ID: 1158218565

View in Genome Browser
Species Human (GRCh38)
Location 18:55126411-55126433
Sequence AGGTTTTTATAAATGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158218565_1158218568 8 Left 1158218565 18:55126411-55126433 CCTGAGTCCATTTATAAAAACCT No data
Right 1158218568 18:55126442-55126464 AACCTTACCTGCAAGTTGCTTGG No data
1158218565_1158218571 24 Left 1158218565 18:55126411-55126433 CCTGAGTCCATTTATAAAAACCT No data
Right 1158218571 18:55126458-55126480 TGCTTGGCCCACGCATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158218565 Original CRISPR AGGTTTTTATAAATGGACTC AGG (reversed) Intergenic
No off target data available for this crispr