ID: 1158251990

View in Genome Browser
Species Human (GRCh38)
Location 18:55499543-55499565
Sequence GACTGTACATTAGAATCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1510
Summary {0: 1, 1: 5, 2: 71, 3: 328, 4: 1105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158251987_1158251990 19 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251990 18:55499543-55499565 GACTGTACATTAGAATCAACTGG 0: 1
1: 5
2: 71
3: 328
4: 1105
1158251989_1158251990 12 Left 1158251989 18:55499508-55499530 CCATCTGTTTATGTAGGACAGAA 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1158251990 18:55499543-55499565 GACTGTACATTAGAATCAACTGG 0: 1
1: 5
2: 71
3: 328
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158251990 Original CRISPR GACTGTACATTAGAATCAAC TGG Intronic
900850922 1:5142384-5142406 GGCTGCACGTTAGAATCACCCGG - Intergenic
901135025 1:6987522-6987544 GACTGGACACTAGAATCATTTGG - Intronic
902056714 1:13606773-13606795 AACTCTAAATTAGAGTCAACAGG - Intronic
902785175 1:18728534-18728556 GGCTGCTCATTAGAATCACCCGG + Intronic
903000048 1:20258747-20258769 TGCTGCACATTAGAATCATCTGG + Intergenic
904485278 1:30820711-30820733 GCTTGCACATTAGAATCAACTGG - Intergenic
904827184 1:33281228-33281250 GGCTGCTCATTAGAATCATCTGG - Intronic
905093151 1:35446064-35446086 GACTGTAGATTAAATTCACCTGG + Intronic
905338146 1:37259570-37259592 GGCTGCACATTAGAATCACCTGG - Intergenic
905439462 1:37985385-37985407 TGCTGCACATTAGAATCACCTGG + Intronic
905807863 1:40889976-40889998 GAGTGTGCATCAGAATCATCTGG + Intergenic
906181580 1:43824768-43824790 GACTGCATATTGGAATCACCTGG + Exonic
906282572 1:44564429-44564451 GGCTGCACAATAGAATTAACTGG - Intronic
906562701 1:46770845-46770867 GGCTGCACATTTGAATCACCTGG - Intronic
907172124 1:52478106-52478128 GGCTGCACATTAGAATCATGTGG + Intronic
907183845 1:52594060-52594082 GACTGCACCTTAAAATCAGCTGG + Intergenic
907183867 1:52594182-52594204 GGCTGCACCTTAGAATCACCTGG - Intergenic
907482694 1:54755548-54755570 GACTGCACATTACAATCAGCTGG + Intergenic
907743528 1:57190085-57190107 GAGTGTGCATTAGAATCACCTGG + Intronic
907743979 1:57194123-57194145 GAGTGTGCATTAGAATCATCTGG + Intronic
907967053 1:59342135-59342157 GGCTGTGCATTAGTATCAACTGG + Intronic
908089370 1:60670218-60670240 GACTACACATTAGAATCACCTGG - Intergenic
908284916 1:62585962-62585984 GGCTGCACATTAGATTCACCTGG - Intronic
908570368 1:65403638-65403660 GATTGTGCATTAGAATTACCTGG - Intronic
909337782 1:74496025-74496047 GGCTGCACATTAGAATCATCTGG + Intronic
909600399 1:77455725-77455747 AGCTGCACATTAGAATCACCGGG + Intronic
909815491 1:79987407-79987429 GACTGTAAATTAAAATGATCTGG + Intergenic
910205776 1:84747615-84747637 GGCTGCAAATTAGAATCACCTGG + Intergenic
910260249 1:85287269-85287291 GGATCTGCATTAGAATCAACTGG - Intergenic
910405554 1:86886135-86886157 GACAGTACACTAGAATCACCTGG + Intronic
910659887 1:89660467-89660489 GGCTGCACATTGGAATCATCTGG - Intronic
911077285 1:93889434-93889456 GACTATACATTAGAATCACCTGG - Intronic
911112424 1:94204324-94204346 GAGTGCTCATCAGAATCAACTGG + Intronic
911112864 1:94210297-94210319 GGCTGCACATTAGAATTACCTGG + Intronic
911236260 1:95415578-95415600 TAGTGTGCATGAGAATCAACTGG + Intergenic
912109837 1:106328022-106328044 GACTGTAAATTGGAATCATCTGG + Intergenic
912262578 1:108123628-108123650 GGCTGAACATTAGAACCACCTGG - Intergenic
912322130 1:108723871-108723893 GACTGCATAGTAGAATCAACTGG - Intronic
912428416 1:109614603-109614625 GGCTGTACACTAGAATCAGCTGG - Exonic
912534321 1:110353538-110353560 GACTGCACGTTACAATCACCTGG - Intergenic
912672225 1:111641389-111641411 GGCTATACATTAGATTTAACTGG + Intronic
912750272 1:112281795-112281817 GGCTGTACATTAGAAATATCTGG + Intergenic
912788859 1:112631089-112631111 GGCTACACATTAGAATCACCTGG - Intronic
912842947 1:113054875-113054897 GTCTGCTCATTAGAATCACCTGG - Intergenic
913090964 1:115476251-115476273 GGCTGCACATTGGAATCACCTGG - Intergenic
913212501 1:116593247-116593269 GAATGTGCATCAGAATCAATTGG - Intronic
913235028 1:116773141-116773163 GACTATACATTACAACCAAGTGG + Intergenic
913312265 1:117512351-117512373 GAGTGTACATCAGAATCACCTGG + Intronic
913414658 1:118591613-118591635 GCCTGCACATTAAAATCATCTGG + Intergenic
913479623 1:119275203-119275225 AGCTATACATTGGAATCAACTGG + Intergenic
913691711 1:121285846-121285868 GGCTGTTCATTAGAATCACCTGG - Intronic
914145835 1:144994109-144994131 GGCTGTTCATTAGAATCACCTGG + Intronic
914390939 1:147222551-147222573 GTCTGCACATTGGAATCATCTGG + Intronic
914417464 1:147497078-147497100 GACTGCACATTGGAATCACCTGG + Intergenic
914865139 1:151420610-151420632 GAATGTATATTAGAATCAACCGG - Intronic
914903803 1:151727923-151727945 AGCTGTACATCAGAATCACCTGG + Intronic
914903825 1:151728043-151728065 GCCAGTCCATTAGAATCACCTGG - Intronic
914999251 1:152573140-152573162 GACTGTGCATCAGAATCACCTGG - Intronic
915306241 1:154981006-154981028 AAGTGTACATCAGAATCAGCTGG - Intergenic
915948530 1:160171934-160171956 CATTGAACATTAGAATCACCAGG + Intronic
916166326 1:161969963-161969985 TTCTGCACATTAGAATCACCTGG - Intergenic
916315201 1:163440955-163440977 AGCTGTATATTAGAATCACCTGG + Intergenic
916353863 1:163882564-163882586 GTCAGTACTTTAGAATCACCTGG - Intergenic
916422190 1:164647685-164647707 GGCTGAACATTAAAATCACCTGG + Intronic
916454284 1:164954439-164954461 GACTGAACACTGGAATCACCTGG + Intergenic
916466364 1:165078046-165078068 GGCTGTACATTAGAGTCACCTGG + Intergenic
916500541 1:165383387-165383409 GCCTGCACATTAGCATCACCTGG + Intergenic
916690439 1:167185115-167185137 GGCTGTGCATCAGAATCATCTGG - Intergenic
916811721 1:168311814-168311836 GGCTGTACATTACAGTCACCTGG + Intronic
917793809 1:178517498-178517520 GGCTGCACATTATAATCACCTGG + Intronic
918023491 1:180718563-180718585 GGTTGCACATTAGAATCACCTGG + Intronic
918063348 1:181081403-181081425 GGCTGTACGTTAGAATCACCTGG - Intergenic
918070998 1:181133317-181133339 GGCTGCACATTAGAATTACCTGG + Intergenic
918447873 1:184632864-184632886 GGCTGCACACTAGAATCACCTGG + Intergenic
918571551 1:185999357-185999379 GAGTGTATAATAGAATCAAAAGG - Intronic
919218978 1:194600780-194600802 GACTGCACATTAGAAGCACCTGG - Intergenic
919607821 1:199707460-199707482 GATTGCACATTAGACTCTACTGG - Intergenic
919968837 1:202557622-202557644 GGCTGTACAGCAGAATCACCTGG + Intronic
920248816 1:204608499-204608521 GGCTGTGCATTAGAATCACCTGG - Intergenic
920390140 1:205594879-205594901 GGCTGAACATTAAAATCACCTGG + Intronic
920479041 1:206304355-206304377 GGCTGTTCATTAGAATCACCTGG - Intronic
920611320 1:207440552-207440574 GACTGTACATTAGAATCACTTGG + Intergenic
920611347 1:207440885-207440907 GACAGTATATTAGAATCACTTGG - Intergenic
920690528 1:208143118-208143140 GGCTGCACATTAGAATCATCTGG + Intronic
920729473 1:208469472-208469494 TGCTGCACATTAGAATCACCTGG + Intergenic
920798593 1:209164631-209164653 TACTATACATGAGAATCACCTGG + Intergenic
921256728 1:213348117-213348139 CACTGAACATGAGAACCAACCGG + Intergenic
921478147 1:215634267-215634289 GGCTGCACATTAGAATCACCTGG - Intronic
921481195 1:215666521-215666543 GGCTGCACATGAGAATCACCTGG + Intronic
921562622 1:216676653-216676675 GAGTGTGCATTAAAATCATCTGG - Intronic
921660346 1:217793644-217793666 AACTGTGCATTTGAATCACCTGG - Intronic
