ID: 1158238437

View in Genome Browser
Species Human (GRCh38)
Location 18:55347630-55347652
Sequence GGTCTTCCTCCCAGGCAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158238437_1158238444 17 Left 1158238437 18:55347630-55347652 CCTGATTGCCTGGGAGGAAGACC 0: 1
1: 0
2: 2
3: 14
4: 156
Right 1158238444 18:55347670-55347692 AAGTCCAGTCTCTGTACCACAGG 0: 1
1: 0
2: 0
3: 14
4: 139
1158238437_1158238440 -9 Left 1158238437 18:55347630-55347652 CCTGATTGCCTGGGAGGAAGACC 0: 1
1: 0
2: 2
3: 14
4: 156
Right 1158238440 18:55347644-55347666 AGGAAGACCCAGCCTAATGGCGG 0: 1
1: 0
2: 2
3: 20
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158238437 Original CRISPR GGTCTTCCTCCCAGGCAATC AGG (reversed) Intronic
900887289 1:5423922-5423944 GGTCTTCCTGCCAAGCATCCGGG - Intergenic
907276391 1:53319247-53319269 GGACTTCATCCCAGCCACTCTGG - Intronic
908165037 1:61449410-61449432 TGTTTTCATCCCAGGCAAGCTGG - Intronic
908541569 1:65127398-65127420 GGGATTCCAGCCAGGCAATCTGG - Intergenic
908669324 1:66529147-66529169 AGTCTTCCCCCCAGGGAAACAGG + Intergenic
911626411 1:100130127-100130149 GGACTTAAACCCAGGCAATCTGG + Intronic
917794897 1:178526380-178526402 GTTATTCCTCCCAGGTAAACTGG + Intronic
919974389 1:202601263-202601285 GGCCTTCCTCCCAGGCACAGGGG + Intronic
920988619 1:210914570-210914592 TCTCTTCCTCCCAGGCAAGAAGG + Intronic
921866563 1:220093451-220093473 GGTCTGCGTTCCAGGAAATCAGG + Intergenic
922246491 1:223803502-223803524 GGACTACTTCCCAGGCAACCGGG + Intronic
922466817 1:225850005-225850027 CGTCTACCTCCCAGCCAAGCTGG - Exonic
922746906 1:228049274-228049296 GGTCTGCACCCCAGGCTATCTGG + Intronic
1062877980 10:957111-957133 GCTCTTCCTTCCGGGGAATCTGG + Intergenic
1068467119 10:57408828-57408850 GGTCTACATCCCAGGCAAAGAGG - Intergenic
1071007372 10:80897763-80897785 GGTCTGTCTCCCAGGCCTTCAGG - Intergenic
1073260536 10:102186759-102186781 GCTATTCTTCCAAGGCAATCAGG - Intergenic
1074430237 10:113388132-113388154 GGACTTCCACCCAGGCCAACTGG + Intergenic
1075170475 10:120109092-120109114 GCTTTGCCTCCCAGGCAGTCTGG + Intergenic
1078742190 11:14077266-14077288 GGTCTTCTCCCCAGGCACTGTGG - Intronic
1079487455 11:20950255-20950277 GCTCTTCCCATCAGGCAATCAGG + Intronic
1080326341 11:31078006-31078028 AGTCCTCCTGCCAGGCTATCTGG - Intronic
1084919149 11:72454964-72454986 AGTCCTCCTCCCAGGGAATGAGG - Intergenic
1085411111 11:76291293-76291315 GGTCTTCCTCAAAGGCAAATTGG + Intergenic
1085707216 11:78797219-78797241 GGTGTTACTCCCAGGAAACCAGG - Intronic
1090404245 11:126467562-126467584 GGCCTTGCTGCCAGGCAATCAGG - Intronic
