ID: 1158251987

View in Genome Browser
Species Human (GRCh38)
Location 18:55499501-55499523
Sequence CTACATAAACAGATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158251987_1158251992 21 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251992 18:55499545-55499567 CTGTACATTAGAATCAACTGGGG 0: 2
1: 24
2: 156
3: 539
4: 1358
1158251987_1158251991 20 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251991 18:55499544-55499566 ACTGTACATTAGAATCAACTGGG 0: 1
1: 6
2: 68
3: 404
4: 1151
1158251987_1158251993 24 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251993 18:55499548-55499570 TACATTAGAATCAACTGGGGAGG 0: 1
1: 1
2: 14
3: 56
4: 248
1158251987_1158251990 19 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251990 18:55499543-55499565 GACTGTACATTAGAATCAACTGG 0: 1
1: 5
2: 71
3: 328
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158251987 Original CRISPR CTACATAAACAGATGGAGCT AGG (reversed) Intronic
901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG + Intergenic
904619159 1:31765109-31765131 CTACACAAACAGATGCAACATGG - Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
908242894 1:62202842-62202864 CTACAAATACAGATTTAGCTGGG - Intronic
908496920 1:64703766-64703788 CTACAAAAACACATGGGGCCAGG + Intergenic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
908912615 1:69089593-69089615 GGACATATACAGATGGACCTAGG - Intergenic
920739271 1:208564767-208564789 CTAATTACACAGGTGGAGCTGGG + Intergenic
1062820017 10:527930-527952 CTACATAATTACGTGGAGCTGGG - Intronic
1063829756 10:9938919-9938941 GAACATAAAAAAATGGAGCTGGG - Intergenic
1064296695 10:14085104-14085126 ATTTATAAACAGATGGAGGTGGG - Intronic
1066673842 10:37867245-37867267 TTACATGATCACATGGAGCTTGG - Intergenic
1066757209 10:38722972-38722994 AAACATGAACAAATGGAGCTTGG + Intergenic
1066964625 10:42251562-42251584 CAACATAAACATACAGAGCTGGG + Intergenic
1067005832 10:42661073-42661095 CTACATAAACAGAGTGAGGATGG + Intergenic
1067818174 10:49499603-49499625 CTACTGAAACACAAGGAGCTCGG + Intronic
1068640570 10:59400940-59400962 CTATTTAAACAAATGGTGCTGGG - Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1074701195 10:116094181-116094203 CTTCATAAATAGATAGAGCCGGG + Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1079892809 11:26079430-26079452 CTATATAACCTGATGGTGCTTGG - Intergenic
1080060371 11:27950299-27950321 CTACAAAAACTGAGAGAGCTGGG + Intergenic
1081108518 11:39102323-39102345 CAATAAAAACAGATGGACCTAGG - Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086897727 11:92333086-92333108 ATACATAAAAATATGGTGCTTGG - Intergenic
1087919499 11:103849985-103850007 CTTCATAAACAGAAGCAGCAAGG - Intergenic
1090941140 11:131389314-131389336 CTTCCTAATGAGATGGAGCTGGG + Intronic
1091023420 11:132121472-132121494 TTACTTAAATAAATGGAGCTGGG - Intronic
1091503357 12:1041046-1041068 CTACATAAACAAAAGCTGCTTGG - Intronic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1092574712 12:9768223-9768245 CTACATAAACTTATGGCACTGGG + Intergenic
1093529879 12:20148063-20148085 CTATATAAAAAGAGGGAGCCAGG - Intergenic
1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG + Intronic
1096753295 12:53777203-53777225 CTAAATAAACATATAGAGTTTGG - Intergenic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1099421789 12:82470889-82470911 CTACATGAACAGTTAAAGCTGGG + Intronic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1102363897 12:112314487-112314509 TTACAGAAACAGACGGATCTAGG - Exonic
1103053155 12:117798335-117798357 CTAAAGAAACAGAGGAAGCTGGG + Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1109220488 13:59636448-59636470 CTACTTCAACAGATGGAGGTTGG + Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1116789014 14:49319580-49319602 CTAGAAAAGCAGATGGACCTGGG - Intergenic
1117504657 14:56390078-56390100 CTACATAGACAGAAGGATCAAGG - Intergenic
1126312367 15:47332474-47332496 ATACATAACCAGAAGGAACTTGG + Intronic
1130215693 15:81966874-81966896 CTACATAAACAAATGTAAATGGG + Intergenic