921777721 1:219121851-219121873 TGCTGCACATTAGAATCAGCAGG + Intergenic
922346045 1:224697358-224697380 GGCTACACATTAGAATCATCTGG - Intronic
922369477 1:224895229-224895251 GGCTGTACATTGGGATCACCTGG + Intergenic
922530754 1:226343081-226343103 GGCTATACATTAGAATCACCTGG - Intergenic
923056765 1:230432371-230432393 GGCTGTACATTAGGATCACCTGG + Intergenic
923191255 1:231622910-231622932 CACTGTGCTTTAGAATCACCTGG + Intronic
923818950 1:237414285-237414307 GGTTGTATATTAGAATCACCTGG - Intronic
924159920 1:241220431-241220453 GGCTCTACATTAGAATTATCTGG - Intronic
924518552 1:244786255-244786277 GGCTGGATATTAGAATCACCTGG + Intergenic
924645801 1:245876384-245876406 GACTGTGCATTGGAATCACCTGG - Intronic
1063380054 10:5578734-5578756 GATTGTACATTAAAATGCACTGG - Intergenic
1063451289 10:6151945-6151967 GGCTTCACATTAGAATTAACTGG + Intronic
1063912624 10:10847811-10847833 GGCTGTCCATTAGAATCTCCAGG - Intergenic
1063987713 10:11523914-11523936 GCCTGCACATTAGAATCAGCTGG - Intronic
1064063881 10:12163844-12163866 GGCTGCACATTAGAATCACCTGG - Intronic
1064449008 10:15425118-15425140 GGCTGCACATTAGAATCAGCTGG + Intergenic
1064878946 10:20028274-20028296 GTCTGTGTATTAGAATCACCTGG - Intronic
1065111086 10:22440448-22440470 GGCTGTTCATTAGAATCTCCTGG - Intronic
1065809170 10:29425367-29425389 GGCTACACATTAGAATCATCTGG - Intergenic
1065851261 10:29791780-29791802 GAATGTGCATTAGAATCACCTGG - Intergenic
1066260084 10:33721050-33721072 GACTGTACATGAGAATCATCTGG - Intergenic
1066371752 10:34823446-34823468 CACTGTGCATTAGAGTCACCAGG - Intergenic
1066501819 10:36002309-36002331 GACTGCATATTAGAATCAACTGG + Intergenic
1067284543 10:44898090-44898112 GGCTGCACATTAATATCAACTGG - Intergenic
1067766655 10:49092165-49092187 TACTGTGCAGAAGAATCAACTGG + Intronic
1067798171 10:49335828-49335850 GGCTGTAGATTAGAATCCACAGG - Intergenic
1067957168 10:50804950-50804972 GGCTGTACATTAGAATCTCCTGG - Exonic
1067959551 10:50833042-50833064 GACTGAAGAATAGAATCATCTGG + Intronic
1068943569 10:62705474-62705496 AGCTGTAAATTAGAATCACCTGG + Intergenic
1069037017 10:63656236-63656258 GACTGCACATTAGAAACACCTGG + Intergenic
1069874451 10:71553133-71553155 GGCTGCATATTAGAATCACCTGG - Intronic
1070292820 10:75131870-75131892 CACTGTGCATTAGAATCACGTGG + Intronic
1070507647 10:77128465-77128487 GACTGTACATTTAAATCACCTGG + Intronic
1070562070 10:77575664-77575686 GGCTGCACATTAGGATCACCCGG + Intronic
1070590876 10:77800158-77800180 CACTGTGCATTAGAATTAGCTGG + Intronic
1070644097 10:78189451-78189473 TGCTGTACATGAGAATCACCTGG - Intergenic
1070873019 10:79774564-79774586 GGCTGCACATTAGAATCACCTGG + Intergenic
1071092004 10:81929819-81929841 GACCACACATTAGAATCATCTGG - Intronic
1071267695 10:83978932-83978954 GTCTGCACATTAGAATCACCTGG + Intergenic
1071267708 10:83979054-83979076 GTCTGTACATTGGAATCATCTGG - Intergenic
1071278726 10:84080020-84080042 GAGTGTGCATCAGAATCACCTGG + Intergenic
1071444187 10:85730697-85730719 GGCTGTGCATTAGAATCACCTGG - Intronic
1071639945 10:87296715-87296737 GGCTGCACATTAGAATCACCTGG + Intergenic
1071655289 10:87441234-87441256 GGCTGCACATTAGAATCACCTGG - Intergenic
1071780586 10:88839958-88839980 CACTGTGCATCAGAATCACCAGG - Intronic
1072043442 10:91631403-91631425 GTCTGGTCATTAGAATCACCTGG - Intronic
1072327195 10:94310371-94310393 CACTGTACATTTGTATCACCTGG + Intronic
1072398279 10:95068221-95068243 GACTGGGCATTAGAATCACCTGG - Intronic
1072478900 10:95791708-95791730 GGCTGTACATTAGAATCACCCGG + Intronic
1072501381 10:96021511-96021533 GGCTGCACATTGGCATCAACTGG - Intronic
1072546194 10:96441390-96441412 GGCTGCACATTAGATTCAACTGG + Intronic
1072547455 10:96450463-96450485 GGCTGTACCATAGAATCACCTGG - Intronic
1072751130 10:97979678-97979700 GGCTGCACTTTAGAATCACCTGG + Intronic
1072755078 10:98014352-98014374 GGCTGTGCATTGGAATCATCTGG + Intronic
1072819101 10:98538562-98538584 TACTGTACACTGGAATCATCTGG + Intronic
1072935754 10:99711587-99711609 GTCTGCACATTGGAATCACCTGG + Intronic
1073117718 10:101101197-101101219 GGCTGCACATTAGAATCACCTGG - Intronic
1073151936 10:101317606-101317628 GGCTACACATTAGAATCAGCTGG - Intergenic
1073257774 10:102165153-102165175 ACCTGTTCATTAGAATCATCTGG - Intergenic
1073397686 10:103231513-103231535 GGCTGAACATTAGAATCACCAGG + Intergenic
1073485292 10:103813824-103813846 GGCTGTACATTACAATCACCTGG + Intronic
1073591623 10:104763011-104763033 GGCTGTACATCACACTCAACTGG - Intronic
1073619159 10:105029094-105029116 GCCTCTGCATTAGAATCAGCTGG + Intronic
1073817135 10:107220244-107220266 GGCTGCAGATTAGAATCACCAGG - Intergenic
1073956800 10:108882061-108882083 GGCTTTATATTATAATCAACAGG - Intergenic
1074007753 10:109445636-109445658 GGCTGCACATTAGAATCAACTGG - Intergenic
1074061241 10:109967844-109967866 GGCTGTACTTCAGAATCACCTGG - Intergenic
1074084401 10:110196887-110196909 GCCTGTACATCAGAATCACTTGG - Intergenic
1074538922 10:114348836-114348858 GGCTGTGCATTAGACTCACCTGG - Intronic
1074558088 10:114510203-114510225 CTCTGTGCATTAGAATCAACAGG + Intronic
1074585431 10:114763796-114763818 GCCTGTACATAAGAAATAACTGG + Intergenic
1074718527 10:116243710-116243732 GGCTGTACACTGGAATCAAATGG - Intronic
1074796754 10:116953954-116953976 GACTGCACATCAGAATCATGTGG - Intronic
1074796943 10:116956258-116956280 TGATGTACATTAGAATCACCTGG - Intronic
1074799364 10:116983781-116983803 GGCTGTACATTGGAATTACCTGG - Intronic
1074911165 10:117910376-117910398 GGCTGCACATTAGAATCTCCTGG + Intergenic
1075050036 10:119176822-119176844 GGCTGCACGTTAGAATCACCCGG + Intronic
1075082996 10:119396440-119396462 GACTGCACATCAGAATCAGCAGG - Intronic
1075130799 10:119737406-119737428 GGCTGTACAGTAGAATCACCAGG + Intronic
1075229737 10:120665438-120665460 GACTGTGCATTAGAATCTTTGGG - Intergenic
1075425269 10:122337203-122337225 GATTGCACATCAGAATCACCTGG + Intronic
1075429560 10:122369156-122369178 TACTGCACATTAGAATCATTGGG + Intergenic
1075690605 10:124391513-124391535 GACTGCACATTAGAATCCCCAGG + Intergenic
1075699114 10:124457161-124457183 TAATGTGCATTAGAATCACCTGG - Intergenic
1075747583 10:124738383-124738405 GGCTGCACATTAGAGTCACCTGG - Intronic
1075848428 10:125566341-125566363 GACTACACAATAGAATCACCTGG - Intergenic
1075904376 10:126068005-126068027 GTCTGTATAATAGAATCAAATGG - Intronic
1075926607 10:126256165-126256187 GCTTGGACATTAGAATCACCTGG - Intronic
1076427220 10:130375852-130375874 GACTGTGCATCAGAATCACCTGG - Intergenic
1076429761 10:130393557-130393579 GGCTCCACATTAGAATCACCTGG - Intergenic
1078061606 11:8049414-8049436 GCCTGGACATCAGAATCACCTGG - Intronic
1078270912 11:9793797-9793819 GACTGAACATTAGAATCACCTGG - Intronic
1078279326 11:9884125-9884147 TGCTGCACATTAGAATCACCTGG - Intronic
1078350878 11:10592162-10592184 GGCTGCACATTAGAATCACCTGG + Intronic
1078378105 11:10813629-10813651 GGCTGCACATTAGAATCACCTGG + Intronic
1078432811 11:11300859-11300881 GGTTGCACATTAGAATCACCTGG - Intronic
1078525319 11:12096557-12096579 TGCTGAACATTAGAATCACCTGG - Intronic
1078639306 11:13080420-13080442 GGCTGCATATTAGAATCACCTGG + Intergenic
1079010348 11:16822899-16822921 GGCTGCACATTGGAATCACCTGG - Intronic
1079070936 11:17346334-17346356 GTCTGCATATTAGAATCACCTGG - Intronic
1079219874 11:18550931-18550953 GGCTGTGCATCAGAATCATCTGG - Intronic
