ID: 1158251353

View in Genome Browser
Species Human (GRCh38)
Location 18:55491255-55491277
Sequence CCCGCCCCCATGATGGTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158251353_1158251361 6 Left 1158251353 18:55491255-55491277 CCCCAGACCATCATGGGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1158251361 18:55491284-55491306 GTGGTTCCATTCACAATGAATGG 0: 1
1: 0
2: 1
3: 8
4: 134
1158251353_1158251363 21 Left 1158251353 18:55491255-55491277 CCCCAGACCATCATGGGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1158251363 18:55491299-55491321 ATGAATGGAAGACATACTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158251353 Original CRISPR CCCGCCCCCATGATGGTCTG GGG (reversed) Intronic
900718801 1:4161734-4161756 CCCGCCCCCATGAGGTTTGGTGG - Intergenic
903307335 1:22422441-22422463 CTAGCCCCCATAATGGTTTGTGG - Intergenic
903368045 1:22816901-22816923 GGGGCACCCATGATGGTCTGGGG - Intronic
905106398 1:35565851-35565873 CCTGCCCCCATGGGGGCCTGAGG - Exonic
905602955 1:39269693-39269715 CCAGACCCCATGATGGGGTGTGG - Intronic
914845422 1:151281356-151281378 CCCGCCCCCAGCATGGAGTGGGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
919422999 1:197394467-197394489 CCAGCCCCCATGATGTTCAAGGG + Intronic
920549299 1:206845202-206845224 CCCTCCATCATGATGGTTTGTGG + Intergenic
921282924 1:213585246-213585268 CCTAGCCCCATGTTGGTCTGTGG + Intergenic
921289788 1:213646742-213646764 CCAGCCCCCATGATGACCTCAGG - Intergenic
922480800 1:225939284-225939306 CCCGTCCCCAGGACTGTCTGGGG - Intronic
922887082 1:229028405-229028427 CAAGCCCCCATCATGGGCTGAGG + Intergenic
923950695 1:238949368-238949390 CCCTCCACAATGATGGTTTGGGG - Intergenic
1066324355 10:34341686-34341708 CCAGCTCCCATGATGATGTGGGG - Exonic
1068405307 10:56580969-56580991 CTTGCCTCCATGATGGTCTTAGG + Intergenic
1069842825 10:71350576-71350598 CCAGCCCCCATACTGGCCTGGGG - Intronic
1070642110 10:78177659-78177681 CCTGGCCCCATGCTGGGCTGTGG - Intergenic
1074245363 10:111685558-111685580 TCAGCCCCCATGAGGGACTGGGG - Intergenic
1077251581 11:1563160-1563182 CCCTCCCCCATCCAGGTCTGGGG - Intronic
1078264068 11:9740066-9740088 CCTGCCACCCTGATGGGCTGAGG + Intronic
1079146539 11:17857326-17857348 CCCTCCACCATGAAAGTCTGTGG + Intronic
1080596006 11:33774616-33774638 CCCGCCCTCAGGGTGGGCTGAGG + Intergenic
1083609659 11:63998897-63998919 CCCGCCCCCAGGGTGGACCGGGG + Intronic
1083895191 11:65616259-65616281 GCCGCCCCCATGAGGGTCCCGGG + Exonic
1084683258 11:70679411-70679433 CCCACCTCCCTGATGGTCCGGGG - Intronic
1085503878 11:77044702-77044724 CCATCCCCCACGTTGGTCTGTGG - Intergenic
1091899630 12:4134450-4134472 CCCGTCCCCATGATGGTGGGTGG + Intergenic
1100013446 12:89980700-89980722 TCTCCACCCATGATGGTCTGGGG + Intergenic
1101212242 12:102546195-102546217 CATGTCCCCATGGTGGTCTGTGG + Intergenic
1102331195 12:112032422-112032444 CCCTTCCCTATGAAGGTCTGGGG + Intronic
1103558058 12:121777835-121777857 CCAGGCCTCATGATGGTCTACGG - Exonic
1105297305 13:19099664-19099686 CCCACCCCCATTATGGTCTAAGG - Intergenic
1106543758 13:30713393-30713415 CCTGCCCCCATCCTTGTCTGGGG + Intergenic
1111694124 13:91601869-91601891 CCATCCCCCATGCTGGTCTGTGG + Intronic
