ID: 1158205340

View in Genome Browser
Species Human (GRCh38)
Location 18:54986472-54986494
Sequence GAATTTAAACTGTGGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158205340_1158205344 8 Left 1158205340 18:54986472-54986494 CCCTGATCCCACAGTTTAAATTC No data
Right 1158205344 18:54986503-54986525 TCAATAAAGAGAGTTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158205340 Original CRISPR GAATTTAAACTGTGGGATCA GGG (reversed) Intergenic
No off target data available for this crispr