1079239298 11:18711243-18711265 GGCTATACATTAGAATCACTTGG - Intronic
1079352531 11:19703898-19703920 GGCTTTACATTAGAGTCACCTGG - Intronic
1079469470 11:20764673-20764695 CACTGTGCATCAGAATCACCTGG - Intronic
1079505801 11:21150645-21150667 GTCTGTACATTTGAATCATCTGG + Intronic
1079551819 11:21708917-21708939 GGCTGCACATTAAAATCACCTGG - Intergenic
1079631880 11:22687435-22687457 TGCTGCACATTAGAATCACCTGG - Intronic
1080241762 11:30134906-30134928 GACTTTACATTAGTATAATCAGG - Intergenic
1080299204 11:30765496-30765518 GACTGAACAGTAGAATCACCTGG - Intergenic
1080421798 11:32117379-32117401 GTGTGTACATCAGAATCACCTGG - Intergenic
1080476221 11:32594077-32594099 GTATCTACATTAGAATCACCAGG - Intronic
1081135255 11:39432371-39432393 TACAGTACATTGGAATCAACTGG - Intergenic
1081451343 11:43173300-43173322 GGCTGCACATTAAAATCACCTGG - Intergenic
1081631541 11:44693064-44693086 GCCTGATCACTAGAATCAACTGG + Intergenic
1081685483 11:45039918-45039940 CAATGTGCATTAGAATCACCTGG - Intergenic
1081855463 11:46300506-46300528 GAGTGTGCATCAGAATCACCTGG - Intronic
1082700242 11:56420561-56420583 GGTTGTACATTAGAATCACTTGG - Intergenic
1082771325 11:57210058-57210080 GGCTACACATTAGAATCACCTGG + Intergenic
1082819061 11:57531264-57531286 GGCTGTACATACGAATCACCTGG - Intergenic
1082895711 11:58187976-58187998 CACTGCACATTAGAATCACCTGG - Intergenic
1083100572 11:60301407-60301429 GAGTCTACATTATAATCAATGGG - Intronic
1085147970 11:74220367-74220389 GGGTATACATTAGAATCACCTGG + Intronic
1085755362 11:79197317-79197339 GGCTGCTCATTAGAATCACCTGG + Intronic
1085755532 11:79198419-79198441 GACTGCTCATTAGAATCACCTGG - Intronic
1085783288 11:79428906-79428928 TGCTGTACCTTAGAATCACCTGG + Intronic
1085982261 11:81738486-81738508 AAATGCACATTAGAATCTACTGG + Intergenic
1086720744 11:90118146-90118168 GACCTCACATTAGAATCACCTGG - Intergenic
1086843175 11:91714511-91714533 GAGTGTACATTAGAGTCACTTGG - Intergenic
1086866262 11:91983576-91983598 GGCTGTGCATTAGAATGACCTGG - Intergenic
1087070568 11:94075792-94075814 GGCTGCACATTGGAATCATCTGG - Intronic
1087138921 11:94746650-94746672 GGCTGCACATTAGAATCAGGAGG + Intronic
1087177282 11:95107390-95107412 GGCTGCACATCAGAATCACCTGG - Intronic
1087531516 11:99387976-99387998 GGCTGCACACTGGAATCAACTGG - Intronic
1087737167 11:101847404-101847426 TACTGTCTATTAGAATCATCTGG - Intronic
1087787145 11:102367988-102368010 GACTATACATCAGAATCATTTGG + Intronic
1088158987 11:106845117-106845139 GGCTGTACATTAGAATCACCTGG + Intronic
1088584283 11:111347149-111347171 GGCTGCACATTAGAATCACTTGG - Intergenic
1088740081 11:112760190-112760212 GGCTGCTCATTAGAATCATCTGG - Intergenic
1088756388 11:112888769-112888791 GACTGCCCATTAAAATCAGCTGG - Intergenic
1089182526 11:116592983-116593005 GATTGTACTTTAGAATCACCTGG - Intergenic
1089860597 11:121586917-121586939 GACTGCACAGTAGAATCACCAGG - Intronic
1089946072 11:122475302-122475324 GACTTTATATTGGAATCATCTGG - Intergenic
1090460047 11:126882928-126882950 GACTGTGCAGTAGAGACAACAGG + Intronic
1090470387 11:126975760-126975782 TATTGTGCATGAGAATCAACTGG - Intronic
1090964647 11:131587748-131587770 GACTGTGCATCAGAAACAACTGG + Intronic
1091059202 11:132445693-132445715 GACTGTACATTAGAGTCCCCTGG - Intronic
1091181950 11:133613203-133613225 GGCTGCATATTAGAATCAAATGG - Intergenic
1091504087 12:1049510-1049532 GACTTCACATTAGAATGACCTGG - Intronic
1091638601 12:2216617-2216639 GTCTGTACAGTAGAATAATCTGG + Intronic
1091661311 12:2385780-2385802 GGGTGTATATTAGAATCACCTGG + Intronic
1092279369 12:7088213-7088235 GGCTGTGCATTAGAATCACCTGG + Intronic
1092918453 12:13209125-13209147 GTTTGTAAATTAGAAGCAACAGG + Intronic
1092954539 12:13537664-13537686 GGCTGTATATTAAAATCACCTGG + Exonic
1092984733 12:13834809-13834831 TTCTGTATATTAGAGTCAACTGG + Intronic
1093818347 12:23578414-23578436 GAGTGTGCATCAGAATCACCTGG - Intronic
1094094089 12:26684398-26684420 GACTGTAAATTAGAACCACCTGG - Intronic
1094182546 12:27607497-27607519 GAGTGCACATTAGAATCACCTGG + Intronic
1094487650 12:30937813-30937835 AAGGGTACATTAGAATCACCTGG - Intronic
1094625455 12:32119371-32119393 GACTGTATGTTAGAATCACCTGG + Intronic
1095189515 12:39240536-39240558 TAGTGTACATTAGAATTACCTGG + Intergenic
1095324716 12:40875069-40875091 GTCTGCACATTAGGATCATCTGG + Intronic
1095675832 12:44917115-44917137 GGCTGCACATTAGAATCACTTGG - Intronic
1095725780 12:45451249-45451271 GACTGTACATTATGATCAAGTGG + Intergenic
1096254619 12:50055483-50055505 GGCTGCACATTCGAATCACCTGG - Intergenic
1096332827 12:50729372-50729394 GTATGTACATAAGAATCACCTGG + Intronic
1096585529 12:52617321-52617343 GAGTGTACATCAGCATCACCTGG + Intronic
1096857644 12:54496452-54496474 GAGTGTGCATTGGAATCACCTGG + Intergenic
1097235614 12:57537438-57537460 GGCTGTAGGTTAGAATCACCTGG - Intronic
1097510877 12:60538076-60538098 TACAGTACATTAGAACCAAAGGG + Intergenic
1097686465 12:62695686-62695708 GGCTGCACATTGGAATCACCTGG - Intronic
1097695973 12:62775231-62775253 GCCTGTACATCAGAATCACCTGG - Intronic
1097750677 12:63348991-63349013 GACTGCACATCAGAATCACCTGG - Intergenic
1097910745 12:64966520-64966542 GACCATACATTAGAATCCCCTGG + Intergenic
1098057134 12:66519708-66519730 TGGTGTACATTAGTATCAACTGG + Intronic
1098147977 12:67517057-67517079 GGCTGTACATTAGAATCACCTGG + Intergenic
1098426436 12:70370016-70370038 GGCTGTACCTTAGAATCACCAGG + Intronic
1098682112 12:73369426-73369448 GAAAGTACATTAGAATTACCTGG - Intergenic
1098782610 12:74705977-74705999 GGCTGCACATTTTAATCAACTGG + Intergenic
1098908350 12:76184119-76184141 GACTGCACATTAGAATTATCTGG - Intergenic
1099617308 12:84953231-84953253 GACGGCACATTAGAATGAGCAGG + Intergenic
1100097067 12:91053642-91053664 GAGTGTGCATCAGAATCACCTGG - Intronic
1100197349 12:92262087-92262109 CAGTGTACATAAGAATCACCTGG - Intergenic
1100557146 12:95706856-95706878 TACTGTGCATCAGAATCACCTGG + Intronic
1100698855 12:97124720-97124742 GGCTACACATTAGAATCACCTGG + Intergenic
1100703018 12:97167844-97167866 AACTGCACATTAGAATCGCCTGG + Intergenic
1100759690 12:97793454-97793476 CACTGTACATTAAAATCATTTGG - Intergenic
1100780865 12:98024804-98024826 CACTGCCCATTAGAATCACCTGG + Intergenic
1101076228 12:101132423-101132445 TACCATACATTAGAATCACCTGG + Intergenic
1101156770 12:101935152-101935174 GGCTGCACATGAGAATCACCTGG + Intronic
1101518060 12:105455350-105455372 AGCTGCACATTAGAATCACCTGG - Intergenic
1101555086 12:105801399-105801421 GAGTGTACATCAGAATCTTCTGG - Intergenic
1101615206 12:106329500-106329522 GACTACAAATTAGAATCATCTGG + Intronic
1101759049 12:107644302-107644324 AGCTGCACATTAGAATCACCTGG + Intronic
1101795198 12:107966611-107966633 GACTGCACATTAGAATCACTGGG + Intergenic
1101799995 12:108013399-108013421 GGCTGCACATTAGAATTACCTGG - Intergenic
1101811495 12:108111818-108111840 GACTGCAAATTGGAATCACCTGG + Intergenic
1101939901 12:109092108-109092130 GACTGCCCATGAGAATCACCTGG + Intronic
1102075118 12:110053520-110053542 GGCTATGCATTAGAATCAGCTGG - Intronic
1102527378 12:113521481-113521503 GCCTGCACATTAGAATCACCTGG + Intergenic
1102712232 12:114938462-114938484 GACTGCATATTGGAATCACCAGG - Intergenic
1102795098 12:115682343-115682365 GGTTGTACAATAGAATCACCTGG + Intergenic