1091141405 11:133238214-133238236 TGTCTTCCTCAAAGGCAGTCTGG + Intronic
1093222262 12:16436813-16436835 GGACTTAATCCCAGGAAATCTGG + Intronic
1094078267 12:26502814-26502836 GGTCTTCCTCCTAGACAATGGGG + Intronic
1095946229 12:47755166-47755188 GGCTTTGGTCCCAGGCAATCTGG - Intronic
1096244979 12:49979490-49979512 GGGCTTCCTGCCAGCCAATCGGG - Intronic
1096555396 12:52400657-52400679 GGGCCACCTCCCAGGCAAGCTGG + Intronic
1098534795 12:71582478-71582500 GGTCTTCCTCAAAGTCAAGCAGG - Exonic
1099715975 12:86294562-86294584 GTACTTTCTCCCAGACAATCTGG + Intronic
1099744596 12:86686341-86686363 GAAGTTCTTCCCAGGCAATCAGG - Intronic
1099874537 12:88388924-88388946 GCTGTTCTTCCTAGGCAATCAGG + Intergenic
1100518278 12:95349486-95349508 GCTCTTCCTCCCAGAAAGTCCGG + Intergenic
1101927148 12:108981572-108981594 GGATTTACGCCCAGGCAATCTGG - Intronic
1103844654 12:123892995-123893017 GGTCATCCTCCCAGGCGAGCTGG + Intronic
1104459000 12:128939162-128939184 GGGGTTCCTTTCAGGCAATCAGG + Intronic
1105718164 13:23088001-23088023 AGCCATCCACCCAGGCAATCAGG + Intergenic
1105902093 13:24764238-24764260 GGTCTTCCTACCAGCGAATGGGG + Exonic
1108642704 13:52397395-52397417 GGTCCTCTTCCCAGGGTATCTGG + Exonic
1111456317 13:88488517-88488539 GATGTTCTTCCTAGGCAATCAGG - Intergenic
1111962984 13:94832038-94832060 TGTCTTCCTCCCAGGCAGCAAGG + Intergenic
1113119690 13:106913033-106913055 GGACTTGCCCCCAGGCAATTTGG - Intergenic
1113403238 13:110014755-110014777 TGTGTTGCTCCCAGGCACTCAGG + Intergenic
1114264577 14:21065633-21065655 GGTCTTCTTCCCTGGCCACCTGG - Intronic
1122302482 14:100738959-100738981 GGGCTGCCTCCCAGGCCACCAGG - Intergenic
1122372652 14:101237207-101237229 GGTCTCCCTCCCACCCACTCTGG + Intergenic
1123105341 14:105838855-105838877 AGTCTCCCTCCCAGGCAGTGAGG - Intergenic
1123777849 15:23598275-23598297 GCTGTTCTTCCTAGGCAATCAGG + Intronic
1128675781 15:69607540-69607562 GGTCTTCCCTCCAGACAGTCAGG + Intergenic
1129105077 15:73301484-73301506 GGGCATGTTCCCAGGCAATCTGG - Intronic
1130061207 15:80571493-80571515 AATCTTCCTCCCAGGCAAACAGG - Intronic
1133678202 16:8095761-8095783 GGTCTTCCTCAAAGCTAATCAGG + Intergenic
1134404216 16:13940920-13940942 TGTCTTCCTCCCATTCTATCAGG - Intronic
1135049729 16:19183043-19183065 GGAATTCCACCCAGGCACTCTGG + Intronic
1139385727 16:66568384-66568406 GGTCTCCCTTCTTGGCAATCAGG - Intronic
1140532565 16:75679386-75679408 GCTATTCTTCCCAGGCAATCGGG - Intronic
1141200214 16:81892016-81892038 GGTCTTCCTCCCAGCACATGAGG - Intronic
1141965432 16:87439102-87439124 GGTCGTCCTCCCAGGCCTTTTGG - Intronic
1144057583 17:11556494-11556516 GCTCTTCCTCCCTGGCTTTCTGG + Intronic
