ID: 1158234800

View in Genome Browser
Species Human (GRCh38)
Location 18:55301016-55301038
Sequence GTCCCTCAGCACATCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158234791_1158234800 2 Left 1158234791 18:55300991-55301013 CCCAGAGCAGGGAATGACCCCCC 0: 1
1: 0
2: 0
3: 8
4: 150
Right 1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG 0: 1
1: 0
2: 1
3: 27
4: 148
1158234792_1158234800 1 Left 1158234792 18:55300992-55301014 CCAGAGCAGGGAATGACCCCCCT 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG 0: 1
1: 0
2: 1
3: 27
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158234800 Original CRISPR GTCCCTCAGCACATCCGGCC TGG Intronic
900104092 1:974844-974866 GGCCCTCAGCTCAGCCCGCCAGG + Exonic
900257506 1:1704713-1704735 GTCCCTCAGCATCTGCGCCCGGG - Intronic
900323794 1:2097574-2097596 GTCCCTCAGCCCATGCACCCCGG + Intronic
900634801 1:3657774-3657796 CTCCCCCAGCACCTCCCGCCTGG + Intronic
901844687 1:11974544-11974566 GGCCCTCAGCACTGCCTGCCTGG - Intronic
902679253 1:18031342-18031364 GTCCCCCAGCCCATTGGGCCAGG - Intergenic
902761155 1:18581525-18581547 GCCCCTCAGGACATCCCTCCAGG - Intergenic
904344602 1:29859706-29859728 ATCCCTCAGCATCTCCTGCCTGG - Intergenic
904396775 1:30227612-30227634 ATCCCTCAGCAGCTCCTGCCTGG + Intergenic
906055975 1:42917180-42917202 GTCCCCCAGCACTGCCGGCCTGG - Intergenic
906517911 1:46450459-46450481 TTCCCTCAGCCCTTCCAGCCTGG + Intergenic
908136580 1:61139362-61139384 GCCCCTCAGCAAAGCCTGCCCGG - Intronic
915627833 1:157126768-157126790 GTCCCTCCGCACAGTCAGCCAGG - Intronic
921766977 1:218983606-218983628 GCCCCTCAGCACAAACAGCCTGG - Intergenic
922816329 1:228452405-228452427 GTCCCTCAGCACACCACACCAGG + Intergenic
924669674 1:246110802-246110824 TTACCTCAGCCCATCCTGCCTGG + Intronic
1064883674 10:20085402-20085424 GACCCTCAGCACCTCCCGCACGG - Intronic
1073173847 10:101537971-101537993 GTCCCTCAGTACATGTGACCTGG + Intronic
1074442757 10:113493219-113493241 TTCCCTCATCCCATGCGGCCTGG - Intergenic
1076502661 10:130949517-130949539 GGCTCCCAGCACAGCCGGCCTGG - Intergenic
1076607019 10:131695735-131695757 GTCCCTCTGCTCATGCGGACAGG + Intergenic
1076796071 10:132799089-132799111 GTCCCACAGCACAGGCGGGCAGG + Intergenic
1076831533 10:132996749-132996771 GTCCCTGGACACATCCGGCCCGG + Intergenic
1084316740 11:68350029-68350051 GTCTCTCAGCACTCCCAGCCTGG + Intronic
1084651254 11:70490714-70490736 TTCCCACAGGACATCCAGCCTGG - Intronic
1088987344 11:114921238-114921260 GCCCCTTTGCACATCCTGCCTGG + Intergenic
1089587548 11:119520001-119520023 TGCCCTCAGGACATCCTGCCCGG - Intergenic
1090610142 11:128463716-128463738 TTCTCTCAGCCCATCCAGCCAGG + Intronic
1091613605 12:2032352-2032374 GGCACTTAGCACACCCGGCCAGG + Intronic
1092791212 12:12072353-12072375 GCCTCTCAGCACACCCGGCCAGG + Intronic
1096573560 12:52538999-52539021 TTCCCTCTGCACATCCTCCCAGG - Intergenic
1097974419 12:65669208-65669230 GTCCCCCAGCACATCCTGCAGGG + Intergenic
1101944012 12:109122069-109122091 GTTCCTCTGCACATGCTGCCTGG - Intronic
1108245183 13:48506571-48506593 CTCCCTCAGCACTGCCAGCCGGG - Intronic
1108344956 13:49536299-49536321 GTCCCTCACCACATGCGTTCAGG - Intronic
1110854201 13:80278842-80278864 GTCCCCCAGCAGTGCCGGCCGGG - Intergenic
1113843604 13:113373876-113373898 GTCCCACAGCAAATCCCACCAGG - Intergenic
1115310614 14:31974777-31974799 GCCCCTCAGCACAGACAGCCTGG - Intergenic
