ID: 1158199786

View in Genome Browser
Species Human (GRCh38)
Location 18:54926903-54926925
Sequence GCAGTTTTCAGAATAACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158199786_1158199790 25 Left 1158199786 18:54926903-54926925 CCTGAGGTTATTCTGAAAACTGC 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1158199790 18:54926951-54926973 CAGTAATGGTAATAGAAATATGG 0: 1
1: 0
2: 0
3: 30
4: 309
1158199786_1158199788 11 Left 1158199786 18:54926903-54926925 CCTGAGGTTATTCTGAAAACTGC 0: 1
1: 0
2: 0
3: 18
4: 147
Right 1158199788 18:54926937-54926959 CCTGTGTCAATTACCAGTAATGG 0: 1
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158199786 Original CRISPR GCAGTTTTCAGAATAACCTC AGG (reversed) Intronic
905698386 1:39993012-39993034 GCAGTTTTCATAACACCCTCTGG + Intergenic
907264218 1:53246271-53246293 GTAGTTTTCAGAAAAGCCTTTGG - Exonic
909772056 1:79436080-79436102 CCAGTTTTCAAAAAATCCTCAGG - Intergenic
910195188 1:84633066-84633088 GCAGTTCTGAGAATGACCTAAGG - Intronic
911237913 1:95431734-95431756 GGAGTTTTCAGAATACCCTACGG - Intergenic
915657612 1:157374821-157374843 GCAGGCTTCTGAATAATCTCTGG - Intergenic
915671467 1:157492167-157492189 GCAGGCTTCTGAATAATCTCTGG + Intergenic
919527583 1:198672920-198672942 GAAGTTTTAACAATATCCTCAGG - Intronic
919743016 1:200991887-200991909 GCAGTTTTCACTGCAACCTCTGG - Intronic
920591487 1:207222973-207222995 CCATTTTTCTGAATAACATCTGG + Intergenic
921329795 1:214024165-214024187 GCAGATTGCAGAATGAACTCGGG - Intronic
924829510 1:247578426-247578448 GCAGTTTTCAAAAGAAGCTTAGG - Intergenic
1062805554 10:417190-417212 GCAGATGTCAGAATTGCCTCAGG + Intronic
1063114673 10:3065827-3065849 GCACTTATCAGAGTAACCTAGGG + Intergenic
1063478681 10:6351135-6351157 CCAGTTTTCAGAATAATCAGAGG - Intergenic
1063737601 10:8778219-8778241 GAAGTTTTGAGATTGACCTCTGG + Intergenic
1065600108 10:27359349-27359371 GCAGTCTTCAGAATAAATTGGGG - Intergenic
1067208287 10:44238221-44238243 GTAGTCATCAGAATAACCTGGGG + Intergenic
1067793311 10:49303559-49303581 ACACTTTTCAGAATGCCCTCGGG - Intronic
1068836796 10:61564212-61564234 CAAGTTTTCAAAATAACCCCTGG - Intergenic
1069835032 10:71302761-71302783 GCAGTTTACAGAATAAACAGAGG - Exonic
1069837109 10:71316517-71316539 GCAATGTTCAGGATAACTTCAGG + Intergenic
1070490026 10:76967505-76967527 CCAGTTTACAGAAAGACCTCAGG - Intronic
1072553821 10:96499185-96499207 GCAGTGTTCAGGAAAACCACTGG + Intronic
1078531647 11:12141069-12141091 GCAGTTATCAAAATATCCGCTGG + Intronic
1079340550 11:19608090-19608112 GCAGTTTTCAAATTCATCTCTGG + Intronic
1081297884 11:41414102-41414124 TCCGTTTTCACAACAACCTCAGG - Intronic
1081435421 11:43022432-43022454 TCTCTTTTCAGAATGACCTCAGG + Intergenic
1083583067 11:63837735-63837757 GCAGTTTTCCCAATAACTCCTGG + Intergenic
1085220866 11:74872773-74872795 TCAATTTTCAGAATCACCTGGGG - Intronic
1086110965 11:83197585-83197607 GCTGTTTTCAAAACAACTTCAGG + Intronic
1087289898 11:96309261-96309283 GCAGTTTTGAAACTGACCTCTGG - Intronic
1088911385 11:114195226-114195248 GCAGTCTTCAGCATGCCCTCGGG + Intronic
1090314949 11:125778035-125778057 GCAGTCTTGAGAATATTCTCTGG + Intronic
