ID: 1158245835

View in Genome Browser
Species Human (GRCh38)
Location 18:55431252-55431274
Sequence AGGTGGAATCAAAGGGATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 254}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158245835_1158245841 28 Left 1158245835 18:55431252-55431274 CCTACATCCCTTTGATTCCACCT 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1158245841 18:55431303-55431325 GAGTTTTGCTCTTGTTGTCCAGG 0: 416
1: 10603
2: 21037
3: 29777
4: 23524
1158245835_1158245840 6 Left 1158245835 18:55431252-55431274 CCTACATCCCTTTGATTCCACCT 0: 1
1: 0
2: 1
3: 21
4: 254
Right 1158245840 18:55431281-55431303 TTGTTTTTTGTTTTTTCAGACGG 0: 4
1: 392
2: 2392
3: 101603
4: 86286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158245835 Original CRISPR AGGTGGAATCAAAGGGATGT AGG (reversed) Intronic
900132197 1:1091903-1091925 AGGTGGAGCCAAATGGAGGTGGG + Intronic
900662765 1:3793780-3793802 AGGTGCAATCATAGGGGTGTGGG - Intronic
901200341 1:7463264-7463286 AGGTGGAAGGAAAGGGATGGAGG + Intronic
901246934 1:7739175-7739197 AGGTTGCATCAATGGGAAGTTGG - Intronic
902625167 1:17672163-17672185 AGGGGAAATCAAGGGGCTGTTGG - Intronic
904789726 1:33010300-33010322 AGGTGTATTCATAGGGATGGTGG - Intronic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
906853556 1:49280167-49280189 GGGTGCAATCATAGGGGTGTGGG - Intronic
907575020 1:55518635-55518657 AGGTGAAATCAGAGGGAGGAAGG + Intergenic
907798608 1:57742375-57742397 ATGTGGGATCAAAAGGATGGGGG + Intronic
907890245 1:58630307-58630329 AGGTGTATTCATAGGGATGGTGG - Intergenic
909136277 1:71804439-71804461 ATGTGGAATCACAGTGTTGTGGG + Intronic
909248971 1:73327538-73327560 AGGTAAAATCAAAGGTCTGTGGG + Intergenic
909359833 1:74747233-74747255 AGGTAGAATCAATGGGAATTGGG + Intronic
909680243 1:78283805-78283827 AGGGGGAATTGAAGAGATGTAGG - Intergenic
909724422 1:78816830-78816852 GGGAGGAATGAAAGGGAGGTTGG - Intergenic
910600392 1:89025099-89025121 AGGTGGGAGCAAAGGTATATTGG + Intergenic
913325941 1:117629011-117629033 AGGTGGAGGCAAGGGGATGAAGG - Intergenic
916561658 1:165938976-165938998 AGGTGGAAGCCAAGGAATGCAGG - Intergenic
918493584 1:185109533-185109555 AGGTTGATTCAGGGGGATGTTGG - Intergenic
919184277 1:194124268-194124290 AGATGGAATAAAAGTGATATTGG + Intergenic
921053721 1:211528560-211528582 AGGAGGCAGCAAAGGGTTGTGGG + Intergenic
922174065 1:223181323-223181345 AGGTGGAATGAAAGGATTGATGG + Intergenic
922360394 1:224816215-224816237 AGGTGGTTTCCAAGGGCTGTGGG + Intergenic
922727914 1:227933263-227933285 AGGTGGAAGCAAACAGAGGTTGG - Intronic
922808988 1:228405770-228405792 AGCTGGAATCAGAGGAAAGTGGG - Intronic
924465800 1:244298304-244298326 GGGTGCAATCATAGGGGTGTGGG + Intergenic
1064422559 10:15203285-15203307 GGGTGCAATCATAGGGGTGTGGG - Intergenic
1064533151 10:16330891-16330913 TGGTGGAAGCAAAGAGAAGTTGG - Intergenic
1067284808 10:44899766-44899788 AGCTGCAAACAAAGGAATGTGGG + Intergenic
