ID: 1158225166

View in Genome Browser
Species Human (GRCh38)
Location 18:55193362-55193384
Sequence TAGTAGGCTGTGATGTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158225166_1158225172 -5 Left 1158225166 18:55193362-55193384 CCCATACACATCACAGCCTACTA No data
Right 1158225172 18:55193380-55193402 TACTACTCAGCAAGGAAAAGGGG No data
1158225166_1158225170 -7 Left 1158225166 18:55193362-55193384 CCCATACACATCACAGCCTACTA No data
Right 1158225170 18:55193378-55193400 CCTACTACTCAGCAAGGAAAAGG No data
1158225166_1158225171 -6 Left 1158225166 18:55193362-55193384 CCCATACACATCACAGCCTACTA No data
Right 1158225171 18:55193379-55193401 CTACTACTCAGCAAGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158225166 Original CRISPR TAGTAGGCTGTGATGTGTAT GGG (reversed) Intergenic
No off target data available for this crispr