ID: 1158198585

View in Genome Browser
Species Human (GRCh38)
Location 18:54915257-54915279
Sequence CTCACTAGGCAGTAAGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158198583_1158198585 4 Left 1158198583 18:54915230-54915252 CCAGAATAAAGAGGCATTTCAAA 0: 1
1: 0
2: 3
3: 22
4: 317
Right 1158198585 18:54915257-54915279 CTCACTAGGCAGTAAGTTCCAGG 0: 1
1: 0
2: 2
3: 15
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158198585 Original CRISPR CTCACTAGGCAGTAAGTTCC AGG Intronic
902652672 1:17846710-17846732 CTCAATACTCAGTAAGTTCAGGG + Intergenic
903668116 1:25020426-25020448 CTCACTAGAGTGTGAGTTCCAGG - Intergenic
904956624 1:34289778-34289800 CTCACACGGCAGTGAGTCCCAGG + Intergenic
905193714 1:36257303-36257325 CTCACTAGAATGTCAGTTCCAGG + Intronic
906811879 1:48835367-48835389 CCCACTAGCCTATAAGTTCCAGG - Intronic
906945433 1:50290544-50290566 CCCACTGGGCAGTAAATTCCTGG - Intergenic
907593819 1:55701517-55701539 CTCACTAGACTGTAAGCTCCCGG - Intergenic
907746395 1:57217997-57218019 CTCATTAGACTGTGAGTTCCTGG - Intronic
907816291 1:57921447-57921469 CTAACTAGACATTAAGTTCCAGG + Intronic
907999612 1:59667774-59667796 CTCAATAGACTGTGAGTTCCTGG - Intronic
908417618 1:63928807-63928829 CTCACTGAGCACTAAGTGCCAGG - Intronic
908599847 1:65726854-65726876 CTTACTAGGTAGTAAGTGCAAGG - Intergenic
909590484 1:77343011-77343033 CTCACTATATAGTAAGCTCCAGG + Intronic
911261785 1:95694921-95694943 CTCACTGGGCAGAGAGTTTCAGG + Intergenic
911539565 1:99142327-99142349 CTCATTAGATAGTAAGCTCCAGG - Intergenic
912195305 1:107390827-107390849 CTCACTAGAGGATAAGTTCCTGG - Intronic
915746353 1:158162217-158162239 CTAACTAGTCTGTGAGTTCCTGG - Intergenic
915836079 1:159176198-159176220 CTCAGTAGTCAGTAAGTAGCTGG - Intronic
915928581 1:160042993-160043015 CTCACTAGGCTGTGAGTTCTTGG - Intronic
917258096 1:173138192-173138214 CTCCCTAGTCAGCAAGTCCCGGG + Intergenic
917380519 1:174401205-174401227 CTCACTATGCAGGAAGACCCTGG + Intronic
917431607 1:174975200-174975222 CCCACTAGGCTTTAAGCTCCAGG - Intronic
918292720 1:183124414-183124436 CTCACTAGACAGGAAGCACCTGG - Intronic
918882903 1:190149195-190149217 GTCACTAGTGAGTCAGTTCCAGG + Intronic
920122035 1:203665982-203666004 AATACTAGCCAGTAAGTTCCTGG - Intronic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
1063110892 10:3036340-3036362 CTCACTAGAAAGTGATTTCCTGG - Intergenic
1064276217 10:13907611-13907633 GGAAGTAGGCAGTAAGTTCCTGG + Intronic
1071464133 10:85924001-85924023 CTCACTAGGAAGTGAGCTCCTGG + Intronic
1073164497 10:101433063-101433085 CTCACCAGACAAGAAGTTCCAGG + Intronic
1074338457 10:112602261-112602283 CTCAATAAACAGTAAGTCCCAGG - Intronic
1074772970 10:116745134-116745156 CCCACTGGGAAGTAAGTCCCAGG + Intergenic
1075980149 10:126731322-126731344 CTCACTAGAATGTAAGCTCCAGG - Intergenic
1077755825 11:5026107-5026129 ATCACTAGGCAGGGAGTCCCTGG + Intergenic
1078129065 11:8596902-8596924 CTAACTAGCTACTAAGTTCCAGG - Intergenic
1079428625 11:20366767-20366789 CTCACTAGGCATGTAGTTACGGG - Intronic
1085311271 11:75518310-75518332 CTCTCCAGGCAGGAAGGTCCTGG + Intronic
1092159410 12:6307872-6307894 CTCACCAGGCAGGAAGGTCAGGG - Intergenic