1102982472 12:117253098-117253120 GACTGCACGTTAGAGTCAATTGG + Intronic
1103065858 12:117896856-117896878 GACTCCATATTAGAATCACCTGG - Intronic
1103075851 12:117981990-117982012 GGCTACACATTAGAATCACCGGG - Intergenic
1103187469 12:118972038-118972060 GACTGTGTATTAAAGTCAACTGG - Intergenic
1103312041 12:120018107-120018129 GATTGCATATTAGAATCACCTGG + Intronic
1103319938 12:120086519-120086541 GACTACACATTAAAATCAAGGGG - Intronic
1104080180 12:125423115-125423137 GGCTGCACATTAAAATCACCTGG - Intronic
1104157741 12:126149759-126149781 GACGGCACATCAGAATCAAGAGG - Intergenic
1104203246 12:126612786-126612808 GTCTATACATTAGAATAATCAGG - Intergenic
1104396975 12:128442390-128442412 GACTATTCATTAGAACCATCTGG + Intronic
1104473814 12:129053847-129053869 GGCTGTACATCAGAATCAACTGG + Intergenic
1104495369 12:129232043-129232065 AGCTGTACATTGGAATCACCTGG + Intronic
1105215745 13:18283868-18283890 GAATGTGCATCAGAATCAATTGG - Intergenic
1105397501 13:20053291-20053313 GACTACTCATTAGAATCACCTGG + Intronic
1105486882 13:20842221-20842243 CACTGTATATTACTATCAACGGG + Intronic
1105999244 13:25704225-25704247 GACTGCTGTTTAGAATCAACAGG - Intronic
1106303113 13:28487210-28487232 GGCTCTACATTAGAATAATCTGG - Intronic
1106415745 13:29544559-29544581 GGTTGCACATTAGAATCATCTGG + Intronic
1106729627 13:32526700-32526722 GACTATACATCAGAATCGTCTGG + Intronic
1106931040 13:34665741-34665763 GGCTGCACATGAGAATCAGCAGG + Intergenic
1107261294 13:38494527-38494549 GTCTGTATATTAGAATCACCAGG - Intergenic
1107399024 13:40050115-40050137 CACTGTGCATAAGAATCACCTGG - Intergenic
1107431752 13:40346500-40346522 GACAGTACATAAGAATCACCTGG - Intergenic
1107584620 13:41831508-41831530 GACTGTACGTTAGAATCTTCTGG + Intronic
1107696311 13:43003701-43003723 GGCTATACTTTGGAATCAACTGG + Intergenic
1107705062 13:43094437-43094459 TAGTGTACATTAGAATCAACTGG - Intronic
1107726982 13:43308741-43308763 GTCTGCACATGAGAATCACCTGG - Intronic
1108020296 13:46121233-46121255 GGCTGCACATTAGAGTCATCTGG + Intergenic
1108033844 13:46265985-46266007 GACTGTAAATGAGAATCCAGAGG + Intronic
1108094846 13:46890856-46890878 GACTGCCCCTTAGAATCACCTGG + Intronic
1108107402 13:47026489-47026511 GGCTGCACATCAGAATCAGCTGG + Intergenic
1108490470 13:50976401-50976423 GGCTGCACATTGGAATCACCTGG + Intergenic
1108598341 13:51969153-51969175 CCCTGTACATTAGGATCACCTGG - Intronic
1108675412 13:52733617-52733639 GGCTGTACTTTAGAAGCATCTGG + Intronic
1108710688 13:53029411-53029433 GACTATATATTAGAATCACCTGG - Intronic
1109006954 13:56890123-56890145 GACTTTATATGAGAGTCAACTGG - Intergenic
1109441006 13:62374429-62374451 GAATGTACCTTAGAATCATGAGG + Intergenic
1109766382 13:66905388-66905410 GACTGTATATTAGAATCACCTGG + Intronic
1109879587 13:68453408-68453430 GCCTGTACATTAGAAGCAATTGG + Intergenic
1110246260 13:73327696-73327718 GAATGCACAATAGAATCACCTGG + Intergenic
1110568048 13:76976072-76976094 GTCTGCACATGAGAATCATCTGG + Intergenic
1110568063 13:76976179-76976201 GGCTGCACATTGGAATCACCTGG - Intergenic
1110843905 13:80172347-80172369 GATGGCACATTAGAATCAGCTGG + Intergenic
1111539612 13:89653616-89653638 ATCTGTACATTAGAAATAACTGG + Intergenic
1111826891 13:93279157-93279179 GAGTGTGCATCAGAATCACCTGG + Intronic
1111857079 13:93651812-93651834 GGCTGCACATTAGAATCACCTGG + Intronic
1111857933 13:93662963-93662985 GGCTGTATATTAGAATCACCTGG - Intronic
1111912777 13:94330361-94330383 GACTGTACATGAAAATTACCTGG + Intronic
1111979469 13:95001946-95001968 GGCTGCACATTAGAATCAGCTGG - Intergenic
1112131620 13:96530862-96530884 TAATGTGCATTAGAATCACCTGG + Intronic
1112441656 13:99428517-99428539 GGCTGCACATTGGAATCACCTGG - Intergenic
1112607092 13:100917169-100917191 AGCTGCACATTAAAATCAACTGG + Intergenic
1112747084 13:102538600-102538622 TAGTGTACATCAGAATCACCTGG + Intergenic
1112937050 13:104813992-104814014 GATTCTACATTAGAACAAACAGG - Intergenic
1113200338 13:107860434-107860456 GGCTGCACATCAGAATCACCAGG + Intronic
1113331358 13:109330944-109330966 CACTGTACATTAGAACCACCTGG - Intergenic
1114513806 14:23284879-23284901 GACTGCACACTAGAATTACCTGG + Intronic
1114612172 14:24050078-24050100 GGATGCACATTAGAATCACCTGG + Intergenic
1114790858 14:25656809-25656831 GGCTATACATTAGAGTCACCTGG + Intergenic
1114830036 14:26129338-26129360 CACTGTAAACTAGAATAAACAGG - Intergenic
1115202668 14:30871384-30871406 GACTGCACATTAGAATCACCTGG + Intergenic
1115269475 14:31535934-31535956 GGCTATACATTAGAGTCAAGTGG + Intronic
1115370748 14:32611358-32611380 TCCTGTACTTTAGAATCACCTGG - Intronic
1115490964 14:33957692-33957714 TACTGGCCATTAGAATCACCTGG + Intronic
1115535335 14:34367493-34367515 AACTGTACATTACAATCATGTGG - Intronic
1115954364 14:38761597-38761619 GGCTGTTCATTAGAATTACCTGG - Intergenic
1116024568 14:39499292-39499314 GGTTGTACATTAGAATCATCTGG - Intergenic
1116524968 14:45892578-45892600 GGCTGCACATTGGAATCACCTGG - Intergenic
1116784924 14:49277157-49277179 GGCTACACATTAGAATCACCTGG + Intergenic
1117006722 14:51428216-51428238 GACTATGCATTAGAATCACCTGG + Intergenic
1117006871 14:51429362-51429384 GGTTGCACATTAGAATCACCTGG - Intergenic
1117045629 14:51810534-51810556 GCCTGAACATTAGAATCACCTGG + Intergenic
1117045715 14:51811177-51811199 GTCTGCACATCAGAATCACCTGG - Intergenic
1117342304 14:54802941-54802963 GGCTGCCCATTAGAATCACCTGG - Intergenic
1117526198 14:56607820-56607842 AACTGCACATTAAAATCACCTGG - Intronic
1117583007 14:57171869-57171891 GGCTGCACATTGGAATCACCAGG + Intergenic
1117584383 14:57185343-57185365 TTCTGCACATTAGAATCACCTGG + Intergenic
1117659567 14:57989361-57989383 GAGTGTGCATTAAAATCACCTGG - Intergenic
1117818950 14:59628320-59628342 GTCTGCCCATTAGAATCACCTGG - Intronic
1118132580 14:62983682-62983704 GGCTATATATTAGAATCATCTGG + Intronic
1118132594 14:62983811-62983833 GGCTGTACATTGTAATCACCTGG - Intronic
1118138142 14:63050264-63050286 GACTGCACATTACAGTCACCTGG + Intronic
1118483757 14:66194733-66194755 AACTGTACATTAAAAACAATAGG + Intergenic
1118573220 14:67215083-67215105 GAGTGTGCATTAGAATCACTTGG - Intronic
1118639257 14:67777208-67777230 GACAATATATTAGAATCACCTGG - Intronic
1118699067 14:68415202-68415224 GGCTGCACATTAGAATCACATGG - Intronic
1118882486 14:69841321-69841343 GGCTGTGCATTAGAATCACCTGG + Intergenic
1119119008 14:72055673-72055695 GACTGCACGTTAGAATCACCTGG - Intronic
1119131837 14:72179885-72179907 CAATGTGCATTAGAATCATCTGG - Intronic
1119238535 14:73039875-73039897 GGCTGCACATTAGAATCATCTGG - Intergenic
1119578866 14:75756035-75756057 GACTTTACATTATAATTACCTGG - Intronic
1119600904 14:75976219-75976241 GGCTGCACATTAGAATCACCTGG + Intronic
1119600919 14:75976337-75976359 GGCTGCACGTTAGAATCATCTGG - Intronic
1119781294 14:77278208-77278230 GGCTGCACATTAGGATCACCTGG + Intronic
1119887292 14:78153630-78153652 CTCTGCACATTAGAATCACCTGG + Intergenic
1119912120 14:78359210-78359232 GGCTGCACATTGGAATCAATGGG + Intronic
1119912138 14:78359333-78359355 GGCTGTACATTAGAATCACCTGG - Intronic
1119921905 14:78454512-78454534 GGCTACACATTAGAATCACCTGG - Intronic
1119924405 14:78479137-78479159 GGCTACACATTAGAATCACCTGG + Intronic
1120004282 14:79339335-79339357 GAATGTACATCAGAATCCCCAGG + Intronic
1120567971 14:86082675-86082697 TACTATGCATTAGAATCACCTGG - Intergenic