1130311677 15:82761453-82761475 TTACTTAAAAAGATGGAACTGGG + Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1136720316 16:32314753-32314775 AAACATGAACAAATGGAGCTGGG - Intergenic
1136725369 16:32353145-32353167 AAACATGAACAAATGGAGCTGGG - Intergenic
1136730319 16:32405554-32405576 CGACATAAACATACAGAGCTGGG + Intergenic
1136838693 16:33521029-33521051 AAACATGAACAAATGGAGCTGGG - Intergenic
1136843702 16:33559203-33559225 AAACATGAACAAATGGAGCTGGG - Intergenic
1137986774 16:53115523-53115545 CAACCTAAAAATATGGAGCTGGG + Intronic
1138004556 16:53320011-53320033 ATAAATAAATAGAAGGAGCTGGG + Intronic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1140739988 16:77932917-77932939 CTACAGAAACAGAGGGACATTGG + Intronic
1202996082 16_KI270728v1_random:111753-111775 CGACATAAACATACAGAGCTGGG - Intergenic
1203001062 16_KI270728v1_random:164609-164631 AAACATGAACAAATGGAGCTGGG + Intergenic
1203006115 16_KI270728v1_random:203016-203038 AAACATGAACAAATGGAGCTGGG + Intergenic
1203022769 16_KI270728v1_random:424095-424117 CGACATAAACATACAGAGCTGGG - Intergenic
1203132664 16_KI270728v1_random:1701013-1701035 AAACATGAACAAATGGAGCTGGG + Intergenic
1203148858 16_KI270728v1_random:1821315-1821337 AAACATGAACAAATGGAGCTGGG - Intergenic
1203153867 16_KI270728v1_random:1859501-1859523 AAACATGAACAAATGGAGCTGGG - Intergenic
1146542537 17:33710048-33710070 CTCCATCAACCTATGGAGCTTGG - Intronic
1147566611 17:41540346-41540368 CTATATAAACTGCTGGAGGTAGG - Intergenic
1149118232 17:53126356-53126378 ATACGTAAACAGATGAAGATTGG - Intergenic
1150665419 17:67131376-67131398 CTTCACAAAAAGCTGGAGCTTGG + Intronic
1153660278 18:7319917-7319939 CTACAGACAGCGATGGAGCTTGG - Intergenic
1154469097 18:14681058-14681080 CTACATAAACAGAGTGAGGATGG - Intergenic
1155411101 18:25546128-25546150 CTAAAGAAAGAGATAGAGCTGGG + Intergenic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158256352 18:55553568-55553590 ATACATAAACACAGGGAGTTGGG - Intronic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1165616035 19:37201409-37201431 CTACTTTATCAAATGGAGCTGGG - Intronic
929820430 2:45269155-45269177 CTACATCAACAGAGAGAACTGGG + Intergenic
930384064 2:50670087-50670109 CTAGATAAATATATGCAGCTAGG - Intronic
933264731 2:80169578-80169600 CCACAGAAACAGATAGAGCAGGG - Intronic
934105859 2:88693864-88693886 CCACAGAAACAGACAGAGCTGGG - Intronic
934186625 2:89683605-89683627 CAACATAAACATACAGAGCTGGG + Intergenic
934315394 2:91913622-91913644 CAACATAAACATACAGAGCTGGG - Intergenic
934320513 2:91967413-91967435 AAACATGAACAAATGGAGCTGGG + Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
935014635 2:99168993-99169015 TTAAAGAGACAGATGGAGCTTGG - Intronic
935589900 2:104836541-104836563 CCACATAAGGAGCTGGAGCTGGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
941629121 2:167865052-167865074 CTGCATAAACATAGGTAGCTGGG - Intergenic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
1169006503 20:2211701-2211723 CTACCTAAACAGGTAGAACTTGG + Intergenic
1170997822 20:21381350-21381372 CTACATAAACTGACGGATATAGG - Intronic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1173022597 20:39279663-39279685 ATAAATAAACAGATGGAGCATGG + Intergenic
1173163662 20:40671118-40671140 CAACTTAGACAGATGGAGCTGGG - Intergenic
1174131407 20:48345922-48345944 CAACATAAACAAATGAAGCCAGG + Intergenic
1176805418 21:13476590-13476612 CTACATAAACAGAGTGAGGATGG + Intergenic
1177453998 21:21311106-21311128 CTACACAAACATATCAAGCTGGG + Intronic
1180308761 22:11151472-11151494 AAACATGAACAAATGGAGCTGGG + Intergenic
1180542164 22:16459506-16459528 CAACATAAACATACAGAGCTGGG - Intergenic
1180547238 22:16513283-16513305 AAACATGAACAAATGGAGCTGGG + Intergenic
1181634514 22:24168370-24168392 CTACATACACAGACAGGGCTGGG + Intronic
1182211925 22:28684051-28684073 AAACATGAACAAATGGAGCTGGG - Intergenic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
955769633 3:62374319-62374341 CTCCTTAAACAGGTGGAGATGGG - Intronic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
956721916 3:72125459-72125481 CTACATAAACAGGTGGGATTTGG + Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
