ID: 1158218808

View in Genome Browser
Species Human (GRCh38)
Location 18:55128904-55128926
Sequence GTGGAGTCCCAGTCTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158218805_1158218808 17 Left 1158218805 18:55128864-55128886 CCCAAATAAGAATTTGAAACAGA No data
Right 1158218808 18:55128904-55128926 GTGGAGTCCCAGTCTGTTGATGG No data
1158218806_1158218808 16 Left 1158218806 18:55128865-55128887 CCAAATAAGAATTTGAAACAGAC No data
Right 1158218808 18:55128904-55128926 GTGGAGTCCCAGTCTGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158218808 Original CRISPR GTGGAGTCCCAGTCTGTTGA TGG Intergenic
No off target data available for this crispr