1067432914 10:46255780-46255802 AGGAGGCATGAAAAGGATGTGGG - Intergenic
1067698800 10:48554055-48554077 AGGTGGTAACAAAGGGATCCTGG - Intronic
1067819786 10:49518570-49518592 AGGTGGCATCAAGTGGAGGTGGG - Intronic
1067842784 10:49694985-49695007 AGGTGAAATTAAAGAGAGGTTGG + Intronic
1070972017 10:80575458-80575480 ATTTAGAAACAAAGGGATGTGGG + Intronic
1071148533 10:82604168-82604190 AGGTGGAACAAAAGGGATTTTGG - Intronic
1072317133 10:94214070-94214092 ATGTGGAGCCAAAGGAATGTAGG - Intronic
1073632386 10:105161827-105161849 AGGTGGAATCAGAGAGATTGTGG - Intronic
1074327375 10:112464826-112464848 TGGTGGAATTTAAGGTATGTTGG + Intronic
1078720733 11:13881054-13881076 AGGTGGAATGGAGGGGATCTTGG + Intergenic
1079938942 11:26653627-26653649 TGGTGGAAACAAAGGGAGGGAGG - Intronic
1080440754 11:32292297-32292319 AGCTGGGATCACAGGCATGTGGG - Intergenic
1081482845 11:43505346-43505368 AAGTGGATGCCAAGGGATGTGGG - Intergenic
1083390008 11:62341812-62341834 GCGTGGACTCAAAGGGATGTGGG - Intronic
1085233331 11:74991661-74991683 AGGTGGAGTGCAAGGGATGGGGG - Intronic
1089876728 11:121729224-121729246 AGGTGGAAGCAAAGGGGTAGTGG - Intergenic
1090234067 11:125133495-125133517 AGGAGGAAGCAAAAGGGTGTGGG - Intergenic
1090422593 11:126585700-126585722 ACGTGGGAACAAAGGGATGCGGG + Intronic
1090974178 11:131667786-131667808 AGTTGGAATCTCAGGCATGTGGG - Intronic
1091844891 12:3648320-3648342 AGGAGGAATAAACTGGATGTGGG + Intronic
1092299019 12:7227572-7227594 AGGTGCAATAAAAGGGCAGTGGG + Intergenic
1094207712 12:27858275-27858297 AGGTGGAGACAAAGGGAGGCTGG - Intergenic
1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG + Intronic
1094820676 12:34221681-34221703 ACGTAGAATCCAAGGAATGTAGG - Intergenic
1095173313 12:39060577-39060599 AGGAGTCAGCAAAGGGATGTAGG - Intergenic
1096372716 12:51082853-51082875 AGCAGGAATCAGAGGGAAGTGGG - Intronic
1097779249 12:63684834-63684856 ATGTGGAATGAAGGGAATGTGGG + Intergenic
1098393013 12:69989405-69989427 AGGTGGAAGGGATGGGATGTTGG + Intergenic
1098456591 12:70681298-70681320 AGCTTGAATCACAGGGATGAGGG + Intronic
1099205215 12:79719116-79719138 AGGTGGGAAAAAAGTGATGTTGG + Intergenic
1100578794 12:95919057-95919079 GGGTGGAATGAATGGGATGCAGG + Intronic
1100966380 12:100017588-100017610 AAGTGGGATCAAAAGAATGTTGG - Intergenic
1101038014 12:100724224-100724246 AAGTGGAATCAAAGGGACGCCGG + Intronic
1101287877 12:103334747-103334769 CCGTGGAAGCAAAGGGAAGTTGG - Intronic
1101620245 12:106379744-106379766 AGGTAGAGTCAAAGTGAAGTTGG + Intronic
1101774849 12:107784315-107784337 AGGTGGAATAAAGTGGATTTGGG + Intergenic
1103963166 12:124622023-124622045 GGATGGAGTGAAAGGGATGTTGG - Intergenic
1104320136 12:127743004-127743026 GGGTGCAATCACAGGGGTGTGGG + Intergenic
1104404896 12:128509054-128509076 AGTGGGAATCAGAAGGATGTTGG + Intronic
1104505208 12:129325482-129325504 AGGTGGATCCAAAGGCTTGTTGG + Intronic
1106205946 13:27594797-27594819 AGGTGGAATCGAGGGGAACTTGG - Intronic