1121165396 14:91791315-91791337 GGGTATACATTAGAATCATCTGG - Intronic
1121178436 14:91908680-91908702 GACTGTACATTTGAATCACCTGG + Intronic
1121205160 14:92158622-92158644 GACTGCACATAAGAATCATCTGG + Intronic
1121225467 14:92318703-92318725 GGCTGCACATTTGAATCACCTGG - Intergenic
1121944225 14:98103757-98103779 CTCTGTACATCAGAATCACCTGG - Intergenic
1122046255 14:99026086-99026108 GGCTGCATATTAGAATCATCTGG - Intergenic
1122748067 14:103911435-103911457 GAGAGTGCATTAGAATCACCTGG - Intergenic
1123905820 15:24920398-24920420 GAGTGTGCATTAGTATCACCTGG + Intronic
1123978491 15:25576433-25576455 AACTGTACATTAAAATTAATTGG + Intergenic
1124249653 15:28098563-28098585 CACTGCACATTAGAGTCACCTGG + Intronic
1124252804 15:28117887-28117909 GGCTGTGCATCAGAATCATCTGG + Intronic
1124358626 15:29018056-29018078 GGCTGCACATTAGCATCACCTGG + Intronic
1124449885 15:29778352-29778374 GGCTGCTCATTAGAATCACCTGG - Intronic
1124868711 15:33519537-33519559 GACTGTGCATTTGAATTACCTGG + Intronic
1124906022 15:33869235-33869257 GTTTGCACATTAGAATCACCTGG - Intronic
1125005419 15:34811330-34811352 GACTGAACATTAGAATTTCCTGG - Intergenic
1125487297 15:40120991-40121013 GACTGCACATTAGAATTACTGGG + Intergenic
1125644259 15:41258384-41258406 GAATATAAATTAGAATAAACTGG - Intronic
1125723418 15:41856144-41856166 GGCTTTACATGAGAATCACCTGG - Intronic
1125824217 15:42661857-42661879 TCCTATACATTAGAATCACCTGG - Intronic
1125882361 15:43205757-43205779 TGCTGCACATTAGAATCACCTGG - Intronic
1125904650 15:43379818-43379840 TACTGTGCATTAGAATCACCTGG + Intronic
1125907069 15:43402635-43402657 GGCTGCACATTGGAATCATCGGG + Intronic
1126193221 15:45900980-45901002 GACTGTATATTAGAATCACCTGG + Intergenic
1126197475 15:45948375-45948397 TAGTGTACACTAGAATCACCTGG - Intergenic
1126354734 15:47783188-47783210 GGTTGTACATTAGAATCATCTGG + Intergenic
1126456657 15:48869818-48869840 TACTTTAAATTAGAATCAACAGG + Intronic
1126462812 15:48931212-48931234 GACTGCATATTAGAATCACTTGG + Intronic
1126580704 15:50240156-50240178 CCCTGCACATTAGAATCATCTGG + Intergenic
1126804257 15:52330094-52330116 GGCTGCACATTAGAATCACCTGG - Intronic
1126847779 15:52777306-52777328 GAATTTATATTAGAATCACCGGG + Intronic
1126927765 15:53609658-53609680 GGCTGCATATTAGAATCACCTGG + Intronic
1126994177 15:54420955-54420977 GATTATACATTAGAATCACCAGG + Intronic
1127015974 15:54688564-54688586 GGCTACACATTAGAATCAACTGG + Intergenic
1127041048 15:54977177-54977199 GAATGTACATTAGAATGACCTGG + Intergenic
1127147344 15:56037801-56037823 GACTGCACATTAGAATTACCTGG - Intergenic
1127325090 15:57886980-57887002 GACTGTACATTGGGATCACCTGG + Intergenic
1127499450 15:59542973-59542995 GGCTGCACATTAGAATCACCTGG - Intergenic
1127663264 15:61120108-61120130 GGCTGCCCATTAGAATCATCTGG + Intronic
1127675857 15:61238225-61238247 GAGTGTGCATCAGAATCATCAGG - Intergenic
1127710200 15:61589488-61589510 TAGTGTACATCAGAATCACCTGG - Intergenic
1127791383 15:62401610-62401632 GGCTGCACATTAGAATCACATGG - Intronic
1127825588 15:62699885-62699907 GACTGGCCATTAGAATCACCTGG - Intronic
1127830936 15:62750656-62750678 GACGGTGCATCAGAATCACCTGG + Intronic
1127860084 15:62986715-62986737 GACTGCACATCAAAATCAGCTGG - Intergenic
1127896648 15:63306069-63306091 GGCTGCACATCAGAATCACCTGG - Exonic
1128015627 15:64342826-64342848 GAGTGTACATCAGAATCATCTGG + Intronic
1128114412 15:65096344-65096366 GGGTGCACATTAGAATCACCTGG - Intronic
1128229758 15:66026135-66026157 GGCTGCACATTAGAATCACCTGG - Intronic
1128250193 15:66158549-66158571 GGCTGCACATCAGAATCATCTGG + Intronic
1128513796 15:68329409-68329431 GACTGCCCATTAGGATCACCAGG - Intronic
1128698824 15:69789137-69789159 GACTTCAAATTAGAATCACCTGG - Intergenic
1128730558 15:70017951-70017973 GACTCCACATTAGAATCCTCTGG - Intergenic
1129184103 15:73895147-73895169 GACCGTACTTTAGAACCACCTGG - Intergenic
1129444042 15:75603687-75603709 GACTGTATGTTAAAATCAGCTGG - Intronic
1129894542 15:79093583-79093605 GGCTGCACATCAGAATCACCTGG + Intergenic
1130380459 15:83367757-83367779 GCCTGCACATTAGAATCCCCTGG - Intergenic
1130446222 15:84004338-84004360 GGCTGCACATTAGAATCTTCTGG - Intronic
1130665054 15:85862465-85862487 AATTGCACATTAGATTCAACTGG - Intergenic
1130690910 15:86080652-86080674 GTCTGCACATTAGAATCACCTGG + Intergenic
1130764143 15:86852847-86852869 GGTTGCATATTAGAATCAACTGG + Intronic
1130875295 15:88008532-88008554 GAATCTGCATTGGAATCAACCGG - Intronic
1131029191 15:89172045-89172067 GATTGCACATTAGAATCACCTGG - Intronic
1131200653 15:90393077-90393099 GTGTGTGCATTAGAATCACCTGG + Intronic
1131428441 15:92366659-92366681 GGCTGCACATTAGAATCATTTGG + Intergenic
1131547429 15:93327649-93327671 GTCTGTGCATTACAATCACCTGG + Intergenic
1132008819 15:98256023-98256045 GGTTGTACATTAGAATCTCCTGG - Intergenic
1132131459 15:99284237-99284259 GACTGCACATTAGAATCACCAGG - Intronic
1132250035 15:100329126-100329148 GGCTGTACCTTAGCATCACCTGG - Intronic
1133824050 16:9261303-9261325 GGCTGCACATTAAAATCACCTGG - Intergenic
1133851086 16:9504564-9504586 GACAGTTCACCAGAATCAACTGG + Intergenic
1133985402 16:10664523-10664545 GGCTGTGCATTAGAGTCACCTGG + Intronic
1134291456 16:12905041-12905063 GGCTGCACATTAGCATCACCTGG - Intronic
1134365459 16:13573195-13573217 GATTGTACATTGGAATCACGTGG - Intergenic
1134536520 16:15030859-15030881 CACTGCACATTAGAGTCATCCGG + Intronic
1134686642 16:16163493-16163515 GGCTGTCCCTTAGAATCATCTGG - Intronic
1134908186 16:18000104-18000126 GGCTGGATATTAGAATCATCAGG + Intergenic
1135126018 16:19809956-19809978 GACTGTACATTAGAAACACCAGG + Intronic
1135200393 16:20432183-20432205 GGCTGTGCATTAGAAACACCTGG + Intronic
1135258642 16:20962411-20962433 GGCTGCACATTGGAATCACCTGG - Intronic
1135270247 16:21063167-21063189 GGCTGCACTTTAGAATCACCTGG + Intronic
1135351503 16:21733336-21733358 AGCTGCACATTAGAATCACCTGG + Intronic
1135449985 16:22549464-22549486 AGCTGCACATTAGAATCACCTGG + Intergenic
1135478469 16:22799629-22799651 GGCTGCACATTAGAATCACCTGG - Intergenic
1135498784 16:22975779-22975801 GGCTGCACATAAGAATCAACCGG - Intergenic
1135672987 16:24390808-24390830 GGCTGCCCATTAGAATCACCTGG + Intergenic
1135889902 16:26347687-26347709 GGCTGCTCATTAGAATCACCAGG + Intergenic
1135897169 16:26418051-26418073 GATTAAACATTAGAATCAAATGG + Intergenic
1135969854 16:27064438-27064460 GACTGCACGTTAGAATTACCTGG + Intergenic
1135984587 16:27174690-27174712 GACTGCGCATTTGAATCACCTGG - Intergenic
1136098005 16:27972809-27972831 GAGTGTACATTGGAATCACCTGG - Intronic
1137248104 16:46721817-46721839 GGCTGTACATTGGAATCATCAGG + Intronic
1137377151 16:47962006-47962028 GGCTGTGCATTAGAATCACCTGG + Intergenic
1137388603 16:48062787-48062809 GGCTGCACATTAGAATCATCTGG - Intergenic
1137705459 16:50532751-50532773 GAATGCACATCAGAATCACCAGG - Intergenic
1137885547 16:52099213-52099235 GACAGCATATTAGAATCACCTGG + Intergenic
1137896011 16:52213617-52213639 GGCTGCACATTAGAATCTCCAGG - Intergenic
1138038120 16:53629163-53629185 GGCTGCACATTAGAATCACCAGG + Intronic
1138226932 16:55303935-55303957 GGCTACACATTAGAATCATCTGG - Intergenic
1138268351 16:55676911-55676933 GACTGCACATCAGAATCACCTGG + Intronic
1138449720 16:57086436-57086458 GACTGCACATTAGAGTCACCTGG + Intergenic
