ID: 1158221106

View in Genome Browser
Species Human (GRCh38)
Location 18:55151675-55151697
Sequence CCCCAAAGTCAGAGACTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158221103_1158221106 17 Left 1158221103 18:55151635-55151657 CCAGCATGCAGGCAAACTCTCAG No data
Right 1158221106 18:55151675-55151697 CCCCAAAGTCAGAGACTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158221106 Original CRISPR CCCCAAAGTCAGAGACTAGA TGG Intergenic
No off target data available for this crispr