1106606576 13:31234567-31234589 AGGTGGAAGCACAGGTGTGTGGG + Intronic
1107676911 13:42807147-42807169 AGATGGAATCAAAGGAAGGAAGG - Intergenic
1108378178 13:49833166-49833188 AGGTGCAATTCTAGGGATGTGGG + Intergenic
1108762671 13:53588632-53588654 TGGTGGAAGCAAAGGGATATAGG - Intergenic
1109157453 13:58928386-58928408 GTGTGGAATCAAAGAGTTGTAGG + Intergenic
1110298656 13:73899321-73899343 AGGTGGAAACAGACGGATATGGG - Intronic
1112367983 13:98772070-98772092 AGGTGGAATGAATTGGATTTAGG + Intergenic
1113386308 13:109851466-109851488 AGGTGGAAAAGAAGGTATGTGGG + Intergenic
1114181031 14:20368060-20368082 AGGAGGAATGAGAGTGATGTTGG - Exonic
1114656315 14:24317809-24317831 AGAAGGAAGCAAAGGGATGTTGG + Exonic
1116035429 14:39621444-39621466 TGGTGGCATCAAAGTGATGATGG + Intergenic
1118788157 14:69064103-69064125 AGGTGGTATGAAAGGGAAGCTGG + Intronic
1119867373 14:77985167-77985189 AGGTGGCATCATTAGGATGTTGG + Intergenic
1121222848 14:92299436-92299458 AGGTGAAAGCACAGGGAAGTGGG - Intergenic
1121541524 14:94730779-94730801 AGGGCAAATCAAAGGGATATAGG + Intergenic
1122379431 14:101291123-101291145 AGGTGGAAGAAAAGGCATGAGGG + Intergenic
1122698540 14:103570897-103570919 GGGTGCAATCACAGGGGTGTGGG + Intronic
1122881887 14:104693958-104693980 AGGTGGAAGCAGAGGCAGGTGGG - Intronic
1127346031 15:58099924-58099946 AGAAGAAATCACAGGGATGTTGG - Intronic
1127957332 15:63864484-63864506 AGGTAGTATCAAAGGAATGATGG + Intergenic
1130194337 15:81764847-81764869 AGGTGGAATGAGAGGCATCTTGG - Intergenic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1138705248 16:58908932-58908954 GGGTGCAATCATAGGGGTGTGGG - Intergenic
1138734847 16:59238580-59238602 AGATGAAATCACAGGGGTGTGGG - Intergenic
1138849536 16:60610255-60610277 AGGAAAAATTAAAGGGATGTTGG + Intergenic
1139002633 16:62531671-62531693 AGGTTTAATCAAATGGATGTTGG + Intergenic
1139527229 16:67524557-67524579 AGGTGGCATCTGAGGGATCTAGG - Intronic
1139915996 16:70428832-70428854 AGGTGGAATCAGACTGATCTGGG - Intronic
1141233185 16:82190289-82190311 AGGTGGAAGCAAAGTCATGAAGG + Intergenic
1141431701 16:83973505-83973527 AGGAGGAATAAGAGGGACGTAGG + Intronic
1142762067 17:2048595-2048617 AGGCAGAATGAACGGGATGTGGG - Intergenic
1143524223 17:7463005-7463027 AGGAGGAATCAAAGGCTGGTGGG - Exonic
1143762709 17:9116514-9116536 AGGGGAAATCAGAGAGATGTGGG - Intronic
1143935489 17:10480171-10480193 GGGGGGAATCAAAAAGATGTTGG - Intergenic
1147875667 17:43618701-43618723 AGGTGAAATCAGTGGCATGTGGG - Intergenic
1149122085 17:53181584-53181606 AGTTTTAATCAAAGGGATGCTGG + Intergenic
1149196959 17:54132788-54132810 AGGTGGAATCTAAAGGCAGTAGG + Intergenic
1150420439 17:65029336-65029358 AGGTGGAAGCAGAGGCGTGTGGG - Intronic
1156520192 18:37715693-37715715 ATGTGGAATCAAAGGGACCTGGG + Intergenic
1158245835 18:55431252-55431274 AGGTGGAATCAAAGGGATGTAGG - Intronic
1158414840 18:57241022-57241044 AGGTGGAAGCAGAGGTATGCAGG + Intergenic