1146126334 17:30234463-30234485 GGTTTTCCTGCCACGCACTCTGG - Intronic
1149555528 17:57570892-57570914 GGCTTTCCTCCCAGGACATCTGG + Intronic
1152228864 17:79104853-79104875 GGTCTTCCGCCCAGGCCCCCGGG + Intronic
1158238437 18:55347630-55347652 GGTCTTCCTCCCAGGCAATCAGG - Intronic
1159026398 18:63185826-63185848 GGACTTGAACCCAGGCAATCTGG + Intronic
1161645881 19:5453166-5453188 CATCTGCCTCCCAGGCAATGAGG - Intergenic
1162424640 19:10587128-10587150 GGTCTCGCTCCCAGGGATTCAGG - Intronic
1162457408 19:10793920-10793942 AGGCCTCCTCCCAGGCAATAAGG + Intronic
1164505965 19:28861427-28861449 GGTCTTCCTCCCAGATGCTCAGG - Intergenic
1164598710 19:29547036-29547058 GGACTTGCACCCAGGCAGTCTGG - Intronic
1164766437 19:30775846-30775868 TGGCTTCATCTCAGGCAATCTGG + Intergenic
1165547453 19:36552978-36553000 GGCTTTCCACCCAGGCAATCTGG - Intronic
1166140213 19:40801286-40801308 GGCCTTCCACCCAGGCAATCTGG - Exonic
1166404081 19:42506777-42506799 GCACTTCCTCCCAGGCAAGTTGG + Intergenic
1166551815 19:43670381-43670403 GGATTTGCACCCAGGCAATCTGG - Intronic
1166673194 19:44723793-44723815 GGACTTCCTCCCAGGGCACCAGG + Intergenic
1166947549 19:46406208-46406230 GGTCTCCCTCCCAGGCCCACAGG - Intergenic
1168316091 19:55485380-55485402 GGGCTCCCTCCCAGGCACTGGGG - Intronic
925726339 2:6875963-6875985 GCTCTACCACCCAGGCCATCAGG + Intronic
926205568 2:10832716-10832738 GGTCTTCCTTCCAGGAGGTCGGG + Intronic
928409145 2:31040906-31040928 GGAATTCATCCCAGGCATTCTGG - Intronic
931746596 2:65296467-65296489 GGTCTTCCTCCCAGGCGGAGTGG - Intergenic
932567461 2:72918555-72918577 GGTCTCCCTCCCAGGAAAGCAGG + Intronic
932586008 2:73029489-73029511 TGTCTACCTCCCAGGCATTTGGG - Intronic
935941478 2:108243655-108243677 GGTCTTGTTCCCAGGCAAGAGGG - Intergenic
936273179 2:111068119-111068141 GGCTGTCCTCCCAGGCCATCCGG + Intronic
936952330 2:117990482-117990504 GGCCTTTCTGCCTGGCAATCTGG + Intronic
938400240 2:130985155-130985177 GGGCTTCTTCCAAGGCAATCAGG + Intronic
940147353 2:150560257-150560279 GGTCTTCCTCATAGGAAAGCAGG + Intergenic
947483159 2:230521832-230521854 GCTGTTCTTCCTAGGCAATCAGG - Intronic
947587821 2:231367460-231367482 GGGCTGCCTCCCAGGCTAGCTGG + Intronic
948047950 2:234958041-234958063 AGTCTTCCTTCCAGGAAGTCAGG + Intronic
948066503 2:235084838-235084860 GGTCTTTTTACCAGGCAGTCAGG - Intergenic
1170032971 20:11961473-11961495 GGTCACCCTCCCAGCCATTCAGG + Intergenic
1170141283 20:13127375-13127397 GTTCTTGCTGCCAGGCAAACTGG + Intronic
1170446591 20:16434293-16434315 GGTCTTCTTCCCACGAGATCTGG - Intronic
1170715366 20:18826529-18826551 GGCCCTCCTCTCAGGGAATCAGG + Intronic