1121316264 14:92962686-92962708 CCCTCCCCTATGCTGGCCTGCGG + Intronic
1122791885 14:104187485-104187507 CCCTCCCCCAAGGAGGTCTGAGG + Intergenic
1122828706 14:104384923-104384945 CCAGCCCCCAGGATGGTCCTCGG + Intergenic
1122889224 14:104724811-104724833 CCCAGCCCCAGGATGGTTTGAGG + Intronic
1127014177 15:54664999-54665021 CCAGCTCACAAGATGGTCTGTGG + Intergenic
1132660453 16:1058602-1058624 CCCGCCCCCAGAATGTCCTGGGG - Intergenic
1132907670 16:2291444-2291466 CCAGCCCCCATGCAGTTCTGAGG + Intronic
1136512646 16:30748628-30748650 CCCGCCCCCAGGCTCTTCTGCGG + Intronic
1138343651 16:56307040-56307062 ACTGCCCCCAAGATGGGCTGGGG - Intronic
1138456745 16:57125367-57125389 CCAGGCCCCTTGGTGGTCTGAGG + Intronic
1141980710 16:87548235-87548257 CCCACCCCCATGCTGGAGTGTGG - Intergenic
1143165559 17:4895651-4895673 CCCGCCCCCATTCTCATCTGAGG - Intronic
1145262830 17:21365056-21365078 CCCACCCCCAGCATTGTCTGGGG - Intergenic
1146234120 17:31141990-31142012 CCTACCCCCATTATGGTCTAAGG + Intronic
1147215939 17:38899029-38899051 CCCGCCTCCCTGATGGTCAGTGG + Intronic
1148779293 17:50112544-50112566 CCCAGCCCCACGATGGCCTGAGG + Intronic
1152580117 17:81162117-81162139 CCCGCACCCATGCTGGTAGGTGG + Intronic
1158251353 18:55491255-55491277 CCCGCCCCCATGATGGTCTGGGG - Intronic
1160034298 18:75286701-75286723 ACCGCCCACATGATGGTCACCGG + Exonic
1161510025 19:4665074-4665096 CCCGCCCTCCTGGTGGCCTGGGG + Intronic
1162977717 19:14218011-14218033 CCCTCCCCGTTGCTGGTCTGAGG - Intergenic
1163849312 19:19654446-19654468 CCTGTCCCCAAGATGCTCTGAGG + Intronic
1164129003 19:22344961-22344983 CCTGCCCACATGATGGACTGTGG + Intergenic
1164170366 19:22719738-22719760 CCTGCCCACATGAAGGGCTGTGG - Intergenic
1165150430 19:33757001-33757023 TGTGCTCCCATGATGGTCTGGGG + Intronic
1165326045 19:35115267-35115289 CCCGCCCCCACGGTGGTGTTGGG + Intergenic
1167493725 19:49806164-49806186 CCCGCCCCCACGAAGTTCTCAGG - Exonic
925099728 2:1235104-1235126 CCTGCCCCCATGCTGCCCTGAGG + Intronic
929758988 2:44790687-44790709 CCCACCCCCCTGGGGGTCTGTGG + Intergenic
934710057 2:96508700-96508722 CCCGCGGCCCTGATGTTCTGGGG - Intergenic
934937963 2:98478812-98478834 CCCGCACCCATGACTTTCTGTGG + Intronic
935594537 2:104868614-104868636 CCCGCACCCCTGCTGGACTGGGG + Intergenic
935631487 2:105216101-105216123 CCCGCCCCCTTGACTGACTGGGG + Intergenic
937576917 2:123434916-123434938 CCATCCCCCACTATGGTCTGTGG - Intergenic
940345341 2:152622913-152622935 CCCTCCCTCATGCTGGTCTCTGG + Intronic
941822587 2:169857361-169857383 CCCGGCCCCATTGTGTTCTGAGG + Intronic
944626586 2:201575842-201575864 ACCCTCCCCATGCTGGTCTGTGG + Intronic
948942869 2:241204747-241204769 CCAGCCCCCAAGCTGGGCTGAGG + Intronic
1169367277 20:5001552-5001574 CCCGCCCCCGCGCCGGTCTGGGG + Intronic
1172284148 20:33729389-33729411 CCAGCCCCCATGATGTTCCTCGG + Intergenic
1172361700 20:34317196-34317218 CACCTCCCCATCATGGTCTGAGG + Intergenic
1175193418 20:57226183-57226205 CCTGGTCCCATCATGGTCTGTGG - Intronic
1176237322 20:64059640-64059662 CCCGCCCCCACCAGGGGCTGGGG - Intronic
1179925296 21:44530845-44530867 CCCTCCTCCCTGATGGTCTTGGG - Intronic
1182939513 22:34261936-34261958 CCCTCCCCCATGAGGGGCAGAGG - Intergenic
954969218 3:54637698-54637720 TCGGCGTCCATGATGGTCTGCGG + Intronic