1093675117 12:21929682-21929704 GCAGTTTCCAGAATAAGATGGGG + Intronic
1095657742 12:44690158-44690180 GCATTTTTCATAAGATCCTCAGG + Intronic
1096485051 12:51974469-51974491 GCAGTGTACACAATCACCTCTGG - Intronic
1099470728 12:83044517-83044539 GCCGTTTTGAGAACACCCTCTGG + Intronic
1099708243 12:86184881-86184903 CCAGTTTTCAGAAAAAAATCTGG + Intronic
1100475088 12:94928072-94928094 GCAGCTTTCAGAAGAGACTCTGG - Intronic
1102092973 12:110209466-110209488 ACAGTTTTCAGATTATCCTCAGG + Intronic
1106043944 13:26120125-26120147 GCAGTTTCCAGAAGCTCCTCTGG - Intergenic
1106777397 13:33021395-33021417 GAAGTTTTCAGAATAAGGGCAGG + Intronic
1108305598 13:49128934-49128956 GCAGGTTACAGAATAAACACAGG - Intronic
1109067363 13:57715226-57715248 TCAGTTTTCAGAATGATCCCAGG - Intronic
1109297045 13:60546708-60546730 GCAGTTTTCAAAATAATTTCAGG + Intronic
1110333582 13:74300781-74300803 GTAGTTTTCAGAATTATCTCTGG + Intergenic
1110507815 13:76309232-76309254 ACTTTTTTCAGAATAACCTGAGG - Intergenic
1115015288 14:28604142-28604164 GAAGTTTTTAGAATAAATTCAGG - Intergenic
1126925649 15:53583457-53583479 GGAGTTTTCAGAATTTCCTCAGG - Intronic
1131559663 15:93428488-93428510 GCAGATTTCTGAGGAACCTCAGG - Intergenic
1131609465 15:93946013-93946035 TGAGTTCTCAGAATAACCTAAGG - Intergenic
1138917765 16:61488558-61488580 GCAGTTTTCAGATTAACGTTTGG + Intergenic
1147320054 17:39640588-39640610 GCCGTTTCCAGACTAACCTTGGG + Intronic
1150323530 17:64236974-64236996 GCAGTACTCAGATTGACCTCAGG + Intronic
1156511324 18:37639360-37639382 CCATTTTTCAGTATAATCTCAGG + Intergenic
1156903596 18:42329095-42329117 GCAGTTTCCAGATGAGCCTCTGG + Intergenic
1158199786 18:54926903-54926925 GCAGTTTTCAGAATAACCTCAGG - Intronic
1160283523 18:77517352-77517374 GCACTGTTCAAAATAACCCCAGG + Intergenic
1162872591 19:13597824-13597846 GTAGATGTCAGACTAACCTCAGG + Intronic
1163261013 19:16190056-16190078 GCATATTTCAGAATAACCCTGGG + Intronic
1164187200 19:22880709-22880731 TCAATTTTCAGAATCACCTGGGG - Intergenic
1165737293 19:38184766-38184788 CTAGTTTTCAGAATCCCCTCTGG - Intronic
1166317570 19:41997693-41997715 GCAGTTTCCACAGAAACCTCCGG + Intergenic
1168610103 19:57792122-57792144 GCAGTTTTCATCACAATCTCTGG + Intronic
1168616840 19:57844676-57844698 GCAGTTTTTATAACAACCTCTGG + Exonic
925747020 2:7051939-7051961 CCAGTATTCAGAATAACCCAAGG + Intronic
929307389 2:40379057-40379079 CCAGTTTCCAGAATAGCATCTGG + Intronic
929909813 2:46080188-46080210 GCAGTTCTCAGAATGACTTGAGG + Intronic
930543248 2:52734342-52734364 GCAGTTTTCTGACTGACCTTTGG - Intergenic
935453945 2:103243660-103243682 GCAGGTGTCAGCATCACCTCGGG - Intergenic
935679131 2:105620839-105620861 GCAGTTTTCAGGATAAACCTAGG - Intergenic
935869667 2:107432711-107432733 GAAGGTTTCAGACTTACCTCTGG - Intergenic
937874345 2:126809927-126809949 GCTGTTTACAGAATACACTCAGG + Intergenic
940041382 2:149364906-149364928 GAAGTTTTCAAAATCACCCCAGG + Intronic
941358655 2:164524026-164524048 GCAGCTTTTAGAAAAATCTCTGG + Intronic
942330489 2:174818389-174818411 GCAGTTTTCAGAGCAAGCTCAGG - Intronic
945688743 2:213006561-213006583 GTAGTTTTCAGAATAACATATGG - Exonic
