ID: 1158234840

View in Genome Browser
Species Human (GRCh38)
Location 18:55301260-55301282
Sequence CTGGTTGAATGTAATACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158234836_1158234840 5 Left 1158234836 18:55301232-55301254 CCCGCTGAGCTGGGGGTTCTGCC 0: 1
1: 0
2: 2
3: 22
4: 235
Right 1158234840 18:55301260-55301282 CTGGTTGAATGTAATACAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 97
1158234837_1158234840 4 Left 1158234837 18:55301233-55301255 CCGCTGAGCTGGGGGTTCTGCCA 0: 1
1: 0
2: 1
3: 22
4: 204
Right 1158234840 18:55301260-55301282 CTGGTTGAATGTAATACAGTAGG 0: 1
1: 0
2: 1
3: 16
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158234840 Original CRISPR CTGGTTGAATGTAATACAGT AGG Intronic
901184283 1:7362480-7362502 CTGGTGGAATTTAATAGAGTTGG + Intronic
902037693 1:13469616-13469638 CCAGTTAAATGTAATAGAGTTGG + Intergenic
906795106 1:48690395-48690417 CTGGTTTAATGTAAAACCTTGGG - Intronic
907452076 1:54551950-54551972 CAGGTTCAAGGTAAAACAGTAGG - Intronic
916737920 1:167624536-167624558 CAGGCTGAATGAAGTACAGTGGG + Intergenic
921247715 1:213262724-213262746 CTGGTTGAATGCCATCCAGCAGG + Exonic
923697449 1:236267602-236267624 ATTGCTCAATGTAATACAGTGGG - Intronic
1068846672 10:61684241-61684263 CTGGTTTAATGAATTACAATTGG - Intronic
1070264214 10:74886790-74886812 CTGGGTCAGTGTAATACACTGGG - Intronic
1071874035 10:89824704-89824726 ATTGTTGAATGTCATTCAGTGGG - Intergenic
1074647756 10:115481529-115481551 CTTGTTGAATTTCATACAGTAGG + Intronic
1075149152 10:119911075-119911097 AGGGCTGAATTTAATACAGTTGG + Intronic
1077958748 11:7050173-7050195 CTCGTAGAAAATAATACAGTGGG + Intronic
1082759752 11:57115921-57115943 CTGCTAGAAAGTAATAAAGTCGG + Intergenic
1083052006 11:59785764-59785786 CTTGTAAAATGTCATACAGTAGG - Intronic
1083806774 11:65079096-65079118 CTGGTTGAATGAGATGCAGTGGG - Exonic
1084109336 11:67003228-67003250 CTGGTTTCATGAAATTCAGTGGG + Intergenic
1086193897 11:84113990-84114012 CTGGCTTAATTTAATATAGTTGG - Intronic
1087546092 11:99585367-99585389 CTGGTTGAATGAAAAAAGGTAGG + Intronic
1089221901 11:116879333-116879355 AAGGTTAAATGTAATAAAGTTGG - Intronic
1090108710 11:123881136-123881158 CTGGTGGATTTTATTACAGTTGG - Intergenic
1090633074 11:128667607-128667629 CTTTTTCAATGTAATACAGCTGG - Intergenic
1093740642 12:22681763-22681785 CTGGTTTAATGGAATACAGCAGG + Intronic
1098925157 12:76341422-76341444 CTGGTGGAATGTAAGATAGAGGG + Intergenic
1102286202 12:111658806-111658828 CTGGTTGCAAGTAAAACAGATGG - Exonic
1103251284 12:119502103-119502125 CAGGCTGAGTGTGATACAGTAGG + Intronic
1110314589 13:74091396-74091418 CTCCTAGAATGTTATACAGTTGG + Intronic
1110754404 13:79154584-79154606 CTTGCTGAAGGTAATACAGCTGG - Intergenic
1112049649 13:95632751-95632773 CTGGTGGAATGGAATAGAATAGG - Intronic
1112991366 13:105517655-105517677 TTGGTTAAATGTAATAGAGAAGG - Intergenic
1114546621 14:23507640-23507662 ATTGTTGAAGGAAATACAGTTGG + Intronic
