ID: 1158226329

View in Genome Browser
Species Human (GRCh38)
Location 18:55205302-55205324
Sequence TGAGTCACAAAATAACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158226329_1158226330 12 Left 1158226329 18:55205302-55205324 CCAAGCTGTTATTTTGTGACTCA No data
Right 1158226330 18:55205337-55205359 AGAACTCCCTGCCCTCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158226329 Original CRISPR TGAGTCACAAAATAACAGCT TGG (reversed) Intergenic
No off target data available for this crispr