1138498677 16:57424962-57424984 GGCTGCATATTAGAATCACCTGG - Intergenic
1138580488 16:57937798-57937820 GGCTGTGCATTGGAATCACCTGG + Intronic
1138823849 16:60294494-60294516 TACTGTACATCAGAATCAACTGG + Intergenic
1138980461 16:62261254-62261276 GAATGTACATCAGAATCACATGG - Intergenic
1138994614 16:62434342-62434364 GGCTGCACATTACAATCACCTGG + Intergenic
1139184651 16:64791517-64791539 GGCTGAATATTAGAATTAACAGG - Intergenic
1139205458 16:65024343-65024365 AGCTGCACATTAGAATTAACCGG + Intronic
1139321183 16:66115663-66115685 GGCTGCATATTAGAATCACCTGG + Intergenic
1139859547 16:70009928-70009950 CACTGCACATTAGAGTCATCCGG - Intergenic
1139873235 16:70124488-70124510 GTCTGCACATTAGAATCAGCTGG + Intronic
1140362546 16:74356817-74356839 GTCTGCACATTAGAATCAGCTGG - Intergenic
1140797090 16:78448711-78448733 GGCTGGACATTAAAATCAAGGGG + Intronic
1140946567 16:79773849-79773871 GGTTGCACATTAGATTCAACTGG - Intergenic
1141087637 16:81108289-81108311 GAGTGCACCTTAGAATCACCTGG - Intergenic
1141366062 16:83444445-83444467 TGCTATACATTAGAATCACCTGG + Intronic
1141390547 16:83659529-83659551 GGCTGTTCATTAGAATCACAGGG + Intronic
1141730696 16:85821112-85821134 GGCTGCACGTTAGAATCACCTGG + Intergenic
1141813552 16:86393198-86393220 GGCTATACATTAGAATGACCTGG + Intergenic
1142302501 16:89266717-89266739 GCCCGTGCATCAGAATCAACAGG - Intergenic
1143195682 17:5074654-5074676 GACTGCACATTGGAATCACCTGG - Intergenic
1143458020 17:7080239-7080261 GACAGTAAATGAGAATGAACAGG + Exonic
1143855873 17:9848464-9848486 GGCTGCATATTAGAATCATCTGG - Intronic
1143924634 17:10358862-10358884 GAGTACACATCAGAATCAACAGG - Intronic
1143946426 17:10596624-10596646 GGTTGCACATTAGAATCACCTGG - Intergenic
1143996937 17:11014582-11014604 GGATGCACATTAGAATCATCTGG - Intergenic
1144024426 17:11265328-11265350 GGCTGCACATTGGAATCAACTGG + Intronic
1144050651 17:11494815-11494837 GGCTGTGCATTAGAATCGCCTGG + Intronic
1144236731 17:13268806-13268828 GGCTGGACACTAGAATCAACTGG - Intergenic
1144369141 17:14573496-14573518 GGCTGCATATTAGAATCACCTGG - Intergenic
1144406937 17:14960973-14960995 GGCTGCATATTAGAATCCACTGG - Intergenic
1144462174 17:15467129-15467151 GAGTGTACAATAGAATCACCTGG + Intronic
1145814443 17:27785432-27785454 GGCTGTGCATTAGAATCACCTGG + Intronic
1146279350 17:31535326-31535348 GGCTGTGCATTGGAATCACCTGG + Exonic
1146592031 17:34135566-34135588 GGCTGCACATTGGAATCACCTGG - Intronic
1146780625 17:35668353-35668375 GGCTGTACATTAGAATCAACTGG + Intronic
1147464666 17:40601826-40601848 GGCTGCATATTAGAATCACCTGG - Intergenic
1147555226 17:41474729-41474751 GCCTGTACATTGGAATGACCTGG - Intergenic
1147773533 17:42884322-42884344 GACTGCACATTGAAATCACCTGG + Intergenic
1148056090 17:44796602-44796624 TAATGTACATAAGAATCACCAGG + Intergenic
1148143509 17:45344872-45344894 GACTGCACAGTAGAATCACTGGG - Intergenic
1148215441 17:45831670-45831692 AGCTGCACATTAGAATCACCTGG - Intronic
1148358617 17:46993989-46994011 GGCTGCACATTAGAATCCACTGG - Intronic
1148478255 17:47943029-47943051 GTCTGTGCATCAGAATCACCTGG - Intronic
1148974846 17:51518608-51518630 GGCTTCACATTAGAATCAGCTGG + Intergenic
1149067182 17:52494653-52494675 GACTGTGCATTAGAATTATTTGG - Intergenic
1149210757 17:54297437-54297459 GAATGCACATTAGAATTAACTGG - Intergenic
1149288959 17:55197189-55197211 GTCTGCACATTAGAATCACCTGG - Intergenic
1149501313 17:57154688-57154710 GGCTGTACATTGCAATCACCTGG + Intergenic
1149551364 17:57542635-57542657 GACTGCATATTAGCATCAGCTGG - Intronic
1149566649 17:57645124-57645146 CACTGTGCATCAGAATCATCCGG + Intronic
1149687728 17:58546954-58546976 GGCTGCACATTAGAATCACCTGG + Intergenic
1149970663 17:61214757-61214779 GACTGTTCTTTGGAATTAACAGG + Intronic
1150332080 17:64302470-64302492 GGCTAAACATTAGAATCACCTGG + Intergenic
1150446379 17:65229933-65229955 GTCTGGACATTAGAATCCACTGG + Intergenic
1150605421 17:66686596-66686618 GACTGTACATTGGAATCACATGG - Intronic
1150630354 17:66876195-66876217 GGCTACACATTAGAATCACCTGG + Intronic
1151170837 17:72244845-72244867 GGCTGCACATTGGAATCAAAGGG + Intergenic
1151360944 17:73588504-73588526 CACTGTGCATCAGAATCACCTGG - Intronic
1151799757 17:76371399-76371421 GTCTGTACCTTAGAATCACTGGG + Intronic
1153159962 18:2192945-2192967 GACTGTTCATTTGAATGAAACGG - Intergenic
1153621662 18:6984589-6984611 GTCTGCACATTGGAATCACCTGG - Intronic
1153909851 18:9697201-9697223 TACTGTACATCAGAATTACCTGG + Intergenic
1154097883 18:11436239-11436261 AACTGTACATTAGAACTAAATGG + Intergenic
1154282089 18:13012978-13013000 GACTGTAAATGAAAATCAATAGG - Exonic
1155252561 18:23966214-23966236 GGCTCTTCATTAGAATCACCTGG - Intergenic
1155566029 18:27135607-27135629 GACTGAATATTAAAATCACCTGG + Intronic
1155977630 18:32148097-32148119 GGCTGTACATTAGAATCATCTGG - Intronic
1156034038 18:32746954-32746976 GGCTGTGTATTAGCATCAACTGG - Intronic
1156762604 18:40611676-40611698 GATTGTATATTAGAATCATCTGG + Intergenic
1156847383 18:41682305-41682327 GGTTGTACATTAGAATCACCTGG - Intergenic
1157090170 18:44627561-44627583 GGCAGTACATTAGAATCACCTGG + Intergenic
1157211793 18:45749160-45749182 GACTGCACATCAGAATCATCTGG - Intronic
1157281807 18:46351192-46351214 GACACTAAATTAGAATCATCTGG + Intronic
1157326424 18:46672092-46672114 GGCTGCACATTAGAAACATCTGG + Intronic
1157517478 18:48321152-48321174 GACTGCATGTTAGAATCACCTGG - Intronic
1157802828 18:50634911-50634933 GACTGCACCTTAGAATCAGCGGG + Intronic
1157933747 18:51851859-51851881 GATTGCACATTGGAATCACCTGG + Intergenic
1158170726 18:54596392-54596414 GACTGCATATTAGAATCACCTGG + Intronic
1158251990 18:55499543-55499565 GACTGTACATTAGAATCAACTGG + Intronic
1158407539 18:57173441-57173463 GGCTGAACATCAGAATCCACAGG - Intergenic
1158428152 18:57358205-57358227 GACTGCATATTGGAATCATCAGG - Intronic
1158490889 18:57908779-57908801 GGCTGCACATTAGAATCACCTGG + Intergenic
1158514472 18:58119737-58119759 GGCTGCACATCAGAATCACCTGG + Intronic
1158554205 18:58461671-58461693 GGCTGCACATTAGAATCACCTGG - Intergenic
1158578663 18:58662190-58662212 GACTGCATATTAGAATCATTTGG - Intergenic
1159476367 18:68925357-68925379 GTCTGTATATTTGAATCACCTGG - Intronic
1159605272 18:70468377-70468399 GGCTGTACATTACAATCACCTGG - Intergenic
1159619105 18:70617147-70617169 GCCTGTTCATTAGTATCACCTGG - Intergenic
1159633717 18:70779897-70779919 GTCTGTACATCAGAATCAACTGG - Intergenic
1159642289 18:70877346-70877368 GACTGTACAATGGAATCTGCTGG - Intergenic
1159854298 18:73565880-73565902 GGCTGAGCATTAGAATCATCTGG - Intergenic
1162120493 19:8463799-8463821 CACTCTTCATTAGAAACAACAGG - Intronic
1162544096 19:11317955-11317977 GGCTGTAGATTAGAATCACCTGG + Intronic
1162882876 19:13673237-13673259 GGCTGCACATTAGAATCTCCTGG + Intergenic
1163261559 19:16193640-16193662 AAATTTACATTAGAATCACCTGG + Intergenic
1164190296 19:22909752-22909774 GACACTACATTACAAACAACCGG - Intergenic
1164549234 19:29194448-29194470 GCCTGAACATTGGAATCACCTGG + Intergenic
1165580520 19:36858802-36858824 GAGTGTACATTAGAATCACTTGG - Intronic
1166026743 19:40093067-40093089 GACTAAACATTAGAATAAAGCGG + Intergenic
1166047948 19:40240656-40240678 GACTGTACAGCAGAACCACCAGG + Intronic
925521359 2:4749338-4749360 GAGTGCACATTAGAATGACCTGG - Intergenic