1159006921 18:63021547-63021569 AGGTGGAAAAGAAGGGATGGAGG - Intergenic
1159285327 18:66342540-66342562 AGGTCTAATCAAAGGGTTTTAGG - Intergenic
1159547623 18:69859360-69859382 AGGTGGAAAAAAAGTTATGTAGG + Exonic
1162817696 19:13206432-13206454 AAGTTGAATCAAAGGGCTTTTGG - Exonic
1163721730 19:18901096-18901118 AGGTGGCTCCAAAGGGAAGTGGG + Intronic
1163774262 19:19208560-19208582 AGGTGGAAGCCAAGGTCTGTGGG - Intergenic
1164673543 19:30087355-30087377 AAGTGGCATCACAGGGCTGTGGG - Intergenic
1165386869 19:35514901-35514923 AGATGGAATAACAGGGAAGTAGG - Intergenic
1165777192 19:38411506-38411528 AACTGGAATTAAAGGAATGTGGG + Intronic
928069693 2:28202332-28202354 GGGGGGACTCAATGGGATGTGGG - Intronic
929564892 2:42978167-42978189 AGCTGGTCTCAAAGGGATGCGGG + Intergenic
930678187 2:54227320-54227342 AAGTGGAATAAAAGAGATGAGGG - Intronic
931819444 2:65936628-65936650 AGGTGGAATCAAAGTGTGGCTGG - Intergenic
934020233 2:87942743-87942765 AGGAGGAATAAAAGAGAGGTTGG - Intergenic
936088193 2:109483947-109483969 AGGTGGAGGCACAGGGATGGCGG - Intronic
937712638 2:124995679-124995701 GGTTGCAATCATAGGGATGTGGG + Intergenic
939077972 2:137626028-137626050 AGCAGGAATCACTGGGATGTGGG + Intronic
939806952 2:146785595-146785617 AGGGAGAATTAAAGGGATGCAGG - Intergenic
940513096 2:154643995-154644017 ATGTGTAATAAAAGGGATATAGG - Intergenic
941155751 2:161975903-161975925 AGGTGAAATCAGAGTGAGGTGGG + Intronic
943431551 2:187809170-187809192 AGGTAATATCAAAGAGATGTAGG + Intergenic
943894507 2:193337354-193337376 AGATTAAATCAAAGGGATATTGG - Intergenic
944201814 2:197115853-197115875 AGGAGGATTCAAAGAGATTTAGG + Intronic
945146109 2:206739911-206739933 AGGAGGCTTCATAGGGATGTTGG - Intronic
945173628 2:207020535-207020557 AAGTGGAAGCAAAGAGAGGTTGG - Intergenic
945702952 2:213194126-213194148 AGGAGAAATCAAAGCAATGTTGG + Intergenic
946396302 2:219445344-219445366 AGGTGGGAGCAGGGGGATGTGGG - Intronic
946770773 2:223086188-223086210 AGATGAGATCAAAAGGATGTGGG - Intronic
948986622 2:241529004-241529026 AAGTGGAATCAAAGTTACGTGGG + Intergenic
1168903475 20:1385690-1385712 AGGTGAAGTCAGAGGGATGGTGG - Intronic
1169701457 20:8451702-8451724 AGGAGGAAACGAAGGGATGAAGG - Intronic
1170207189 20:13811145-13811167 AGCTGGAAGAAAAGGGAAGTGGG + Intronic
1170606289 20:17877262-17877284 AGGGGGAAACAGAGTGATGTTGG + Intergenic
1170828269 20:19816335-19816357 AGGTGATATCAAATGGAGGTAGG - Intergenic
1171336583 20:24390704-24390726 AGGTAGAATCAGAGGGAAGGTGG - Intergenic
1171935035 20:31266898-31266920 AGATAGACTCAAAGGGATGGAGG - Intergenic
1175093646 20:56524610-56524632 AGGAGGACTCAAAGGGAGATGGG - Exonic
1175094837 20:56533143-56533165 AGGAGGACTCAAAGGGAGATGGG - Intergenic
1175771935 20:61629461-61629483 AGCTGTAATCAAAGGAATGGTGG + Intronic
1178202034 21:30418316-30418338 AGGTGGAACCAAGCTGATGTGGG - Intronic
1179245359 21:39628967-39628989 ATGTGGAATCCAAGGGAACTGGG - Intronic