965441676 3:168722406-168722428 ATACATCACCACATGGAGCTAGG + Intergenic
967500348 3:190190324-190190346 CTACATAAACAGAAGCACTTTGG + Intergenic
969160561 4:5254078-5254100 CTACAAAAAAAGATTCAGCTGGG - Intronic
969464867 4:7350405-7350427 ATACATAGACAGCTGGATCTAGG + Intronic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
974563740 4:63555810-63555832 CAACATAAGCTGTTGGAGCTTGG + Intergenic
975464714 4:74696346-74696368 CTACATAAACAGATGGGTATGGG + Intergenic
976976846 4:91176056-91176078 CTATCTAAACAAATGGTGCTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980037236 4:127899433-127899455 CCACAAAAACACATGGACCTAGG - Intergenic
980622596 4:135328552-135328574 CCATATAAACTAATGGAGCTTGG - Intergenic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
980871136 4:138612519-138612541 CTACCTAAACTGCTTGAGCTGGG - Intergenic
981550001 4:145934501-145934523 CTAACTGAACAGAAGGAGCTGGG + Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG + Intergenic
986595200 5:9414481-9414503 CTGCATAAATAGATGGAAATAGG + Intronic
989111309 5:37908776-37908798 CTACATAAATATCTGAAGCTGGG - Intergenic
995038248 5:107559567-107559589 GAACATAAACAGATGTAGTTGGG - Intronic
995301165 5:110585103-110585125 CTACTTAAGAAGAAGGAGCTGGG - Intronic
996491440 5:124102642-124102664 ATACATAAACAAATGGAGTGTGG + Intergenic
996946694 5:129078968-129078990 CTTCATAAACTGCTGGAGCCAGG + Intergenic
998883638 5:146671396-146671418 TTGCATAAACAAATAGAGCTGGG + Intronic
999545004 5:152618182-152618204 AAACATATACAGATGGAGGTGGG - Intergenic
999624538 5:153506511-153506533 CTCAATTAACAAATGGAGCTTGG - Intronic
1001690493 5:173629308-173629330 CTAAATAACAAGAAGGAGCTGGG + Intergenic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1003733118 6:8848406-8848428 CTCCAAAAACAGGTGGATCTTGG - Intergenic
1004512589 6:16294913-16294935 CTACAGAAAGTGCTGGAGCTGGG + Intronic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008754471 6:54777741-54777763 CTACACAAAAAGATGGACCATGG - Intergenic
1010368782 6:75083443-75083465 CAAAATAAACTGATGGAACTTGG + Intergenic
1012145808 6:95680379-95680401 GTACATAAACAGATAAAACTGGG + Intergenic
1012181321 6:96156512-96156534 ATATATAAGCTGATGGAGCTGGG + Intronic
1026243693 7:68599288-68599310 CTACATAAGTAGATGGAGCCTGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1027611145 7:80362214-80362236 CTGCATAAACAGCTGGCTCTTGG - Intergenic
1028549035 7:92036445-92036467 CTACAAAAACATTTGTAGCTGGG - Intronic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1036453578 8:8890689-8890711 CTCCACATACTGATGGAGCTGGG + Exonic
1038833470 8:31090856-31090878 CTACATAAACAGGTGGATACTGG - Exonic
1040887564 8:52282549-52282571 CTACATACAGTGATGGAGGTTGG - Intronic
1042721436 8:71830867-71830889 GTACATAATCTGATGGTGCTAGG - Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1043068856 8:75612778-75612800 CTATATAAATAGATGGGGTTGGG - Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1047921525 8:129639596-129639618 CTACATAATCAGATGGCTCATGG + Intergenic
1048951277 8:139498909-139498931 CTACACACACAGATGGGGCAAGG - Intergenic
1055442151 9:76347183-76347205 CTACACAGAAAGATGCAGCTTGG - Intronic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1059569829 9:115422946-115422968 CGACATAAACTGATGGGCCTAGG + Intergenic
1062530244 9:136996511-136996533 CTTGACAAACAGCTGGAGCTTGG + Exonic
1186400435 X:9253712-9253734 CTACATAAAAAAATTTAGCTGGG + Intergenic
1190640697 X:52481203-52481225 CTACAGAAAATGATGGAGCAGGG + Intergenic
1190646975 X:52531662-52531684 CTACAGAAAATGATGGAGCAGGG - Intergenic
1195260125 X:103123646-103123668 CCACACAAACTGATGGAGCCCGG + Intergenic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic
1197055814 X:122117023-122117045 CTACATAAGCAGTATGAGCTTGG + Intergenic
1199374890 X:147096759-147096781 CTATATAAACAGAGTGAGCTTGG + Intergenic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201183059 Y:11368441-11368463 CAACATAAACATACAGAGCTGGG - Intergenic
1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG + Intergenic