ID: 1158231159

View in Genome Browser
Species Human (GRCh38)
Location 18:55256965-55256987
Sequence TTCCAGGTATAGGACCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158231151_1158231159 29 Left 1158231151 18:55256913-55256935 CCTGTAAACCTGTTATTCTGGAA 0: 1
1: 0
2: 1
3: 14
4: 243
Right 1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 108
1158231152_1158231159 21 Left 1158231152 18:55256921-55256943 CCTGTTATTCTGGAAAGTAAAGC 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158231159 Original CRISPR TTCCAGGTATAGGACCTGGC TGG Intronic
900284937 1:1894540-1894562 CTCCAGGGATGGGCCCTGGCTGG - Intergenic
900832509 1:4975317-4975339 TTCCAAGCATCAGACCTGGCTGG + Intergenic
903188488 1:21642821-21642843 TTCCAGGGACAGGAGGTGGCAGG - Intronic
905254422 1:36670952-36670974 TTCTAGGTATAGGATATGGTAGG + Intergenic
907373190 1:54016131-54016153 TTCCAGGCAGAGGGCGTGGCAGG + Intronic
908785278 1:67729314-67729336 TTTCAGTTCCAGGACCTGGCAGG - Intronic
912347433 1:108977448-108977470 TTCCAGGAGTTGCACCTGGCCGG - Intronic
914758057 1:150577451-150577473 TTCCATGTAGAGGACCTAGAAGG - Exonic
915515589 1:156410641-156410663 TGCCAGGTGTAGGGCATGGCTGG - Intronic
916901218 1:169225784-169225806 TTCCAGCTATAAGAACTGGAAGG + Intronic
919995584 1:202745966-202745988 TTCCAGGTATAGGTACACGCTGG - Exonic
920193668 1:204212035-204212057 TTCCAGGTAGAGGCCTGGGCTGG - Intronic
920397824 1:205659581-205659603 CTCCAGGCTTAGGGCCTGGCAGG + Exonic
1067525498 10:47036011-47036033 TCCCAGGTGTGGGGCCTGGCAGG + Intergenic
1073578777 10:104645137-104645159 TTCCAGCCAGAGCACCTGGCAGG - Intronic
1075344084 10:121669723-121669745 CTCCAGGTGTGGGACGTGGCAGG + Intergenic
1076843462 10:133057774-133057796 GTGCAGGTAAGGGACCTGGCAGG + Intergenic
1078020472 11:7652451-7652473 TACCAGGGATAGGACCAGCCTGG - Intronic
1078199496 11:9167419-9167441 TTTCAAGTAGAGGACATGGCAGG - Intronic
1080936979 11:36874423-36874445 TTCCAGCTCTAGGTCTTGGCAGG - Intergenic
1084124967 11:67093479-67093501 TCCCAAGAGTAGGACCTGGCTGG + Intergenic
1084128928 11:67118932-67118954 TTCCAGGGCTCGGGCCTGGCTGG - Intergenic
1087705288 11:101483552-101483574 TGCCAGGTATAGAACCTTGGTGG + Intronic
1089606554 11:119644795-119644817 TTCCAAGTATTGGATATGGCTGG + Intronic
1094496447 12:30992242-30992264 TTCCAGGTTCAGGAGCTGGGAGG - Exonic
1102514516 12:113437329-113437351 TTCCTGGCATAGGGCATGGCAGG + Intronic
1102619008 12:114178806-114178828 TCACAGGTATAGCAGCTGGCGGG - Intergenic
1103676859 12:122662815-122662837 GTCAAGATATAGGAGCTGGCCGG - Intergenic
1105746326 13:23379912-23379934 TTCCAGGTATAAGACCAAGCAGG - Intronic
1114130449 14:19785916-19785938 TTCAAGGAATAAGAGCTGGCCGG + Intronic
1119467774 14:74872954-74872976 TACCAGGTATTAGACCTGGGGGG + Intergenic
1122903671 14:104792346-104792368 TTCCTGGTGTGGGCCCTGGCAGG - Intronic
1124706630 15:31972038-31972060 GTCCAGGTCTAGGACCTGCTGGG - Intergenic
