ID: 1158231159

View in Genome Browser
Species Human (GRCh38)
Location 18:55256965-55256987
Sequence TTCCAGGTATAGGACCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158231152_1158231159 21 Left 1158231152 18:55256921-55256943 CCTGTTATTCTGGAAAGTAAAGC No data
Right 1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG No data
1158231151_1158231159 29 Left 1158231151 18:55256913-55256935 CCTGTAAACCTGTTATTCTGGAA No data
Right 1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158231159 Original CRISPR TTCCAGGTATAGGACCTGGC TGG Intronic