1171240783 20:23565626-23565648 GGTCTTCCTCCCCTGCCTTCTGG - Intronic
1173205763 20:40991831-40991853 GGTCTCCTTCCCAGGCTCTCAGG - Intergenic
1180848737 22:18999469-18999491 GGGCTTTCTCCGAGTCAATCAGG - Intergenic
1181759729 22:25049879-25049901 GGACTTGAACCCAGGCAATCTGG - Intronic
1185019457 22:48365667-48365689 AGTCTCACTCCCAGGCACTCTGG - Intergenic
950755262 3:15165722-15165744 GGACTCACTCCCAGGCATTCTGG - Intergenic
950810425 3:15645386-15645408 GGTCATTCTCCCAGCCAAGCTGG - Exonic
950956644 3:17060422-17060444 GGCCTTCATCCCAAACAATCTGG - Intronic
954297504 3:49682388-49682410 CCTCTCCCTCCCAGGCAATGTGG + Exonic
957926837 3:86825268-86825290 GGTCTCCCTAACAGACAATCTGG - Intergenic
959478166 3:106837652-106837674 GCTGTTCTTCCTAGGCAATCAGG + Intergenic
960242517 3:115361988-115362010 GGACTTCCGCCCAGGAAAGCTGG - Intergenic
961232901 3:125335284-125335306 GAATTTCCTCCCAGGAAATCAGG + Intronic
962058534 3:131900478-131900500 GGTCTTCCTACCACACATTCAGG + Intronic
962246768 3:133801987-133802009 GGACTTCATCCCAGGCAATTGGG - Intronic
962477943 3:135773214-135773236 GGGCTTGCACCCAGGCAATCTGG + Intergenic
973632346 4:52831362-52831384 TGTCTTCCTCACAGGCAAGGAGG + Intergenic
974876757 4:67711880-67711902 GTTCTCCCTCCCAGCCTATCAGG - Intergenic
977297355 4:95225681-95225703 GTTATTCCTCACAGGCAATTAGG + Intronic
978015755 4:103744232-103744254 GATGTTCTTCCAAGGCAATCAGG - Intergenic
978672529 4:111267639-111267661 GGGTTTGATCCCAGGCAATCTGG - Intergenic
983974759 4:173920119-173920141 AGTCTTCCTCCCAGGCACTGTGG - Intergenic
984692984 4:182749703-182749725 GGACTTAAACCCAGGCAATCGGG + Intronic
985875298 5:2590107-2590129 GGCCCTGGTCCCAGGCAATCTGG - Intergenic
995641502 5:114262497-114262519 GGATTCACTCCCAGGCAATCTGG - Intergenic
995753098 5:115474133-115474155 TATGTTCCTCCCAGGCCATCTGG + Intergenic
995833198 5:116376125-116376147 TTTCTCCCTCACAGGCAATCAGG + Intronic
995943981 5:117619720-117619742 GGTCTACCTCACTAGCAATCAGG + Intergenic
997517905 5:134503911-134503933 GGTCCTTCTCCCAGGCAGGCAGG - Intergenic
998818527 5:146036959-146036981 GGTCTTCCTCAAAGGCAATCTGG + Intronic
999743659 5:154575660-154575682 GGTCTTCCTCCCAGGCTGCCTGG + Intergenic
1001970400 5:175950709-175950731 GGACTTGAACCCAGGCAATCTGG + Intronic
1002247037 5:177893052-177893074 GGACTTGAACCCAGGCAATCTGG - Intergenic
1003422784 6:5973554-5973576 CCTCTGCCTCACAGGCAATCAGG - Intergenic
1003485896 6:6579502-6579524 GGCTTCCCTCCCAGGCAGTCTGG - Intergenic
1004730440 6:18353017-18353039 GGTCCTACTCCCAGACAAGCAGG + Intergenic