946662018 2:222011270-222011292 GCATATTTCAGCATAACCTGAGG + Intergenic
946736889 2:222762810-222762832 ACAGTTTTCAGTTTTACCTCTGG - Intergenic
948532717 2:238621936-238621958 GCTGTGTTCATAATAATCTCTGG - Intergenic
1169641485 20:7757270-7757292 GCAGGTATCAGAATCACCTGGGG - Intergenic
1170973436 20:21138556-21138578 GCAGTTGGAAGTATAACCTCAGG - Intronic
1173042545 20:39477989-39478011 ACAGTTTTTAGAATAATTTCAGG + Intergenic
1176994080 21:15533822-15533844 GCAGCTTCCAGAATAACCCCAGG + Intergenic
1177397398 21:20555178-20555200 ACAGTTTTCCTAAAAACCTCTGG - Intergenic
1179895318 21:44358541-44358563 GCAGTTTCCAGCATCACATCAGG + Intronic
1179902776 21:44402564-44402586 GCAGTTTTCAGTTTGACCTTTGG - Intronic
1179981491 21:44898123-44898145 ACAGTTTTCAGCTTGACCTCTGG + Intronic
1181801404 22:25349980-25350002 GCAGCTTTCTTAATATCCTCAGG + Intergenic
1183836523 22:40458771-40458793 GCTGTTTTCAGAAACACCTCAGG + Intronic
1183942991 22:41306853-41306875 GCTGCTGTCTGAATAACCTCAGG - Intronic
949233551 3:1780429-1780451 GTAATTTTCAGAATAACATATGG - Intergenic
950371470 3:12534342-12534364 TCAGTTTTCAGAATTCTCTCTGG - Intronic
953567815 3:44048172-44048194 GCAGTCTTCAGAATGGTCTCTGG + Intergenic
954638405 3:52084105-52084127 GCTGGTTCCAGAATAAACTCTGG + Intronic
955016346 3:55073854-55073876 ACAGTTCTCAGACTTACCTCAGG - Exonic
956001839 3:64738087-64738109 CCACTTTTGAGAATAAGCTCTGG + Intergenic
956739870 3:72267348-72267370 GCAGTTGTCTGAAAAACCTGTGG - Intergenic
956921588 3:73935435-73935457 GCAGTTTTCATAAATACTTCAGG - Intergenic
959443938 3:106413688-106413710 GCAGTTTTCTGAATCACTTGTGG + Intergenic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
961577309 3:127848306-127848328 GCAGTTTCCAGAAAATGCTCAGG - Intergenic
962395787 3:135014339-135014361 GCAGTTCTCAGAATCAAGTCGGG - Intronic
963934779 3:151041065-151041087 TCAGTTTTCAGAATGAGATCTGG - Intergenic
963972667 3:151446831-151446853 GCTTTTTTCAGAAGAACCTCTGG + Exonic
967504640 3:190239645-190239667 GAAGTTTTCAGGATAGACTCAGG - Intergenic
968609354 4:1550102-1550124 GCTGTTTCCTGAAAAACCTCTGG - Intergenic
969257101 4:6009608-6009630 ACAGCTTTCAGAATGACCGCAGG + Intergenic
970462851 4:16292816-16292838 GCAGTTTCCAGAATATCATCAGG + Intergenic
976495585 4:85726043-85726065 GCAGTTTTCAAAATCAGCACTGG - Intronic
977452286 4:97213873-97213895 GCACTTTTCTGAATTAACTCAGG - Intronic
978048408 4:104164173-104164195 ACAGTTTTCTGAATTACCTTGGG + Intergenic
981823547 4:148913984-148914006 ACAGTTTTCAGAATTCTCTCTGG + Intergenic
983461027 4:168026454-168026476 TCAGTTTCCAGAATCACCTGGGG + Intergenic
984746308 4:183222619-183222641 GAAATTTTCAGAATATCATCTGG + Intronic
985188601 4:187346094-187346116 GCAGACTGCAGAATAACCACAGG - Intergenic
986252147 5:6070223-6070245 GCAGTTTCCAATATAACCACTGG + Intergenic
986459218 5:7952773-7952795 CCATCCTTCAGAATAACCTCTGG + Intergenic
986572604 5:9181139-9181161 GCAGAGGTCAGAATAACCTCAGG - Intronic
989133222 5:38127565-38127587 TCAGGTATCAGAATCACCTCGGG + Intergenic
990003519 5:50921728-50921750 GCTGTTTCCTGAAAAACCTCTGG + Intergenic
