ID: 1158220542

View in Genome Browser
Species Human (GRCh38)
Location 18:55146233-55146255
Sequence GAAATCTCAGACAAATGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158220542_1158220552 14 Left 1158220542 18:55146233-55146255 CCTGACCATTTGTCTGAGATTTC No data
Right 1158220552 18:55146270-55146292 CACCTCCTCCCCAGGTTGGTGGG No data
1158220542_1158220554 18 Left 1158220542 18:55146233-55146255 CCTGACCATTTGTCTGAGATTTC No data
Right 1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG No data
1158220542_1158220545 6 Left 1158220542 18:55146233-55146255 CCTGACCATTTGTCTGAGATTTC No data
Right 1158220545 18:55146262-55146284 CCAGCCCCCACCTCCTCCCCAGG No data
1158220542_1158220547 10 Left 1158220542 18:55146233-55146255 CCTGACCATTTGTCTGAGATTTC No data
Right 1158220547 18:55146266-55146288 CCCCCACCTCCTCCCCAGGTTGG No data
1158220542_1158220551 13 Left 1158220542 18:55146233-55146255 CCTGACCATTTGTCTGAGATTTC No data
Right 1158220551 18:55146269-55146291 CCACCTCCTCCCCAGGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158220542 Original CRISPR GAAATCTCAGACAAATGGTC AGG (reversed) Intergenic
No off target data available for this crispr