ID: 1158206681

View in Genome Browser
Species Human (GRCh38)
Location 18:55000752-55000774
Sequence CTACTTGTGGATGGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158206681_1158206688 14 Left 1158206681 18:55000752-55000774 CCATGCTCCCCATCCACAAGTAG No data
Right 1158206688 18:55000789-55000811 ACATGCCAGCATCACTTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158206681 Original CRISPR CTACTTGTGGATGGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr