3:71300021-71300043 CCAGATAAGTAGAGATTCTTGGG - Intronic
956688483 3:71854609-71854631 CCAGATAAGGAGAGACTGTTAGG - Intergenic
960615039 3:119588621-119588643 CCAGCCTAGCAGATATTGTTAGG - Exonic
961063561 3:123854167-123854189 CCAGCTCAGCAGATCTTGATTGG - Intronic
961958029 3:130824506-130824528 CCAGGTAAGCAGATAGTCAGAGG - Intergenic
964231392 3:154474003-154474025 CCAGACAATCAAATATTCATTGG - Intergenic
965649318 3:170917701-170917723 CCAGATAAGCAAATGTTGAGGGG + Intergenic
965967169 3:174507004-174507026 CAAGATAAACAGATATTGAGAGG - Intronic
966977581 3:185099005-185099027 CCAGAGAAACAGAGATAGATGGG - Intronic
969939284 4:10714053-10714075 CTAGACAGGCAGATATTGTTGGG + Intergenic
970475136 4:16414435-16414457 CCAAATCTGCAGATTTTGATGGG + Intergenic
972243421 4:37218979-37219001 ACAGATAAGAATATATTGAGTGG - Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975425199 4:74217098-74217120 CCAGGAAAGCAGATATGGCTAGG - Intronic
976185177 4:82436209-82436231 GCAGATAAGTAGTTGTTGATGGG + Intronic
977866849 4:102039013-102039035 TCAGATAAGCAGAGATGGAAAGG - Intronic
978686421 4:111450435-111450457 TCAGATAAGCAGATAAGGAAGGG - Intergenic
979429465 4:120611113-120611135 CCAGATAAGAAGGTAATGATTGG + Intergenic
980616169 4:135228805-135228827 GCAAAGAAGCAGATATTGAAAGG - Intergenic
980616177 4:135228895-135228917 GCAAAGAAGCAGATATTGAAAGG - Intergenic
981462048 4:145024792-145024814 CCAGACAAGCTGATTTTGTTAGG - Intronic
982091742 4:151885566-151885588 CCAGATGAGCAGCTAGTGACTGG + Intergenic
982348168 4:154384721-154384743 CCAGGGAAGCAGAGATTGAAGGG + Intronic
982597889 4:157407807-157407829 CCTGGTATGCAGCTATTGATTGG - Intergenic
983077912 4:163348194-163348216 GTAGATAAACATATATTGATAGG + Intronic
987569467 5:19637674-19637696 CGGGATAAGCAGACATTGACTGG - Intronic
988001271 5:25352179-25352201 CCAGATAAACAGATATAAAAAGG + Intergenic
988035273 5:25820017-25820039 CCTGATGAGCAGATATTTGTGGG + Intergenic
988173199 5:27685692-27685714 CCAGATAAGGTCATATTCATAGG + Intergenic
990108018 5:52288449-52288471 CCAGGTAAGAACATATTCATAGG - Intergenic
992688829 5:79223633-79223655 CCAGATATGTATATATTGGTCGG + Intronic
992775945 5:80089473-80089495 CCAGATAAGCAGACATGTTTAGG - Intergenic
994372486 5:98983113-98983135 CCAGCTCAGCAGATGGTGATGGG + Intergenic
995099435 5:108280391-108280413 CCAAACAAGCAAATATTGAGGGG + Intronic
996891039 5:128420748-128420770 TCAAATAAACAGATACTGATTGG + Intronic
996916686 5:128720648-128720670 CCAGATTAGCAGATACTTCTTGG + Intronic
999715266 5:154355289-154355311 GCAGATAAACAGATATGCATTGG - Intronic
1004962734 6:20809776-20809798 ACAGAAAATCAGAGATTGATTGG + Intronic
1009276693 6:61690802-61690824 CATGAGAAGCAGATACTGATAGG + Intronic
1012910846 6:105116098-105116120 CCAGATAAGATGATTTTGAAAGG + Intronic