1179596963 21:42449407-42449429 AGATGGATTCACTGGGATGTAGG + Intergenic
1180066855 21:45416635-45416657 AGCTGGAATCTAAGAGATGCCGG - Intronic
1182854263 22:33503111-33503133 AACTAGAATAAAAGGGATGTGGG + Intronic
1183786097 22:40030000-40030022 TGGTGGAATAAAAGGGAAGAGGG + Exonic
949913087 3:8930969-8930991 ATGTGGAATAAAAGTGGTGTGGG - Intronic
950626918 3:14254026-14254048 ACATGGAATAAAAGTGATGTGGG - Intergenic
950781690 3:15398000-15398022 GGGTGCAATCATAGGGATGTGGG - Intronic
953010340 3:39019326-39019348 AGGTGCAATCAAAAGGGTGTGGG - Intergenic
953147951 3:40295965-40295987 AGGTGTAGCCAATGGGATGTAGG - Intergenic
953197955 3:40751809-40751831 AGGAGGAAGCAAGGAGATGTGGG + Intergenic
953656553 3:44859082-44859104 AGGAGGAATCCCAGGGCTGTGGG + Intronic
953669714 3:44952247-44952269 TGGTGGAGTGAATGGGATGTGGG - Intronic
956507963 3:69962792-69962814 AGGGGGAATCAAGGGTATTTAGG + Intronic
958849686 3:99309401-99309423 GGGTGGAAATAAAGGGATGGAGG - Intergenic
961847234 3:129776055-129776077 AGGAGGAGTAAAAGGGAAGTGGG - Intronic
963091102 3:141484895-141484917 AGGAGGAATGAGAGGGATGGGGG + Intergenic
963990084 3:151642900-151642922 AGGTAGAATCAACAGGATTTTGG + Intergenic
965372459 3:167880607-167880629 AGGTAGAGTCAACAGGATGTAGG + Intergenic
965736397 3:171825174-171825196 TGGTGGTATCAAAGGCCTGTGGG + Intergenic
970447508 4:16136467-16136489 GGGTGGAATCAAAAGGACATTGG - Intergenic
971615810 4:28789161-28789183 AGGTGCAGTTATAGGGATGTGGG - Intergenic
973218706 4:47700795-47700817 AGGAGGAAGCAGGGGGATGTAGG - Intronic
973780417 4:54283443-54283465 AGCTGGAGTCATAGGGATGCAGG + Intronic
975286599 4:72628705-72628727 AGGTGGAAACATAGGCATATTGG - Intergenic
976220356 4:82752346-82752368 AGGTGGAAGCACAGGGACGTGGG + Intronic
976666185 4:87595269-87595291 AGGAGGAATAAAAGGGAGATTGG - Intergenic
977207730 4:94182232-94182254 AGTGGGAATCAAAGGAATGGAGG + Intergenic
977416058 4:96733961-96733983 TGGTGAAAACAAAGGGATATAGG - Intergenic
978292090 4:107153356-107153378 AGGGGGCATGAAAGGGAGGTTGG - Intronic
982130586 4:152225318-152225340 AGGTGGCATAGAAGGGAGGTGGG + Intergenic
985396254 4:189547648-189547670 AGGTGGCATTGAATGGATGTGGG + Intergenic
986685241 5:10270630-10270652 AGATGGAATCAATGGGACATTGG - Intergenic
987208377 5:15652033-15652055 AGTTGGAAGCTAAGGGAGGTTGG - Intronic
987543490 5:19284250-19284272 AGCTGGAATGACTGGGATGTGGG + Intergenic
987928917 5:24377640-24377662 AGGTGGAATCAAAGGGGCCAGGG + Intergenic
990453399 5:55959372-55959394 AGCTGGAAGTAAAGGGATATAGG + Intronic
990871397 5:60434702-60434724 AGATGGAATCAGAGAGATTTAGG - Intronic
992622495 5:78607566-78607588 AGGTGGAACCAACTGGATGGGGG - Intronic
993408840 5:87549043-87549065 AGGTGGAAGGAATGGCATGTTGG - Intergenic
996158798 5:120136435-120136457 TGGTACAGTCAAAGGGATGTGGG + Intergenic
997704499 5:135934356-135934378 AAGTGAAATCAAATGGAGGTTGG + Intronic
997748253 5:136318784-136318806 AGGTGGAATCAAAGGATTGCTGG - Intronic