1125234125 15:37491741-37491763 TTCCAGATAGAGGACATTGCTGG + Intergenic
1127552966 15:60059368-60059390 TGCCAGGTAAAGGACATGCCTGG + Intronic
1129268512 15:74407584-74407606 TTCCATGTAAATGAGCTGGCAGG - Intergenic
1130059940 15:80562212-80562234 TTACAGGCATGGGGCCTGGCTGG + Intronic
1132506885 16:314667-314689 TTGCAGGTATGGATCCTGGCGGG - Exonic
1133887666 16:9845674-9845696 TTCCAGGTAGAGGCAATGGCAGG - Intronic
1137547263 16:49413022-49413044 TTCCAGGTACAGTCCCTGCCTGG + Intergenic
1139550885 16:67672444-67672466 TTCCAGGCAGAGGACATGCCAGG + Intergenic
1139713780 16:68796449-68796471 TTCCAGTTATGGGACCAGGCGGG + Intronic
1140958021 16:79885478-79885500 TTCCAGGTAGCGGGCCTGCCCGG - Intergenic
1148160456 17:45447068-45447090 CTCCTGGCATAGGGCCTGGCAGG + Intronic
1151265014 17:72948054-72948076 TTCCAGGTATAGGACTTTAGTGG + Intronic
1157402332 18:47398905-47398927 TTGCAGGCATGGGACATGGCAGG + Intergenic
1158231159 18:55256965-55256987 TTCCAGGTATAGGACCTGGCTGG + Intronic
1159883672 18:73884092-73884114 TTTCAGGCATGGGACCTGGTGGG + Intergenic
1160874021 19:1288930-1288952 GTCCAGGGCTTGGACCTGGCCGG + Intronic
1161629983 19:5349061-5349083 TCCCAGCTCTAGGGCCTGGCTGG + Intergenic
1162778211 19:12992785-12992807 TGCTTGGTATAGGACCGGGCAGG + Intergenic
1162933037 19:13966642-13966664 TTCCCGGTACAGGACCTGGAAGG + Exonic
928393069 2:30924102-30924124 TCCCAGGTAAAGTAACTGGCTGG - Exonic
932420115 2:71596606-71596628 TTCCATGCACTGGACCTGGCAGG - Intronic
941447919 2:165625216-165625238 TTCTAGGTATTGGATATGGCAGG + Intronic
941933545 2:170965629-170965651 TTCCAGATAGAGGCCCTGGCAGG - Intronic
942285572 2:174412644-174412666 TTCTAGCTAGAGGACCTGGAAGG + Intronic
946359952 2:219213310-219213332 TTCCAGGTGAAGGACCTTCCTGG - Exonic
947485059 2:230540398-230540420 TTCTAGGTATAAGATATGGCAGG + Intronic
948041951 2:234909299-234909321 TTCCAGGGAAAGGGCCTGGATGG + Intergenic
948469379 2:238167455-238167477 TCCCAGGTAGGGGCCCTGGCTGG - Intronic
1170724739 20:18916430-18916452 TTCCAGGCATAGGACCCCTCTGG + Intergenic
1173454622 20:43192199-43192221 TTCCAGGCAGAGGGACTGGCCGG - Intergenic
1174672108 20:52318177-52318199 TTCCAGGCACAGGAAGTGGCAGG + Intergenic
1178494633 21:33076359-33076381 CTCCAGGTACAGGGCCTGTCAGG - Intergenic
1179525597 21:41974059-41974081 TTCCAGGAACAGGTCCGGGCTGG - Intergenic
1181712003 22:24696741-24696763 GCCCAGGGATAGGAGCTGGCAGG + Intergenic
1181829464 22:25548173-25548195 TTCCATGTTTAGGACCTGAATGG - Intergenic
1182835154 22:33335739-33335761 TTCCAGGTAGAGGAAGTAGCTGG - Intronic
1182897559 22:33871419-33871441 TTCCAGATGGAGCACCTGGCAGG - Intronic
1183285393 22:36959480-36959502 TGCCAGGAAGGGGACCTGGCTGG + Intergenic
1184263457 22:43332991-43333013 TTCCAGGGATGGGAGCTGACAGG + Intronic
1184343084 22:43896685-43896707 TCCCAGGTACAGCACCTGCCTGG + Intergenic
953790945 3:45947499-45947521 TTCCAGTTATAGGCCTTGCCAGG + Exonic
