ID: 1158220554

View in Genome Browser
Species Human (GRCh38)
Location 18:55146274-55146296
Sequence TCCTCCCCAGGTTGGTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158220543_1158220554 13 Left 1158220543 18:55146238-55146260 CCATTTGTCTGAGATTTCTATTG No data
Right 1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG No data
1158220542_1158220554 18 Left 1158220542 18:55146233-55146255 CCTGACCATTTGTCTGAGATTTC No data
Right 1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158220554 Original CRISPR TCCTCCCCAGGTTGGTGGGA AGG Intergenic
No off target data available for this crispr