1117808926 14:59524651-59524673 CTGGTAGTATGTACTAAAGTTGG + Intronic
1118234651 14:63991359-63991381 CTTGTTCAATGTCATAGAGTCGG - Intronic
1120189849 14:81430831-81430853 CTGGGTAAATGTTATCCAGTGGG + Intronic
1121884092 14:97526990-97527012 CTGGTTAAAGGTAATTCAGTGGG - Intergenic
1122057887 14:99117338-99117360 CTAGATGAAAGTTATACAGTCGG - Intergenic
1131044245 15:89300113-89300135 GTGGTTGAATGTAATCCAGTAGG - Intronic
1146610405 17:34299898-34299920 CTAGTTCAATGTATTAGAGTAGG + Intergenic
1149338439 17:55662088-55662110 CTGGATAATTGTAATACAGTGGG + Intergenic
1149840059 17:59954552-59954574 CTGGTTGAATGTAACTCATGTGG + Intronic
1150712231 17:67541411-67541433 CTGTTTGAAAGAAATACAGTGGG + Intronic
1153282858 18:3430287-3430309 CTGGTTTAATAGAAGACAGTTGG - Intronic
1158234840 18:55301260-55301282 CTGGTTGAATGTAATACAGTAGG + Intronic
1159393302 18:67823402-67823424 CTTGCAGAATGTTATACAGTTGG + Intergenic
1159872914 18:73778696-73778718 ATGATTAAATGTAATACAGAAGG + Intergenic
1159931557 18:74316986-74317008 CAGCAGGAATGTAATACAGTAGG - Intronic
1161513819 19:4685532-4685554 CTGGTTGACTGTTCTACAGCTGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
926002350 2:9343865-9343887 CTGATTGAATCTACCACAGTTGG - Intronic
926838163 2:17047430-17047452 CTGCCTGAATGTTATATAGTTGG + Intergenic
932655301 2:73606052-73606074 CTGGTTTAATGGAAGACAGCTGG - Intronic
936960173 2:118064932-118064954 TGGCTTGAATGAAATACAGTTGG - Intergenic
937556704 2:123166698-123166720 CTGGATGAGTGTTACACAGTGGG + Intergenic
937603111 2:123763154-123763176 TTGGTTAAATGTAAGACATTTGG + Intergenic
938162185 2:128995936-128995958 ATGGTTGAATATAAAACAGTGGG - Intergenic
940667544 2:156626919-156626941 CTTATTGAATGAAATGCAGTTGG + Intergenic
945809854 2:214535515-214535537 CTGTTTGAATGTAATAAACCTGG - Intronic
946558623 2:220887931-220887953 CTGCTGGAATGTAAAACATTTGG + Intergenic
948082969 2:235221566-235221588 CAGATTGGATGTAATACATTTGG + Intergenic
1171232532 20:23499116-23499138 CAGCTTGGATGCAATACAGTGGG + Intergenic
1172298808 20:33833351-33833373 CTGTTTGAATGTACAACAGAAGG - Intronic
1172751519 20:37254433-37254455 GTGGCTGAATCTAATTCAGTTGG - Intronic
1172967061 20:38843828-38843850 CTGGCTTAATGGAAGACAGTTGG + Intronic
1174227673 20:49015766-49015788 CTTTTTCAATGTGATACAGTTGG - Intronic
1174955921 20:55098314-55098336 ATGTTTGAATTTAAGACAGTAGG + Intergenic
1178804675 21:35829141-35829163 CTGGTTAAAGGGAAAACAGTGGG + Intronic
1184438076 22:44491886-44491908 CTGGCTGAATGGAAGACAGTGGG - Intergenic
950204616 3:11069319-11069341 ATGTTTAAATGTAATAAAGTAGG + Intergenic
951059910 3:18193446-18193468 TTGCTTGAATTTAATAAAGTGGG - Intronic
955749490 3:62173325-62173347 CTGGTAGAATTGAGTACAGTCGG - Intronic
955873840 3:63469097-63469119 CTGGCTGAATTCAATACATTTGG - Intronic
962622642 3:137195148-137195170 CTTGTCCAATGTAATACAGTTGG - Intergenic
964353535 3:155826986-155827008 CTGGGTGTATGTAATACGCTGGG + Exonic