1015885985 6:137919141-137919163 ACAGAAAAGCAGCGATTGATCGG - Intergenic
1016426527 6:143941681-143941703 CCAGAGAGGCAGGTATTGTTAGG + Exonic
1017946388 6:159099587-159099609 CAAGATAATCAGGTTTTGATTGG + Intergenic
1019065768 6:169296262-169296284 CCATATAAACAGAAATTGCTGGG + Intergenic
1020654471 7:10912885-10912907 TCAGATAAACAGATAGTTATAGG - Intergenic
1021225610 7:18022339-18022361 CCAGATAACTAGCTACTGATTGG - Intergenic
1022313100 7:29216044-29216066 GCAGAGAAGCAGCTATTGTTGGG + Intronic
1024149573 7:46557261-46557283 ACAGATAAACATATATTTATGGG + Intergenic
1027493748 7:78861559-78861581 CCAGATACTTAGATATTAATTGG - Intronic
1028805085 7:95016883-95016905 CCAGATAAGAATACATTGAAAGG - Intronic
1029318721 7:99738114-99738136 ACAAATAAGCAGATAATTATAGG + Intergenic
1031255284 7:119439597-119439619 CCAGATAAGTAGATAATTTTTGG - Intergenic
1032777017 7:135123827-135123849 CCAGACAAGCAAATACTGAGGGG + Intronic
1036125029 8:6054749-6054771 GCAGAGTAGAAGATATTGATGGG - Intergenic
1040839194 8:51766535-51766557 CCAGATAAACAGATATGGAGAGG - Intronic
1041296245 8:56360091-56360113 CCAGACAAGCAAATACTGAGGGG - Intergenic
1044333630 8:90950133-90950155 TCAGATAAGAAGATATAGATAGG + Intronic
1052745942 9:32441128-32441150 GCCCATAAGCAGATATTCATAGG - Intronic
1053623945 9:39849485-39849507 CCAAATAAGCTGATATTATTTGG + Intergenic
1053880924 9:42593744-42593766 CCAAATAAGCTGATATTATTTGG - Intergenic
1054219952 9:62401215-62401237 CCAAATAAGCTGATATTATTTGG - Intergenic
1054230763 9:62507957-62507979 CCAAATAAGCTGATATTATTTGG + Intergenic
1055062715 9:72087219-72087241 CCAAATAAATATATATTGATGGG - Intergenic
1058631929 9:106998035-106998057 CCAGATAAGTAAATATTTTTAGG - Intronic
1061462945 9:130754729-130754751 CAAGATAGGAAGATATAGATGGG + Intronic
1061855696 9:133440847-133440869 TCAGATGAGCAGATGTTGCTGGG + Intronic
1186076100 X:5881002-5881024 GCAGATAAGCATATAGAGATTGG + Intronic
1186748483 X:12596011-12596033 CCAGATAAGAAGCAATTTATGGG - Intronic
1187613956 X:20972904-20972926 CCAAAGAAGCAGAAAGTGATTGG - Intergenic
1187631948 X:21183046-21183068 TAAGATAAGCAGATATTCAAAGG - Intergenic
1188843064 X:35039229-35039251 TCAGATAAGCAAATGTTGAGAGG + Intergenic
1190088854 X:47420045-47420067 TCAGATTAGCAGACAGTGATGGG - Intergenic
1190458756 X:50650194-50650216 ACAGATATGCAAATATTGAAAGG + Intronic
1192538136 X:71946093-71946115 ACAGATAAGCAGGCAGTGATAGG + Intergenic
1192597977 X:72431622-72431644 CCAGATAATAATAGATTGATTGG - Intronic
1192839900 X:74843988-74844010 TCAGATAAGCAAATGTTGAGGGG - Intronic
1198012268 X:132569428-132569450 CCAATAAAGCAAATATTGATAGG - Intergenic
1198054070 X:132976484-132976506 CCACATACACAGATTTTGATGGG + Intergenic
1198530362 X:137546138-137546160 CCAGATTTGAAGATATAGATGGG + Intergenic