993947298 5:94131050-94131072 GAAGTCTTCAGAATAACAACAGG - Intergenic
994207798 5:97055410-97055432 GCACTTTGCAGGATGACCTCAGG - Intergenic
994681616 5:102894787-102894809 GCAGTGTTGAGAATAACTCCTGG - Intronic
996543796 5:124656529-124656551 TCTGTGTTCAGATTAACCTCTGG - Intronic
998245327 5:140496947-140496969 TCACTTTTCAGAGTTACCTCAGG + Exonic
999963333 5:156780516-156780538 ACAGTTAACAGAATAAACTCTGG + Intergenic
1001235918 5:170029517-170029539 TCAGTTCTCACAATAACCACAGG - Intronic
1002916928 6:1536882-1536904 GCAGTTTTCAAAACAACATTAGG - Intergenic
1004966462 6:20857484-20857506 CCATCTTTGAGAATAACCTCTGG + Intronic
1005133284 6:22537426-22537448 GCAGATTTGAGAATTACATCTGG + Intergenic
1006952588 6:37836163-37836185 GGAGTTGTCAGAATCACTTCGGG + Intronic
1010130341 6:72485395-72485417 GCACGTTTGAGAATTACCTCAGG - Intergenic
1017527132 6:155251258-155251280 GCAGGTTTCAAAATAGCCGCAGG - Intronic
1018453449 6:163930346-163930368 GTATTTTTCAGAATCTCCTCAGG + Intergenic
1018868545 6:167763896-167763918 GCAGGTTTCAGAACAGCATCCGG - Intergenic
1022195789 7:28066214-28066236 GCAGTTCTTAGAAATACCTCTGG - Intronic
1022650445 7:32269218-32269240 GCTGTTTTCACAACATCCTCAGG - Intronic
1027600988 7:80240954-80240976 CCAGTTTTCAGAATCACTCCTGG + Intergenic
1030077831 7:105751715-105751737 GCATTTTTCAGATTCTCCTCAGG + Intronic
1031502388 7:122535207-122535229 GCAGTTTAGAGAATAAGCTCTGG + Intronic
1032896445 7:136256060-136256082 AGAATTTTCAGATTAACCTCTGG - Intergenic
1033997427 7:147368333-147368355 ACATTCTTCAGAATATCCTCAGG - Intronic
1035739102 8:1912788-1912810 GCATTTTTCAAAATAGCATCAGG - Intronic
1039204374 8:35134482-35134504 ACAGTTATCAGTTTAACCTCTGG - Intergenic
1039408163 8:37330271-37330293 GCAGTCTTCAATATCACCTCGGG + Intergenic
1046757629 8:117988444-117988466 GCAGTTTTAATAATTATCTCAGG + Intronic
1048700595 8:137084423-137084445 TCAGTTTCCAGCCTAACCTCAGG - Intergenic
1050568459 9:6912350-6912372 GCAGTCTTCAGAATAACCCTAGG - Intronic
1056008755 9:82302960-82302982 GCAGTGTACAGATTAAGCTCAGG + Intergenic
1058170253 9:101671768-101671790 GCACTTTTAAGGATAGCCTCAGG + Intronic
1058342851 9:103920021-103920043 GCAGAATTCAGAATTACCTCAGG - Intergenic
1058662188 9:107276563-107276585 GCAGTTACCAGAATCACCTGGGG + Intergenic
1060061517 9:120464505-120464527 GTCGTTTTCAGGATTACCTCTGG + Intronic
1061128879 9:128695644-128695666 GCACTTTGCAGGATGACCTCAGG + Exonic
1062411120 9:136425095-136425117 GCAGTTTCTAGAATGTCCTCGGG - Intergenic
1187719452 X:22136076-22136098 GCAGTTCTTAAAATGACCTCTGG + Intronic
1188063769 X:25632782-25632804 GCAGTCTTCTAAATAACCTTTGG - Intergenic
1191754903 X:64582450-64582472 GCAGTTTATAGTAGAACCTCAGG - Intergenic
1192634401 X:72804166-72804188 GCAGTCTGTAGAATTACCTCAGG + Intronic
1192647309 X:72916635-72916657 GCAGTCTGTAGAATTACCTCAGG - Intronic
1193179109 X:78432619-78432641 GCAGCATCCAGCATAACCTCTGG - Intergenic
1193700682 X:84756972-84756994 GCACTTTGCAGGATGACCTCAGG + Intergenic
1197609916 X:128626565-128626587 GCAGTTTTAAAAATAAGGTCAGG + Intergenic
1198530553 X:137547078-137547100 GAAGTTTTCAGACAAACCTGTGG + Intergenic