1008062267 6:47010967-47010989 GGTCTGGCTCCCAGACACTCTGG + Intronic
1013609425 6:111780109-111780131 GGGCTGGCTCCCAGGCAAGCTGG + Intronic
1014651693 6:124047554-124047576 GGGCTTCCTCCCCGGCTATTAGG + Intronic
1015555180 6:134453835-134453857 GGTTTTCCCACCAGGCAACCTGG + Intergenic
1016200668 6:141403434-141403456 GCTGTTCTTCCCGGGCAATCAGG - Intergenic
1016233043 6:141829766-141829788 GTTGTTCTTCCTAGGCAATCAGG + Intergenic
1018087764 6:160319681-160319703 GGTCTAACTCTCAGGTAATCAGG - Intergenic
1019295285 7:270613-270635 TGTCTGCCTCCCAGGCACTAGGG + Intergenic
1019339768 7:503495-503517 GCCCTGCCTCCCAGGCAGTCAGG + Intronic
1019432958 7:1007827-1007849 GGGCATGCTCCCAGGCACTCAGG + Intronic
1019769416 7:2874269-2874291 GGTCTTCCTCCCACAGAAGCAGG - Intergenic
1020049654 7:5073014-5073036 GGTCTTCCTCCCCGGCTTTCTGG - Exonic
1022391285 7:29946771-29946793 GGTCTTCCTACCATGCCATGAGG + Intronic
1027829285 7:83156351-83156373 AGTCATCCTCCAAAGCAATCAGG - Exonic
1034386222 7:150743378-150743400 TGTCTTCCTCCCTGGCATTGTGG + Exonic
1036153456 8:6320175-6320197 ATTCTTCCTCACAGGCAATGTGG - Intergenic
1045458184 8:102402704-102402726 GGTCTACCTCACAGACAACCTGG - Intronic
1047120858 8:121902908-121902930 GGTCTTCCTCCCAACGATTCAGG + Intergenic
1047613693 8:126545334-126545356 TGTCTTCCTGCCAGGGAATGTGG + Intergenic
1048160077 8:132010788-132010810 AGTCCTCCTCCCAGTCCATCAGG + Exonic
1051815732 9:21103243-21103265 TGTCTTCTTCCCTGCCAATCTGG - Intergenic
1052298616 9:26928585-26928607 GGCCTTGCGCCCAGGCAGTCTGG - Intronic
1053510379 9:38682846-38682868 AGTCTGCCTCCCAGGAAATAAGG - Intergenic
1055454010 9:76456390-76456412 GGTCTGACTCCCAGCCAACCAGG + Intronic
1056676145 9:88678646-88678668 CGTCTTCTTCCCAGGAAACCTGG + Intergenic
1057858393 9:98620568-98620590 GGTATTCCTCCAAAGCAAGCAGG + Intronic
1058293221 9:103271516-103271538 GATCTTCTTTCTAGGCAATCAGG - Intergenic
1058642173 9:107098421-107098443 GGTATTCCTGACATGCAATCAGG - Intergenic
1186383113 X:9081820-9081842 TGTCTTCCCCCAAGGCCATCTGG + Intronic
1186732596 X:12426277-12426299 CATCTTCTTCACAGGCAATCAGG - Intronic
1189655532 X:43240680-43240702 CCTCTTCCACCCAGGCCATCAGG + Intergenic
1191849497 X:65575521-65575543 GGTCTCTATCCCAGGCCATCTGG - Intergenic
1192682976 X:73272156-73272178 GGATTTCCTCCCAGGCATGCAGG + Intergenic
1195509679 X:105700492-105700514 TGTCATTCTCCCAGGCAATGGGG + Intronic
1196648581 X:118145750-118145772 GGTCTACCTCTCAGGCAGGCAGG - Intergenic
1199566944 X:149225262-149225284 GGTCGTCCTCCCAAGGAATTAGG + Intergenic
1200794686 Y:7330042-7330064 CGTCATCCTACCAGGCAATATGG - Intergenic