1117030285 14:51661888-51661910 GTCCCACTGCACATCCTACCAGG - Intronic
1118853181 14:69600568-69600590 GTCCCACAGCACCTCAGCCCTGG + Intergenic
1123716911 15:23040155-23040177 CCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123716967 15:23040376-23040398 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717058 15:23040671-23040693 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717072 15:23040707-23040729 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717299 15:23041457-23041479 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717560 15:23042347-23042369 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717584 15:23042419-23042441 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717663 15:23042682-23042704 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123717693 15:23042788-23042810 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123717750 15:23042979-23043001 GTCCCCCAGGACCTCTGGCCAGG - Intergenic
1123717861 15:23043346-23043368 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123717878 15:23043390-23043412 CACCCCCAGCACCTCCGGCCAGG - Intergenic
1123718086 15:23044127-23044149 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718302 15:23044869-23044891 GTCCCCCGGCACCTCTGGCCAGG - Intergenic
1123718347 15:23045048-23045070 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718377 15:23045154-23045176 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718477 15:23045488-23045510 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718543 15:23045714-23045736 GCCCCCCAGCACCTCCGGCCAGG - Intergenic
1123718560 15:23045758-23045780 CACCCCCAGCACCTCCGGCCAGG - Intergenic
1123718625 15:23046017-23046039 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718652 15:23046123-23046145 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718717 15:23046343-23046365 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123718746 15:23046449-23046471 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718844 15:23046783-23046805 GCCCCTCGGCACCTCCGGCCAGG - Intergenic
1123718909 15:23047009-23047031 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719049 15:23047489-23047511 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719124 15:23047752-23047774 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719186 15:23047970-23047992 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719220 15:23048088-23048110 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719340 15:23048494-23048516 GCCTCCCAGCACCTCCGGCCAGG - Intergenic
1123719413 15:23048759-23048781 GCCCCACAGCACCTCTGGCCAGG - Intergenic
1123719439 15:23048831-23048853 GCCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719507 15:23049057-23049079 GCCCCCCAGCACCTCCGGCCGGG - Intergenic
1123719771 15:23050011-23050033 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719782 15:23050046-23050068 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719791 15:23050081-23050103 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719801 15:23050116-23050138 GTCCCCAAGCACCTCTGGCCAGG - Intergenic
1123719876 15:23050334-23050356 GTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719884 15:23050369-23050391 ATCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719903 15:23050439-23050461 CTCCCCCAGCACCTCTGGCCAGG - Intergenic