1093781723 12:23145155-23145177 CTCATTAGACTGTGAGTTCCAGG - Intergenic
1097263201 12:57731156-57731178 CCCACTAGACTGCAAGTTCCTGG + Intronic
1097612303 12:61839131-61839153 CTCACCAGACTGTAAGTTCCTGG - Intronic
1098187486 12:67912953-67912975 CCCACTAGATAGTAAGTTCAGGG + Intergenic
1098686366 12:73425903-73425925 TTCACTAGGCAGTATGTTTGAGG + Intergenic
1098886208 12:75963193-75963215 CCAACTAGGCAGTATCTTCCAGG + Intergenic
1099603369 12:84769976-84769998 CTCACTATGCACCAAGTTCTAGG - Intergenic
1100431696 12:94536556-94536578 TTCTCTAGGGTGTAAGTTCCAGG + Intergenic
1100460344 12:94793241-94793263 CTCAGTTGCCAGTGAGTTCCTGG - Intergenic
1100661243 12:96701454-96701476 CTCACTGGACTGTAAGCTCCAGG - Intronic
1100786399 12:98083057-98083079 CTCCCTATCAAGTAAGTTCCAGG - Intergenic
1102464632 12:113121335-113121357 CTCACTGGGTTGTAAGTTCCTGG - Intronic
1102562531 12:113772510-113772532 CCCACTAGAATGTAAGTTCCAGG - Intergenic
1103914357 12:124368812-124368834 CTCACTAGAATGTAAGTGCCTGG + Intronic
1104283912 12:127405530-127405552 CTCACTAGAAAATAAGCTCCAGG - Intergenic
1107117138 13:36759416-36759438 CTCTCTAGAAAGTAACTTCCTGG + Intergenic
1107178478 13:37427869-37427891 CTCACTAGGCTGTAACTTTTGGG - Intergenic
1108223064 13:48258122-48258144 CTAAATAGGCTGTAAGTTTCTGG - Exonic
1112912916 13:104510578-104510600 CCCACTAGTCAGAAAGTTCCAGG - Intergenic
1117889379 14:60401880-60401902 GCTACTAGGCTGTAAGTTCCAGG - Intronic
1118002646 14:61537980-61538002 GTCACCAGGCAGTGAATTCCAGG + Intronic
1118311087 14:64693644-64693666 CTCAATAGGCAGTGAGTTCCGGG - Intergenic
1118376315 14:65180332-65180354 ATTACTAGGCAGAATGTTCCAGG + Intergenic
1120062910 14:80005507-80005529 CTCACTGGGGAGTGAGTTCATGG - Intergenic
1121029473 14:90645872-90645894 CTCACTGGACTGTAGGTTCCAGG - Intronic
1122199318 14:100112829-100112851 CTCTCTAGATTGTAAGTTCCAGG + Intronic
1122417959 14:101559449-101559471 CCCTCTACGTAGTAAGTTCCTGG + Intergenic
1127876243 15:63114047-63114069 CTCTCTGGGCAGTAAGTGGCAGG - Intergenic
1131041847 15:89275723-89275745 CTCACTAACCAGGAAATTCCTGG + Intronic
1131242774 15:90761842-90761864 CTCACTAAGCTGTGAGCTCCAGG - Intronic
1132295182 15:100729304-100729326 CCCACTAGAAAGTAAGATCCAGG + Intergenic
1135195481 16:20390600-20390622 CTCACTAGGATGTCAGTTCCAGG + Intronic
1137253832 16:46759153-46759175 CACAGAAGGCAGTAAGATCCTGG - Intronic
1137769521 16:51004763-51004785 CCCATGAGACAGTAAGTTCCAGG + Intergenic
1138329373 16:56201194-56201216 TTCTCTAGGCAGGAAGTTCAGGG + Intronic
1142976439 17:3647512-3647534 CTCACCCTGCGGTAAGTTCCTGG + Exonic
1144646031 17:16974233-16974255 TTCAACAGGCAGAAAGTTCCTGG - Intergenic
1145353122 17:22106694-22106716 TTCACTAGGCAATGAGTTCTAGG + Intergenic
1145725848 17:27123305-27123327 TTCACTAGCCAGAAAGTTCATGG + Intergenic
1146578424 17:34014374-34014396 CTCATCTGGCAGTAAGTTTCTGG + Intronic
1152590391 17:81208794-81208816 CTCACTAGCCAGCAAGGGCCCGG + Intronic
1152790097 17:82274025-82274047 CTCACTGGGCTGCCAGTTCCCGG + Intergenic
1153255077 18:3162353-3162375 TTCAGTAGGCTGTAAGTTACAGG - Intronic
1155174548 18:23290974-23290996 GCCACTAGAAAGTAAGTTCCAGG + Intronic