969051805 4:4378566-4378588 CTTCTTGACTGTAATAAAGTGGG - Intronic
969902759 4:10364810-10364832 CTGGTTGAAGGTAACATATTTGG + Intergenic
970891887 4:21055712-21055734 CTTCTAGAATGTATTACAGTTGG - Intronic
977951938 4:102981064-102981086 CTGTTAGAATGTCATATAGTTGG + Intronic
980931128 4:139184281-139184303 CTTGTTCAAAGTTATACAGTAGG + Intergenic
982574388 4:157090384-157090406 CTGGTTTAATGGAAGACAGCAGG + Intronic
982839953 4:160172006-160172028 CTGGATGAATATACTGCAGTAGG - Intergenic
983060115 4:163150334-163150356 GTGGTTGAAAGGAATAAAGTAGG - Intronic
985544966 5:504840-504862 CTGGTTGAGTGGCATACAGCGGG + Intronic
990086528 5:51985608-51985630 CTGTTTGAAGGTAAGACAGCAGG - Intergenic
990093219 5:52081807-52081829 CTCCTTGAAGGTAATAAAGTAGG + Intergenic
990157630 5:52897113-52897135 CAAGTTGGATGTACTACAGTAGG - Intronic
990342289 5:54835303-54835325 CTGCTTGGATGAAATGCAGTGGG - Intergenic
991165053 5:63556293-63556315 TTTGTTCAATGTAATAGAGTAGG - Intergenic
995756268 5:115507767-115507789 CTGATTAGATGTAATACATTTGG - Intergenic
996199426 5:120652608-120652630 TTTGTTGAATGTCATTCAGTTGG - Intronic
1004521963 6:16369730-16369752 CTGGTGGAATGAAATAAAGAAGG - Intronic
1010549609 6:77205231-77205253 CTTCTTGAAAGTAATACAGTAGG - Intergenic
1014916122 6:127150757-127150779 ATGGTACAATTTAATACAGTAGG + Intronic
1015309602 6:131751813-131751835 CTTGTCAAATGTATTACAGTTGG - Intergenic
1028571653 7:92294758-92294780 TTGGTAAAATGTAATATAGTTGG + Intronic
1031903868 7:127439821-127439843 CTGGTGGAATGAAATACACTTGG - Intergenic
1035053688 7:156019602-156019624 CTGGTAGAATGTGATACAATGGG - Intergenic
1035386040 7:158473737-158473759 ATGGTTGACTGTTAGACAGTTGG - Intronic
1035918756 8:3654034-3654056 CTAATTGGATGTTATACAGTTGG - Intronic
1037109617 8:15150339-15150361 CTGGTTGAATTTAAGTCAGTCGG + Intronic
1037256822 8:16964794-16964816 CTGGCAGAAAGGAATACAGTCGG + Intergenic
1045680629 8:104655861-104655883 CTAGTTGATTGTAACACACTAGG - Intronic
1054953342 9:70879129-70879151 CTGGTTCAATGTGATGCAGCTGG + Intronic
1056088447 9:83180361-83180383 CTGGTTGAATTTAAAATAGTTGG - Intergenic
1059896300 9:118869764-118869786 GTGGGTGAGTGGAATACAGTAGG + Intergenic
1060692026 9:125671104-125671126 CAGGTTGAATGTATTTCAGTGGG - Intronic
1061238766 9:129357346-129357368 CTCATTGAATGTTATGCAGTAGG - Intergenic
1187402865 X:18977773-18977795 GAGGTTGAAAGTAATATAGTGGG - Intronic
1192091424 X:68161105-68161127 CTAATTGAGTGTCATACAGTTGG - Intronic
1193691091 X:84643580-84643602 CTGGTTTAATAGAATACAGCTGG + Intergenic
1194320243 X:92437670-92437692 CTGTTTCCATGTAAAACAGTGGG - Intronic
1197508595 X:127341635-127341657 ATGGTTGAATGTATTTCTGTGGG + Intergenic
1198332372 X:135633493-135633515 CTGGAAGAATCTAATCCAGTTGG - Intergenic
1199660161 X:150041357-150041379 CTGGTTCAGTGTAATCCTGTTGG - Intergenic
1200628364 Y:5550800-5550822 CTGTTTCCATGTAAAACAGTGGG - Intronic
1200866620 Y:8050958-8050980 CTGATTTAATGTATGACAGTTGG - Intergenic