1123719924 15:23050509-23050531 GTCCCCCAGCACCTATGGCCAGG - Intergenic
1126990881 15:54374328-54374350 GTCCCTCAGTACAAACAGCCTGG - Intronic
1129494357 15:75963733-75963755 GTGCCACTGCACATCCAGCCTGG + Intronic
1130407171 15:83612454-83612476 GCCCCTCAGCACTTCCTGCTGGG + Intronic
1131529556 15:93179987-93180009 TTCCCCCAGCAGATCAGGCCTGG - Intergenic
1133192359 16:4143525-4143547 TTCCGGCAGAACATCCGGCCTGG - Intergenic
1133337079 16:5013228-5013250 GTCCCTGAGCACCTCCTGGCTGG - Intronic
1133615445 16:7472072-7472094 CTCCTTCAGCATATCCTGCCTGG + Intronic
1134103527 16:11469593-11469615 GTCCCTCAGCACTTCTGACCCGG + Exonic
1139476002 16:67202856-67202878 GTCACTGAGCACATCTGACCTGG - Intronic
1142282199 16:89154473-89154495 GTGCCTCAGCACGTGGGGCCAGG - Exonic
1146008394 17:29176708-29176730 GGAGCTCAGCACAGCCGGCCGGG - Intronic
1147333355 17:39712086-39712108 GTCCCTCTGCGCATGCAGCCTGG + Intronic
1147636755 17:41968664-41968686 GACCCTCCGCAAAGCCGGCCAGG + Exonic
1147646913 17:42039671-42039693 TTCCCTCGGCCCATCCAGCCTGG - Intronic
1150218779 17:63484359-63484381 GTCCTTCAGCACCTCCTGCCAGG - Intergenic
1151453506 17:74213373-74213395 TTCCCTCCTCCCATCCGGCCAGG + Intergenic
1152519043 17:80844831-80844853 CTCCCTCCGCTCATCTGGCCGGG - Intronic
1152602916 17:81274133-81274155 GTCCCTCCGCGCATCTGGCCAGG - Intronic
1152912065 17:83010563-83010585 GCCCCTCTGCACATGCAGCCTGG - Intronic
1156921658 18:42529730-42529752 GTCCCTCAGGACAACATGCCAGG + Intergenic
1158234800 18:55301016-55301038 GTCCCTCAGCACATCCGGCCTGG + Intronic
1159161388 18:64646918-64646940 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1160083606 18:75753919-75753941 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1161626679 19:5330969-5330991 TTCCCTCTGCACATCTGTCCTGG - Intronic
1162451075 19:10755606-10755628 GTCCACCACCACACCCGGCCAGG + Intronic
1162519776 19:11173006-11173028 GTCCTTCAGCTCTTCCGGCTTGG - Exonic
1163469006 19:17486216-17486238 ATCCCCCAGCACCTCCAGCCTGG - Intronic
1163582214 19:18145660-18145682 GTCCCACAGCAGACCCAGCCTGG + Intronic
1164813396 19:31175825-31175847 GTCCCTGAGCACTGCAGGCCTGG + Intergenic
927591304 2:24360349-24360371 GTCCCTCAGCACCGGCAGCCTGG + Exonic
936072110 2:109378064-109378086 CTCCCTGAACACATCCCGCCTGG - Intronic
939466369 2:142562052-142562074 GTCCCTCAGCACAGACAGCCTGG + Intergenic
943427026 2:187750073-187750095 ATCCCTCAGCACAACCAACCTGG - Intergenic
946005342 2:216520138-216520160 GTCTCTAAGCACATACAGCCTGG - Intronic
948723295 2:239917062-239917084 GGCCCTGAGCACATCCAGGCAGG + Intronic
1170122350 20:12924824-12924846 GTCCCTCAGAACCTACAGCCTGG - Intergenic
1171253057 20:23664433-23664455 GTCCCTCAGTACCTCCTACCAGG + Intergenic
1176993155 21:15522331-15522353 GCCCCTCAGCACAAGCAGCCTGG - Intergenic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1182238952 22:28899456-28899478 GTCCCTAACCACATCCGCCGGGG - Intronic
1183019244 22:35014136-35014158 GTCCCTTAGTACATCTGGCTGGG + Intergenic
1183298524 22:37046454-37046476 GCCCCTCCCCACAACCGGCCTGG - Intergenic
1183939735 22:41286506-41286528 GTCCCTCAGCTCTTCCGGAAAGG + Intergenic
1184004720 22:41699756-41699778 TTCCCTCAGCAAACGCGGCCAGG + Intronic
1184073786 22:42163312-42163334 GTTCCTCAGCACCTGCAGCCTGG + Intronic
950652341 3:14415124-14415146 GTCCCTGAGCTCATGAGGCCTGG - Intronic
953502473 3:43451090-43451112 GTCCCTAAGCACATCCTTGCAGG + Intronic