997804751 5:136905994-136906016 AGGTGGAATCCAATGGCAGTGGG + Intergenic
999505281 5:152188233-152188255 AGGAGGCAGGAAAGGGATGTAGG + Intergenic
1001417503 5:171556152-171556174 AGGAGGAAGTAAAGGGATGAGGG - Intergenic
1001897812 5:175396669-175396691 AGGTGGAATCACTGGGCTTTTGG + Intergenic
1002032624 5:176441714-176441736 AGGTGAAATGTAAGAGATGTTGG + Intergenic
1002330700 5:178438323-178438345 AGGGGGAAAAAAAGGTATGTAGG + Intronic
1002575625 5:180172289-180172311 AGGTGGCATCTAAGGGCTGGGGG - Intronic
1003313072 6:4986221-4986243 AGGAGGACTCAATGGAATGTGGG + Intergenic
1004362536 6:14984009-14984031 AGGTGAAATCAAAGGACTTTTGG - Intergenic
1004474513 6:15958961-15958983 GGGTGCAATCACAGGGGTGTGGG + Intergenic
1004583537 6:16977538-16977560 ATCTGGCATCAAAGGCATGTAGG - Intergenic
1005467204 6:26126646-26126668 AGCTGGAATCAAAGGCAATTTGG - Intronic
1006113051 6:31760347-31760369 AGGTGGAAGCACAGGGATGTGGG - Intronic
1006608719 6:35279058-35279080 AGGTGGACTCTAAGAGCTGTAGG + Intronic
1006886779 6:37388622-37388644 AGATGGAAAAAGAGGGATGTGGG + Intronic
1007243748 6:40445172-40445194 AGGTGCAATCCAAGGGAAGAGGG + Intronic
1007648718 6:43403008-43403030 AGGTGGTATCAAAGTGCTGTGGG + Intergenic
1007779315 6:44243578-44243600 TGGAGGAATAAAAGGGATCTGGG + Intergenic
1009811894 6:68678583-68678605 GGGTGTAATCAAAGGAAGGTTGG + Intronic
1010314547 6:74431601-74431623 AGGTGAAATCAGATGCATGTTGG - Intergenic
1011009318 6:82685918-82685940 GGGTGCAATCATAGGGATATAGG + Intergenic
1012058914 6:94452438-94452460 AGGTTGAATAAAAGTGATGAGGG - Intergenic
1012758765 6:103268018-103268040 AGGTGGAAAGAACGGTATGTTGG + Intergenic
1014383447 6:120772990-120773012 AAGTGGAATGAAGGGGATATGGG - Intergenic
1015189302 6:130455912-130455934 AGGTAGAAACAAAGGGCAGTCGG + Intergenic
1016857091 6:148681920-148681942 GGGGGGAATCAAAGAGATGTTGG - Intergenic
1017779988 6:157708262-157708284 GGGTGCAATCAGAGGGGTGTGGG + Intronic
1018277315 6:162146801-162146823 AGGAGGAATAAAAAGAATGTAGG - Intronic
1019820831 7:3241613-3241635 AGCTGGAATCAGAGGCATGTAGG + Intergenic
1022754979 7:33277690-33277712 AGGTGCAATCATAGGGGTGTGGG + Intronic
1022938175 7:35202521-35202543 ATGTGGAATGAAGGGAATGTGGG + Exonic
1024749524 7:52449004-52449026 ACGTGCAATCACAGGGGTGTGGG - Intergenic
1025809776 7:64868409-64868431 AGGTGGATTCAAGGGGCTCTGGG - Intergenic
1026827589 7:73594044-73594066 ATGTGGAACCAAAGGGATAGGGG + Intronic
1030695447 7:112580380-112580402 GAGTGGAAACAAAGGAATGTGGG - Intergenic
1030951947 7:115802022-115802044 AGGTGGTATCACAGGGCAGTAGG - Intergenic
1031355975 7:120786820-120786842 AGGTGAAATTACAGGGATTTGGG + Intergenic
1031513789 7:122678545-122678567 AGGTGAAATCACAGGTGTGTGGG + Intronic
1032411812 7:131699738-131699760 AGGTAGAAGCATAAGGATGTGGG + Intergenic
1036382248 8:8244195-8244217 GGGTACAATCACAGGGATGTTGG - Intergenic
1037203096 8:16282132-16282154 GGGTGAAATCATAGGGGTGTGGG + Intronic