956941382 3:74165766-74165788 TTCCAGCTATAATACCTGGATGG + Intergenic
959835134 3:110909724-110909746 TGCCAAGTACAGGACCTGCCAGG - Intergenic
961927975 3:130503343-130503365 TTCCAGGTTTAGGAATGGGCAGG + Intergenic
962669293 3:137689083-137689105 TTCCAGTTATATGATCTGCCTGG + Intergenic
966855332 3:184189752-184189774 ATCCAGGTGTGGGGCCTGGCAGG + Exonic
971020031 4:22525466-22525488 TTCCAGGTATACAACCAGGCAGG + Intergenic
978545594 4:109869450-109869472 ATCAAGGTCTAGGACCTGCCAGG - Intronic
980897501 4:138874206-138874228 ATCCAGATAGATGACCTGGCTGG + Intergenic
995300819 5:110579227-110579249 TTCCAGGTATAGTATCTTCCTGG - Intronic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
999376429 5:151089607-151089629 TTCCAGTTAGAATACCTGGCTGG + Intronic
1003163275 6:3654365-3654387 ATCCAGGTAGGGGAGCTGGCTGG - Intergenic
1005300072 6:24461754-24461776 TCTCAGGTATATGGCCTGGCAGG - Intronic
1006779651 6:36623648-36623670 TTCCAGGCCTTGGACCTGTCAGG + Intergenic
1008252365 6:49255886-49255908 TTCCAGAGCAAGGACCTGGCTGG - Intergenic
1009796641 6:68477786-68477808 TGCCAGGGATAGAACCTGGATGG - Intergenic
1028747058 7:94338931-94338953 TTCCAGGCATAGGATGGGGCTGG + Intergenic
1031976299 7:128095658-128095680 TTCCCGGAATAGGACCAGGCAGG - Intergenic
1033607930 7:142941082-142941104 TTCCAGGCATAGAACATAGCAGG + Intergenic
1034979835 7:155468453-155468475 TTCCAGACAAAGGACTTGGCGGG - Intergenic
1035171663 7:157020803-157020825 TTCCAAGTAAAGGCCCAGGCCGG - Intergenic
1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG + Intronic
1039433226 8:37542146-37542168 TTCCAGGACTGGTACCTGGCAGG + Intergenic
1040748672 8:50678426-50678448 TTCCAGAAATAGGACTTGTCTGG - Intronic
1043457223 8:80424724-80424746 TTCCAGGCAGAGGAAATGGCTGG - Intergenic
1044606853 8:94055351-94055373 TTCTAGGAAGAGGACCTGGGTGG + Intergenic
1046852155 8:118986869-118986891 TTTCAGGTATAGGATGTGGAAGG + Intergenic
1047720781 8:127637261-127637283 TCCCAGGTATATTTCCTGGCTGG - Intergenic
1047960382 8:130007486-130007508 TTCAAAGTATATGACATGGCTGG + Intronic
1051998222 9:23245878-23245900 TCCCTGGTATAGGTGCTGGCAGG + Intergenic
1055574565 9:77648243-77648265 TTGGAGGCAAAGGACCTGGCTGG + Exonic
1059458750 9:114416175-114416197 TTCCAGGCATATGACAGGGCTGG + Intronic
1060873048 9:127058099-127058121 TTCCAGGCAGAGGAGATGGCTGG + Intronic
1061883865 9:133581684-133581706 TTCCAGGCACTGGAGCTGGCCGG + Intronic
1062542875 9:137049277-137049299 TTCCAGGCATGGGCGCTGGCTGG - Intronic
1062577552 9:137215647-137215669 TTCCTGCAATAGGACCTGTCCGG + Exonic
1185890300 X:3816323-3816345 TTCCAGGGAAGGCACCTGGCCGG + Intergenic
1188715991 X:33459601-33459623 TACCAGGTATAGTACCTGATAGG - Intergenic
1189701639 X:43719482-43719504 TTCCAGGAATAAACCCTGGCAGG + Intronic
1193937581 X:87641655-87641677 TTCCAGGTAGAGGACGAGACGGG - Intronic
1198520307 X:137445741-137445763 TGCCAGGTCTGGGACATGGCTGG + Intergenic