925552513 2:5091697-5091719 GGCTATACATTAGAATCGATTGG + Intergenic
925892868 2:8449967-8449989 GATAATACATTAGAATCACCTGG - Intergenic
926298310 2:11584166-11584188 AACTGTACATTAAACTCAACCGG - Intronic
926615342 2:14991655-14991677 GGCTGAACATTGGAATCATCTGG - Intergenic
926667177 2:15538556-15538578 GGCTGTATCTTAGAATCACCTGG - Intronic
926764970 2:16316327-16316349 GGATGTACATTACAATCACCTGG + Intergenic
926785708 2:16516606-16516628 GGCTGCACATCAGAATCACCTGG - Intergenic
926874428 2:17458887-17458909 CAATGCACATTAAAATCAACTGG + Intergenic
927265616 2:21146047-21146069 AGCTGTGCATTAGAATCACCAGG - Intergenic
927647149 2:24885222-24885244 GGCTGTGCCTTAGAATCACCTGG + Intronic
928185850 2:29110163-29110185 GGTTGTGCATTAGAATCACCTGG - Intronic
928469248 2:31557292-31557314 GGCTGCACATTAAAATCATCTGG - Intronic
928485438 2:31726514-31726536 GCTTGGACATTAGAATCAACTGG - Intergenic
928492059 2:31794479-31794501 GATGTTACATTAGAATCAAGTGG - Intergenic
928550760 2:32368213-32368235 AACTGCACATTAGAACCAGCTGG - Intronic
928561179 2:32487236-32487258 GACTATAGATTAGAATCATCTGG - Intronic
928613789 2:33016561-33016583 GGCTGTACATTAGAATCACCTGG - Intronic
929000089 2:37339077-37339099 GGCTGCACGTTAGAATCACCTGG + Intergenic
929073082 2:38053867-38053889 GGCTGCACATTAGAGTCACCTGG - Intronic
929085889 2:38167000-38167022 GGCTGCACATTAGAGTCAACTGG - Intergenic
929177109 2:38991022-38991044 GGCTGTACATTAGAATCCTATGG + Intronic
929225251 2:39505593-39505615 GGCTGTACTTTAGAATCACCTGG + Intergenic
929364795 2:41140897-41140919 GACTGGATATTAGAATCAGCTGG + Intergenic
929423156 2:41815755-41815777 GACTGCACATCAGAATCACCTGG - Intergenic
929427411 2:41857226-41857248 GACTGCACATTAGAATCACCTGG + Intergenic
929436215 2:41930603-41930625 GACTGCACATTAAAATCATCTGG - Intergenic
929479041 2:42285045-42285067 GAAAGTAAATAAGAATCAACAGG - Intronic
929671720 2:43881082-43881104 CACTGCACATTAGAATTACCTGG - Intergenic
929959934 2:46488862-46488884 GATTGCTTATTAGAATCAACTGG - Intergenic
929997370 2:46837138-46837160 GGCTGCACCTTAGAATCCACTGG + Intronic
929997391 2:46837238-46837260 GGCTGCTCATTAGAATCACCCGG - Intronic
930004170 2:46882743-46882765 AGCTGTACATGAGAATCACCTGG - Intergenic
930090930 2:47531028-47531050 GGCTGCACAATAGAATCACCTGG + Intronic
930252621 2:49052565-49052587 GACTGCACTTTAGAATCCCCTGG - Intronic
930308434 2:49706576-49706598 TACAGTACATGAGAATCACCTGG - Intergenic
931029597 2:58157270-58157292 GAATGCACATCAGAATCGACTGG - Intronic
931070854 2:58647934-58647956 GGCTGCACATTAGAATCACCTGG + Intergenic
931141576 2:59464201-59464223 GGCTGTACAGCAGAATCACCTGG - Intergenic
931225951 2:60332469-60332491 GACTGCACATTAGAATCACTTGG - Intergenic
931243346 2:60471915-60471937 GAGTGTGCATGAGAATCACCTGG - Intronic
931365420 2:61614896-61614918 GACTGTGCATTAGAATCATCTGG + Intergenic
931580633 2:63768595-63768617 GGCTGTACATTAAAAGCACCTGG - Intronic
931633095 2:64318821-64318843 AGCTGTGCATTAGAATCATCTGG - Intergenic
931745282 2:65286537-65286559 GGCTGTGCATTAGAATCATTAGG + Intergenic
931756441 2:65378856-65378878 CACTGTACATTAGAATTACTGGG - Intronic
932000319 2:67878885-67878907 GGCTGTATATTAGAATCACCAGG + Intergenic
932001205 2:67886787-67886809 GACTGCACATTAGAATCACCTGG + Intergenic
932093924 2:68830255-68830277 GATTGTATATTGGAATCAACTGG - Intergenic
932210362 2:69923253-69923275 GGCTGCACATGAGAATCACCTGG - Intronic
932302871 2:70679287-70679309 GGCTGTACACTAGAATCACGGGG + Intronic
933292037 2:80448592-80448614 GGCTGTACATTAGTATCACCTGG - Intronic
933325515 2:80831655-80831677 GACTGCCCATTGGAATCACCTGG + Intergenic
933372678 2:81436545-81436567 GGCTGCACATTAGAATCACCTGG + Intergenic
933608503 2:84409404-84409426 GGCTGCACATTAGAATCACCTGG + Intergenic
933628277 2:84627214-84627236 GAGTGTGCATCAGAATCACCTGG - Intronic
933656133 2:84888406-84888428 GGTTGCACATTAGAATCATCTGG + Intronic
933688758 2:85163101-85163123 GGCTGCACATTTGAATCATCTGG + Intronic
933693363 2:85196686-85196708 GACTACACATTGGAATCACCTGG - Intronic
933693733 2:85199501-85199523 GGCTGCACATTAGAGTCAACTGG + Intronic
934090642 2:88547709-88547731 GACTGTACTTTGGAATTATCAGG + Intergenic
934298585 2:91762857-91762879 GAATGTGCACCAGAATCAACTGG + Intergenic
934610190 2:95729815-95729837 CACTGCACCTTAGAATCATCTGG + Intergenic
935164887 2:100561906-100561928 GGCTATGCATTAGAATCACCTGG - Intergenic
935419396 2:102851692-102851714 GACTGCAAATTAAAATCACCTGG - Intergenic
935627603 2:105184255-105184277 GACTGTGCCATAGAATCACCTGG - Intergenic
935662992 2:105485986-105486008 GGCTGAGCATTAGAATCAGCTGG - Intergenic
935925302 2:108061921-108061943 AACTATAAATTAGAATCACCTGG + Intergenic
936482557 2:112898387-112898409 GATTGTACATTAGGGTCATCTGG + Intergenic
936493335 2:112994978-112995000 GAAACTACATTAGAATCATCTGG + Intergenic
936543520 2:113371413-113371435 CACTGCACCTTAGAATCATCTGG + Intergenic
936616978 2:114057784-114057806 GGCTGCATATTAGAATCACCTGG + Intergenic
936645082 2:114359469-114359491 GACTGCACTTTAGAATCACGTGG + Intergenic
936930816 2:117786951-117786973 GGCTGAACATTATAATCAACTGG + Intergenic
936955485 2:118018007-118018029 GGCTGCACATTGGAATCACCTGG + Intergenic
937117220 2:119416419-119416441 AACTGCACATTAGAATCACCTGG - Intergenic
937121525 2:119442712-119442734 TGCTGCACATTAGAATCACCTGG + Intronic
937642049 2:124224031-124224053 GGCTGTGCATTTGAATCACCTGG + Intronic
938797671 2:134731879-134731901 GACTGCACATGAGATTCACCTGG + Intergenic
938810280 2:134846371-134846393 GACAGTGCATCAGAATCACCAGG - Intronic
938961966 2:136352215-136352237 GGCTGCACATTAGAATCACCTGG + Intergenic
938966926 2:136397013-136397035 GACTGTACGTTAGAGTCACTGGG - Intergenic
939204168 2:139078611-139078633 AGCTGTCCACTAGAATCAACTGG - Intergenic
939401384 2:141699167-141699189 GGCTTCACATTAGAATCATCTGG + Intronic
939406571 2:141765911-141765933 GAATGTACAGCAGAATCATCTGG - Intronic
939614560 2:144348033-144348055 AGCTGCACATTAGAATCACCTGG + Intergenic
939881997 2:147641473-147641495 CTCTGGACATTAGAATCACCTGG + Intergenic
939882011 2:147641585-147641607 GGCTGCACATTAGAGTCACCTGG - Intergenic
940020523 2:149151748-149151770 GGATGTACATCAGAATCACCTGG - Intronic
940111454 2:150159450-150159472 GCCTGAACAATAGAATCACCTGG + Intergenic
940129480 2:150364759-150364781 GGCTGCGCATTAGAATCACCTGG + Intergenic
940150305 2:150592803-150592825 AGCTATACATTAGAATCATCTGG + Intergenic
940175701 2:150875481-150875503 GAGTGTGCATCAGAATCACCTGG + Intergenic
940424023 2:153510573-153510595 GGCGGCACATTAGAATCACCTGG + Intergenic
940424034 2:153510714-153510736 GGCTGCACATAAGAATCACCTGG - Intergenic
940646333 2:156396460-156396482 GTCTGCATATTAGAATCACCTGG + Intergenic
940890913 2:159034425-159034447 GGCTACACATTAAAATCAACTGG + Intronic
940893094 2:159054381-159054403 GGCTGCACATTAGAATCACCTGG + Intronic
941046363 2:160680161-160680183 GATTGCACATTAGAACCATCTGG + Intergenic
941083358 2:161088340-161088362 GGCTGTCCATTAGAATCACCTGG + Intergenic
941658801 2:168173025-168173047 GGCTGCACATTAGAACCACCTGG - Intronic
941891347 2:170585136-170585158 GGCTGCACATTAGAGTCATCTGG - Intronic
941906848 2:170724889-170724911 CAGTGTGCATTAGAATCACCTGG - Intergenic
942181505 2:173385101-173385123 GGCTCCACATTAGAATCATCCGG + Intergenic