956941625 3:74168627-74168649 CACTCTCCCATGCTGGTCTGTGG - Intergenic
961147650 3:124608540-124608562 CCCTCCCTCCTGATAGTCTGTGG + Intronic
961390493 3:126549890-126549912 CCTGCCGCCTTGCTGGTCTGGGG + Exonic
962893704 3:139695300-139695322 CCCACCCCCTTTAAGGTCTGTGG + Intergenic
965940233 3:174170038-174170060 ACAGCCCCCATGATGGTGTCTGG - Intronic
968652228 4:1764817-1764839 GCAGCCCCCACCATGGTCTGTGG - Intergenic
968681951 4:1927172-1927194 CCAGCCCCCATCATGTTGTGAGG - Intronic
982312297 4:153998205-153998227 CCATCCACCATGATGATCTGTGG + Intergenic
988069482 5:26267764-26267786 ACAGCCCCCATGATGGTATCTGG - Intergenic
994094020 5:95832550-95832572 CCCACCCCCATCATGACCTGGGG - Intergenic
1007071432 6:39041086-39041108 CTCCTCCCCATGAAGGTCTGAGG + Intergenic
1008572367 6:52828386-52828408 CACTCTCCCACGATGGTCTGCGG - Intergenic
1009992084 6:70855708-70855730 CCTGCCCCCATGACTTTCTGTGG - Intronic
1018736019 6:166687928-166687950 CCCTCCCCAGTGGTGGTCTGGGG - Intronic
1019453869 7:1114578-1114600 CCCGCGCCCATCACGGCCTGTGG - Intronic
1019599363 7:1873672-1873694 CACTCCCCCATGGTGGTCGGGGG - Intronic
1021965828 7:25916833-25916855 CTCACCCCCATGATTGGCTGAGG + Intergenic
1021971374 7:25968679-25968701 CCTGCCCTCATGACGTTCTGTGG - Intergenic
1024209356 7:47190532-47190554 CCCACCCCCATGCTGCTCTCCGG + Intergenic
1026869117 7:73840188-73840210 CCCACCCCTAGGGTGGTCTGAGG - Intronic
1029382350 7:100222128-100222150 CCAGCCCCAAAGCTGGTCTGAGG - Intronic
1032525980 7:132578260-132578282 CCCGCTCCCACCATAGTCTGAGG + Intronic
1037469965 8:19198323-19198345 CCCGACCCCATGACGGGCTCCGG + Intergenic
1043866825 8:85384157-85384179 CCCACCCCCACGTCGGTCTGTGG + Intronic
1044551945 8:93522189-93522211 CCCACCACCAACATGGTCTGAGG + Intergenic
1049476438 8:142799186-142799208 CCTGGCCCCCTGAGGGTCTGGGG - Intergenic
1049616842 8:143579234-143579256 GCCCCTCCCATGATGTTCTGGGG - Intergenic
1053313913 9:37036442-37036464 CCCGCACCCATGAAGGGCAGAGG + Intergenic
1061386822 9:130295417-130295439 CCTGACCCCATGGTGTTCTGAGG + Intronic
1062362899 9:136195947-136195969 CCCACCCCCATCATGCTCTCTGG + Intergenic
1062543405 9:137051465-137051487 CCTGTCCCCATGATGGCCTTTGG - Intronic
1062586433 9:137251917-137251939 CCCACCCCCAAGCTGGTCTTTGG + Intronic
1185721259 X:2383661-2383683 CCCAGCCCCATGATGGTCCATGG - Intronic
1186162803 X:6795457-6795479 ACAGCCCCCATGATGGTGGGTGG - Intergenic
1189487214 X:41442977-41442999 CCCTCCCCCATCCTGATCTGAGG + Intergenic
1191870209 X:65739257-65739279 CTATCCCCCATGATGGTCTAGGG - Intronic
1192166147 X:68828882-68828904 CCCGCCCCCTTCCTGCTCTGGGG + Intergenic
1197977741 X:132183189-132183211 CCAGACCTCATGATGGCCTGGGG + Intergenic
1199627941 X:149757947-149757969 CCCGCCCCCATCTTAGACTGAGG - Intergenic
1199628706 X:149761835-149761857 CCCGCCCCCATCTTAGACTGAGG - Intergenic
1200181114 X:154151251-154151273 CCCGCCCCCCTACTGTTCTGGGG - Intronic
1200186759 X:154188365-154188387 CCCGCCCCCCTACTGTTCTGGGG - Intergenic
1200192410 X:154225503-154225525 CCCGCCCCCCTACTGTTCTGGGG - Intronic
1200198165 X:154263307-154263329 CCCGCCCCCCTACTGTTCTGGGG - Intronic
1202060267 Y:20879764-20879786 ACCTCCTCCATGATGGTCTCTGG + Intergenic