1158198585 18:54915257-54915279 CTCACTAGGCAGTAAGTTCCAGG + Intronic
1160433572 18:78829318-78829340 TTCACTCGGCAGTTACTTCCTGG + Intergenic
1161279644 19:3438841-3438863 CTCACTAGGCTGTTAGCCCCTGG - Intronic
1166948655 19:46412390-46412412 CTACCTGGGCAGCAAGTTCCTGG - Exonic
929055978 2:37876099-37876121 CCCACTAGACTGTAAGTTCAGGG - Intergenic
929940636 2:46331243-46331265 CTGACTGGGCTGTCAGTTCCTGG + Intronic
930476423 2:51888340-51888362 CACACTAGACAGTATTTTCCTGG + Intergenic
936476958 2:112847788-112847810 CTCACCAGTGTGTAAGTTCCTGG + Intergenic
936550171 2:113430903-113430925 CTCACTAGACACAAACTTCCTGG + Intergenic
937081152 2:119140871-119140893 CTCACTTGAGAGTAAGTTCCTGG - Intergenic
943611869 2:190044365-190044387 ATCACCAGGCAGTAAACTCCTGG - Intronic
945153629 2:206814090-206814112 GTAACTAGGGAGTTAGTTCCAGG - Intergenic
945421273 2:209639883-209639905 CTCACAAGGCTGTGAGCTCCTGG - Intronic
947258799 2:228197392-228197414 ATCAACAGGCAGTAAGTTTCAGG + Intergenic
948942615 2:241203809-241203831 CTCCCTAGGATGGAAGTTCCTGG - Intronic
1169451900 20:5719146-5719168 CTACCTAGGCAGTAAGCCCCAGG - Intergenic
1171563359 20:26150891-26150913 TTCACTAGGCAATGAGTTCTAGG + Intergenic
1172297822 20:33826065-33826087 CTCACCAGACAGGGAGTTCCTGG - Intronic
1172952282 20:38729811-38729833 CTCACTAGACTGTAAGCTCCCGG - Intergenic
1173186278 20:40842932-40842954 CCCACTAGGTGGTAAGTTCCAGG - Intergenic
1174715556 20:52754127-52754149 CTCACTTGGCAGTGAGTTCAGGG - Intergenic
1175707255 20:61189307-61189329 TTGATAAGGCAGTAAGTTCCTGG + Intergenic
1177183568 21:17769315-17769337 CTAACCAGGCAGTAAATTACAGG - Intergenic
1181285082 22:21746153-21746175 CCCACTTGCCAGGAAGTTCCTGG - Intergenic
1182466483 22:30520008-30520030 CTCAGCAGGCAGCAATTTCCTGG - Intergenic
949945063 3:9183409-9183431 CTCTCTAGTAAGTAAGTGCCAGG - Intronic
950096646 3:10334532-10334554 GTCACTAGGCAGTCACTGCCAGG - Intronic
950787841 3:15450692-15450714 CTCTCTAGGCAGAGCGTTCCTGG - Exonic
951107967 3:18768114-18768136 CCCACTAGACTGTAAGCTCCAGG - Intergenic
954293519 3:49662039-49662061 CTCTCGGGGCAGGAAGTTCCAGG + Exonic
954944499 3:54408057-54408079 CCCATTAGACAGTAAGTTCTAGG - Intronic
956114518 3:65904763-65904785 CTCACTAGACTGGAAGCTCCAGG + Intronic
956370482 3:68553773-68553795 CTCACAAGCCAGTAAGAGCCAGG + Intergenic
958148008 3:89652477-89652499 CTTACTAGGAGGTAAGTTCAGGG - Intergenic
962611662 3:137082520-137082542 CTCACTAGACCCTAAGTTCCTGG - Intergenic
962939681 3:140114436-140114458 CTCACTGGCCTGTAAGTTCTTGG + Intronic
963675132 3:148301223-148301245 CTCAGTAGGCAGAAGTTTCCAGG - Intergenic
964100909 3:152987435-152987457 CTCACTTGGCAGTGGTTTCCTGG + Intergenic
972840506 4:42924690-42924712 CTAATTAGGAAGTAAGTTCTAGG - Intronic
972966737 4:44519613-44519635 CCCACTAGACTGTAAGCTCCAGG - Intergenic
973713641 4:53653721-53653743 CTCACCAGGCAGAAGTTTCCAGG - Intronic
984441728 4:179779420-179779442 CTCACTGGGCAGAATATTCCAGG - Intergenic
992140431 5:73791244-73791266 CTCAATAGGCTGTAAATTCTGGG - Intronic
995963745 5:117878160-117878182 CTCATTAGGCATTTAGTTCATGG + Intergenic
996940543 5:129000006-129000028 ATCACTAGGGTGAAAGTTCCTGG + Intronic