1039322263 8:36445371-36445393 AGATGAAATCATAGGGGTGTGGG + Intergenic
1041055332 8:53979877-53979899 GGATGCAATCATAGGGATGTGGG - Intronic
1049075501 8:140392872-140392894 TGGTTGTATCAAAGGGATGCAGG - Intronic
1049980131 9:896447-896469 TGGAGGAAATAAAGGGATGTTGG - Intronic
1051789746 9:20787667-20787689 AGCTGGAATCAAAGGCAAGAAGG - Intronic
1051890106 9:21932604-21932626 GGGTGCAATCATAGGGGTGTGGG - Intronic
1051954918 9:22680633-22680655 AGGGAGAATGAAAGGGAAGTAGG + Intergenic
1053419910 9:37970815-37970837 AGGGGGAGTCACAGGGATGTAGG - Intronic
1053561614 9:39202063-39202085 GGGTGTAATCATAGGGGTGTGGG - Intronic
1053825709 9:42022305-42022327 GGGTGTAATCATAGGGGTGTGGG - Intronic
1054135505 9:61416884-61416906 GGGTGTAATCATAGGGGTGTGGG + Intergenic
1054604854 9:67165088-67165110 GGGTGTAATCATAGGGGTGTGGG + Intergenic
1055116301 9:72609119-72609141 AGGTTGAAAGAAAGGGAGGTAGG - Intronic
1055220464 9:73924095-73924117 AGAAGGAATCAAAGTGATGCTGG + Intergenic
1055416992 9:76094286-76094308 AGGTGGAAGCAAAAGCATTTGGG - Intronic
1055992353 9:82120593-82120615 AGATGGGATTAAAGAGATGTAGG + Intergenic
1056202098 9:84286771-84286793 AGGGGGATTCAAAGTGATGGTGG - Intronic
1056740121 9:89247220-89247242 AGATGGTATAAAATGGATGTGGG - Intergenic
1058598875 9:106647312-106647334 GGGAGAAATGAAAGGGATGTGGG - Intergenic
1059683136 9:116605768-116605790 AGATGGAAATAAAGGGATATAGG - Intronic
1059950518 9:119457408-119457430 AGTTGGAAGGAAGGGGATGTAGG - Intergenic
1060507758 9:124210958-124210980 AGGTGGAATACAGGGGATTTTGG - Intergenic
1061405207 9:130390101-130390123 AGCTGGACGCAAAGGGAGGTGGG - Intronic
1186092424 X:6064152-6064174 AGGTGGAGTTAAGGGGATATAGG - Intronic
1186250005 X:7655768-7655790 ATGTGGAATTAAATAGATGTGGG - Intergenic
1188626267 X:32289003-32289025 TGTTGGAACCAAAGTGATGTGGG - Intronic
1188750913 X:33904931-33904953 AGATGGAATCATAGGGGTGTGGG + Intergenic
1189271958 X:39758180-39758202 AGTAGGAATTAAAGGAATGTAGG + Intergenic
1190524081 X:51310921-51310943 AGGTGCCAGCAAAGTGATGTGGG + Intergenic
1191178740 X:57536890-57536912 AGATGCAATCAAAGGGCTGGGGG + Intergenic
1192184257 X:68935951-68935973 TGGTGAACTCACAGGGATGTAGG + Intergenic
1192208486 X:69111411-69111433 AGGAAGAAACAAAAGGATGTGGG + Intergenic
1193971509 X:88060766-88060788 CGGTGGAATCATAAGGATTTGGG + Intergenic
1195220750 X:102743752-102743774 GGGTGCAATCATAGGGGTGTGGG + Intronic
1195854191 X:109312568-109312590 AGGTGAAAGCAAAGGCATTTTGG - Intergenic
1197240955 X:124122851-124122873 AGTTGAAATCTAAGGTATGTTGG + Intronic
1197637608 X:128932649-128932671 AGGTATAATTTAAGGGATGTTGG - Intergenic
1198444547 X:136698989-136699011 AGGTGGGAGCAAAGGTCTGTTGG + Intronic
1199124290 X:144096385-144096407 AGGAGGAATAAAAGAGAGGTTGG + Intergenic
1200818843 Y:7561598-7561620 TGGTGGAATCACTGAGATGTGGG - Intergenic
1201465720 Y:14278428-14278450 ATGTGAAATTAAAGAGATGTGGG - Intergenic