953603027 3:44386802-44386824 GCCCCTCAGCACAAACAGCCTGG + Intronic
955407405 3:58634093-58634115 CTCCCACAGCACATCCTACCCGG - Exonic
961324697 3:126103270-126103292 CTCCCTCAGCAGATGGGGCCGGG - Intergenic
961457055 3:127029520-127029542 GTCCCTCAGCAGATACGGTGAGG + Exonic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
965596187 3:170413736-170413758 GCTCCCCATCACATCCGGCCTGG - Intergenic
965984690 3:174736814-174736836 GCCCCTCAGCACAAACAGCCTGG - Intronic
967219125 3:187234608-187234630 GTCCCTCTGAACATCCTGCGGGG + Exonic
968742670 4:2339406-2339428 GTCCCCCAGCTCATACAGCCAGG + Intronic
968812499 4:2806274-2806296 GTCCCTCACCGCAGCCAGCCTGG - Intronic
968943016 4:3648933-3648955 GGCCCTCAGCCCAAGCGGCCGGG + Intergenic
975491972 4:74999108-74999130 CTGCCTCAGTACATCCAGCCTGG + Intronic
975798319 4:78032499-78032521 GTCTCTCTGCCCATCAGGCCTGG - Intergenic
985611362 5:891440-891462 GTTCCTCAGCAGACCCTGCCAGG - Intronic
988202222 5:28083207-28083229 GTCCCTCAGCACAGACAGCTGGG + Intergenic
992470347 5:77046001-77046023 GGCCCTCATCACATACTGCCTGG - Intronic
993879828 5:93348942-93348964 GCCCCACAGCTCATCCGCCCTGG + Intergenic
994891268 5:105639634-105639656 GCCCCTCAGCACAAACAGCCTGG + Intergenic
995332036 5:110956788-110956810 GTCCCTCAGCACAAACAGCCTGG + Intergenic
995742385 5:115368740-115368762 GCCCCTCAGCACAAACAGCCTGG + Intergenic
996176717 5:120368455-120368477 GCCCCTCAGCACAGACAGCCTGG + Intergenic
998430595 5:142066480-142066502 GTCCCTCAGCAAGTCCTGCTGGG - Intergenic
998467580 5:142357750-142357772 GTCCCTCACCACTTCCAGCCGGG + Intergenic
1001755853 5:174167830-174167852 GTGCCTCTGCACAGCCGGACAGG + Intronic
1002133712 5:177096013-177096035 GTGCCTCAGGACACCTGGCCTGG - Intronic
1002171624 5:177377964-177377986 TTGCCTCAGCACTTCCGGCAGGG - Intergenic
1005989542 6:30894453-30894475 GTTGCTCAGCACACACGGCCTGG - Intronic
1017526401 6:155245000-155245022 GTCCAGCAGCACCTCCCGCCTGG + Intronic
1018179617 6:161209827-161209849 GTTCTTCATCACATCCTGCCTGG - Intronic
1019696125 7:2447035-2447057 CACCCTCAGCACATCAGGGCTGG - Intergenic
1022015447 7:26345258-26345280 GTCCCCCAGCTGATCTGGCCTGG + Intronic
1025853909 7:65262447-65262469 GTCACTGAGCACATCCTGCCAGG + Intergenic
1034238598 7:149592108-149592130 ATCCCTCGCCACATCTGGCCTGG - Intergenic
1037913445 8:22757914-22757936 GGCCCCCAGGGCATCCGGCCAGG - Intronic
1039542244 8:38382012-38382034 TTCCCGCAGCACGCCCGGCCCGG - Exonic
1040588417 8:48765792-48765814 TTCCCTCAGCACAGCGGGGCCGG + Intergenic
1044525002 8:93241743-93241765 GCCCCTCAGCACCTACAGCCTGG - Intergenic
1049618372 8:143586539-143586561 GGCCCTGAGCAGACCCGGCCCGG + Intronic
1052609911 9:30758929-30758951 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1057254051 9:93529050-93529072 GTCCCTCTGCAGATACGGCAGGG - Intronic
1061886276 9:133592506-133592528 GCCCCTCAGCACAGCCAGCGTGG - Intergenic
1062024583 9:134334421-134334443 GGCCCTCTGCACACCAGGCCTGG - Intronic
1189308669 X:40005701-40005723 CTCCCTCCCCACCTCCGGCCCGG + Intergenic
1192264994 X:69531791-69531813 GGCCCTCAGCACTTTGGGCCTGG + Exonic
1192471363 X:71401750-71401772 GTCCCATAGCACTTCCTGCCTGG - Intronic
1193211486 X:78811370-78811392 GCCCCTCAGCACAAACAGCCTGG - Intergenic
1197768509 X:130074301-130074323 GTCCCTCAGTACCTCTGGTCAGG - Intronic
1200942387 Y:8798619-8798641 GTCCATCAGCATATGCAGCCTGG - Intergenic