1000640728 5:163698831-163698853 CTCACTAGGCACTAAATGTCTGG - Intergenic
1001092664 5:168752742-168752764 TTCACTATGCTGTGAGTTCCAGG + Intronic
1001589772 5:172857449-172857471 CACACAAGGCAGTGAGTCCCAGG - Intronic
1006707403 6:36032730-36032752 CCCACTAGGCTGTAAGTTCCAGG - Intronic
1008464911 6:51819603-51819625 CCAGCTAGGCAGTATGTTCCAGG + Intronic
1010036767 6:71334568-71334590 GGCACTAGCCTGTAAGTTCCAGG + Intergenic
1010903472 6:81456499-81456521 CTCTCTAGGCAGTGAATTACAGG + Intergenic
1010938849 6:81892142-81892164 CTCTCTAGGCACTAATTTCAGGG - Intergenic
1013138439 6:107305849-107305871 CGCACTAGACTGTAAGTTTCTGG - Intronic
1014993011 6:128104627-128104649 TTCTTTAGTCAGTAAGTTCCTGG + Intronic
1021462403 7:20903179-20903201 GTCATTAGGCAGTAAATTCTAGG - Intergenic
1021868007 7:24978413-24978435 CTCATTAGGATGTAAGTACCAGG - Intronic
1025274355 7:57563480-57563502 TTCACTAGGCAATGAGTTCTAGG - Intergenic
1033430114 7:141281552-141281574 CACACTAGACAGAAAGCTCCAGG - Intronic
1039883909 8:41644928-41644950 CCCACTAGGCTATAAATTCCTGG + Intergenic
1040741602 8:50582362-50582384 CTCACTAGAATGTAAGTTCTAGG - Intronic
1045213159 8:100120065-100120087 CCCACCAGACAGTAAATTCCTGG + Intronic
1047003766 8:120598527-120598549 CTCACTAGACTCTAAGCTCCTGG - Intronic
1048862006 8:138730455-138730477 CTTACTAGGCTGTAATTTTCTGG - Intronic
1049787690 8:144458908-144458930 CTCACTCGGGTGTAAGTGCCGGG - Intronic
1049902768 9:185917-185939 CTCACTAGACAAAAACTTCCTGG - Intergenic
1050535575 9:6627817-6627839 CTCACTAGGCTGTATGTTTGGGG - Intronic
1051722965 9:20058067-20058089 CTCACTGGTCAGAAACTTCCTGG + Intergenic
1052162065 9:25275075-25275097 CTATCTAGGCAGTAAGTTGGGGG - Intergenic
1052297652 9:26915878-26915900 CTCACTTGGTATTAAGTTTCAGG + Intronic
1052449194 9:28605530-28605552 CTCACTAAAATGTAAGTTCCTGG + Intronic
1053745792 9:41196201-41196223 CTCACTAGACACAAACTTCCTGG - Intronic
1054481480 9:65669015-65669037 CTCACTAGACACAAACTTCCTGG + Intronic
1054682552 9:68235072-68235094 CTCACTAGACACAAACTTCCTGG + Intronic
1057105403 9:92410456-92410478 CTCACAAGGCACTCAGTTGCTGG - Intronic
1057475657 9:95399069-95399091 TTCACTTGGAAGTAAGTTCTTGG - Intergenic
1057819469 9:98319882-98319904 CTTACTAGGCAGTAAGATTCAGG + Intronic
1059101014 9:111471571-111471593 CTCAATATCCAGTGAGTTCCTGG - Intronic
1059491046 9:114667545-114667567 GCCACTAGACAGTAAGTGCCAGG - Intergenic
1202781923 9_KI270718v1_random:6980-7002 CTCACTAGACACAAACTTCCTGG - Intergenic
1187259145 X:17669186-17669208 CCCAGTAGACAGCAAGTTCCAGG + Intronic
1187561990 X:20412001-20412023 CTAACTTGGCAGTAAGGTACTGG - Intergenic
1189312461 X:40029370-40029392 CCCACTAGACGGTAAGCTCCAGG + Intergenic
1189640166 X:43060297-43060319 GTCTCTAGGTAGTAAGTTCTTGG - Intergenic
1190632516 X:52401413-52401435 CTCAGAAGGCAGTCAGTTCAGGG + Intergenic
1193471323 X:81907534-81907556 TGCACTAAGCAGTAAGATCCTGG + Intergenic
1195596803 X:106700358-106700380 CCCACTAGATTGTAAGTTCCAGG + Intronic
1195720065 X:107858616-107858638 CTAACTAGACTGAAAGTTCCTGG - Intronic
1199811319 X:151352681-151352703 CTCATTAGGCACTATATTCCAGG + Intergenic