942256278 2:174102254-174102276 TAGTGTGCATTAGAATCATCTGG - Intronic
942389707 2:175479258-175479280 GGCTGCACATTAGAATCATCTGG - Intergenic
942792818 2:179780062-179780084 GGCTGCCCATTAGAATCACCTGG - Intronic
942804057 2:179909092-179909114 GGCTGTACATTAACATCACCTGG + Intergenic
942889364 2:180968875-180968897 GGCTACACATTAGAATCATCTGG - Intronic
943122313 2:183752033-183752055 GATGGCACATTAGAATCACCTGG - Intergenic
943173269 2:184432317-184432339 GTCTATGCATTAGAATCACCAGG + Intergenic
943288349 2:186034565-186034587 GGCTGCACATTAGAATCACCTGG + Intergenic
943301502 2:186208162-186208184 AACTGTACATTAGAATTATTTGG - Intergenic
943344419 2:186721155-186721177 GGCTGTGCACTAGAATCATCTGG + Intronic
943566715 2:189524819-189524841 GACTGCACATCAGAACCACCTGG - Intergenic
943636466 2:190312788-190312810 GTCTGTACATTAGAATCACCTGG + Intronic
943686886 2:190827867-190827889 GGCTGTACACTGGAATCACCTGG - Intergenic
943759316 2:191591296-191591318 GAGTGTGCATCAGAATCACCTGG - Intergenic
943958580 2:194228028-194228050 CACTATAGATTACAATCAACAGG + Intergenic
944213077 2:197226677-197226699 CACTATACATCAGAATCACCAGG - Intronic
944284973 2:197939286-197939308 GAATGCACATTAGAATGACCTGG + Intronic
944293383 2:198033855-198033877 GACTGTGCATTAGAATTGCCTGG + Intronic
944391076 2:199220298-199220320 GACTGTACTTTAGAATCCCATGG - Intergenic
944402850 2:199347996-199348018 GAGTGTGCATCAGAATCACCTGG - Intronic
944475873 2:200105580-200105602 AAATGTACATTATAATCAACTGG + Intergenic
944541448 2:200757522-200757544 GACTGCACGTTAGAATCATCTGG + Intergenic
944869450 2:203895071-203895093 AGCTGCACATTAGAATCAACTGG - Intergenic
944898339 2:204188768-204188790 GGCTGTACTTTAGAATCACTTGG - Intergenic
944934129 2:204549605-204549627 GGCTGGGCATTAGAATCACCTGG - Intronic
945111211 2:206361374-206361396 GGCTGCACATTAGAGTCACCTGG - Intergenic
945444720 2:209922668-209922690 TACAGTACATTACAACCAACTGG + Intronic
945494603 2:210495034-210495056 GGCTGCATATTAGAATCACCTGG - Intronic
945695510 2:213098205-213098227 GGCTGCACATTAGAATCATCTGG - Intronic
945774073 2:214082630-214082652 GGCTGCACATTAGAATTACCTGG + Intronic
945783987 2:214211212-214211234 GGCTGCATATTAGAATCACCAGG + Intronic
945969465 2:216221713-216221735 GGCTGTACACTGGAATCAGCTGG - Intergenic
946266520 2:218547451-218547473 GACTGTACATTAGAATCACCTGG - Intronic
946456142 2:219828006-219828028 GACTGCACTTTGGAATCATCTGG - Intergenic
946596319 2:221309669-221309691 GGCTGTACATTGGAATCACCTGG - Intergenic
946713663 2:222531756-222531778 GGTTGCACATTAAAATCAACGGG - Intronic
946774263 2:223121184-223121206 GACTGTACATTAAAATCACTTGG + Intronic
946854442 2:223939250-223939272 GAATGTGCATCAGAATCACCTGG - Intronic
947484777 2:230538040-230538062 GACTGCACATTAGAACCATCTGG + Intronic
947940797 2:234053572-234053594 GACCGCACATTAGAATGAGCAGG - Intronic
948505589 2:238425273-238425295 GGCTGCACTTTAGAATCACCTGG + Intergenic
948950846 2:241250320-241250342 TACTGCACATTAGAAACACCTGG - Intronic
1168901712 20:1370510-1370532 GACTGCACATGAGAGTCACCTGG - Intronic
1168937015 20:1674237-1674259 GGCTGCTCATTAGAATCATCTGG - Intergenic
1169016951 20:2299773-2299795 TGCTGCACATTAGAATCACCAGG + Intronic
1169094005 20:2879981-2880003 GGCTACACATTAGAATCACCTGG - Intronic
1169475205 20:5924707-5924729 GAATGTACATTAGGATCATGAGG + Intronic
1169529703 20:6471707-6471729 GGATGCATATTAGAATCAACTGG + Intergenic
1169537174 20:6557731-6557753 GGCTGTACCTAAGAATCACCAGG + Intergenic
1169653413 20:7894531-7894553 GGCTGCACATTGGAATCATCTGG - Intronic
1169710897 20:8562214-8562236 GGCTGTACATTGAAATCACCTGG + Intronic
1169816372 20:9661044-9661066 GAGTGCACATCAGAATCATCTGG - Intronic
1169847741 20:10013874-10013896 GAATGTGCATAAGAATCACCTGG - Intronic
1169876055 20:10298080-10298102 GGCTGTACATTAGAATCACCAGG + Intronic
1169911495 20:10651143-10651165 GGCTGTATATCAGAATCACCTGG - Intronic
1169965141 20:11208904-11208926 GTCTGTACTTTAAAATCACCTGG - Intergenic
1169980340 20:11377701-11377723 GGCAGTACATTAGAATCATCTGG + Intergenic
1170252876 20:14304971-14304993 GACTATATATTAGAATCAATGGG + Intronic
1170295613 20:14821512-14821534 GACTGCACATTGAAATCATCTGG - Intronic
1170352454 20:15456833-15456855 GGCTGTACATTAGAATATGCCGG - Intronic
1170404250 20:16019779-16019801 GACTGAGCATTAGAACCACCTGG - Intronic
1170478715 20:16743933-16743955 GGCTGCATATTAGAATCATCTGG + Intergenic
1170549269 20:17462290-17462312 GTCTGCACATTGGAATCACCTGG - Intronic
1170730633 20:18972031-18972053 AACTGGACATCAGAGTCAACAGG - Intergenic
1170860003 20:20094002-20094024 GACTGCACCTTGGAATCATCTGG - Intronic
1170962467 20:21037584-21037606 GGCTGCACATTAGAATCACCTGG - Intergenic
1173036968 20:39421287-39421309 GGCTGCACAGTAGAATCAGCTGG + Intergenic
1173041532 20:39468689-39468711 TGCTGTACCTTAGAATCATCAGG + Intergenic
1173246168 20:41339336-41339358 GTTTGTACATTACAACCAACTGG + Intergenic
1173258946 20:41416040-41416062 AACTGCACATTGGAATCAGCTGG - Intronic
1173340204 20:42146462-42146484 GACTGCACATTAGAATCACCTGG + Intronic
1173478164 20:43377810-43377832 GGCTGCACATTAGAATCCCCTGG - Intergenic
1173478639 20:43382046-43382068 GACTGTGCATTAGAATCACCTGG - Intergenic
1174002098 20:47382293-47382315 GGCTACACATTAGAATCAGCTGG - Intergenic
1174422507 20:50408819-50408841 GGCTGTGCATCAGAATCACCTGG - Intergenic
1174488359 20:50875078-50875100 GACTCTGCATGAGAATCACCTGG + Intronic
1174566624 20:51469344-51469366 GACTGTATGTTAGAATTACCCGG - Intronic
1174577158 20:51544672-51544694 GACTACACATTAGAATCACCTGG + Intronic
1174735944 20:52965942-52965964 GGCTGAACATCAGAATCACCTGG - Intergenic
1174768598 20:53276648-53276670 GACTGTACATCGCAATCACCTGG + Intronic
1175034581 20:55988101-55988123 CACTGTACTTAAGAATCATCTGG - Intergenic
1175637212 20:60595856-60595878 GGCTGCACATTAGAACCACCTGG - Intergenic
1176677864 21:9797494-9797516 GACTGTGCATAAGAAACATCTGG - Intergenic
1176920335 21:14680173-14680195 CACTGCACATTAGAATCACCTGG + Intergenic
1177045400 21:16162638-16162660 GACTGCACATTAGAGTCACCTGG + Intergenic
1177953375 21:27566823-27566845 GACTACACATTAGAATCACTAGG + Intergenic
1178139194 21:29662921-29662943 GGCTGTACATAAGTATCACCTGG - Intronic
1178327272 21:31656172-31656194 GGCTGCACAATAGAATCACCTGG - Intergenic
1178628711 21:34240628-34240650 GGCTGCACATTAGAATCACTGGG + Intergenic
1178884631 21:36475512-36475534 GCCTGCACATCAGAATCACCGGG - Intronic
1178964664 21:37104888-37104910 GACTGCACATTAGTACCATCTGG - Intronic
1179254126 21:39700143-39700165 GGCTGCACATCAGAATCACCTGG - Intergenic
1180631592 22:17233831-17233853 GGCTGCACCTTAGAATCACCTGG + Intergenic
1181789934 22:25257222-25257244 GGCTGCACATTAGGATCACCTGG + Intergenic
1181909824 22:26229756-26229778 GGCTGCACATTTGAATCATCTGG - Intronic
1182012315 22:27011194-27011216 GACTGCTCATTGGAATCACCTGG - Intergenic
1182058738 22:27381755-27381777 GGCTGCACATTAGAATCCCCAGG + Intergenic
1182315001 22:29439857-29439879 CACTGTGCATTAGAATTACCAGG - Intronic
1182736555 22:32535338-32535360 GGTTGTACATCAGAATCACCAGG + Intronic
1182805236 22:33064161-33064183 GACTATACATTAGTGTCATCTGG - Intergenic
1183145231 22:35984292-35984314 AACTGTGCGTTAGAATCACCTGG - Intronic
1183354025 22:37349090-37349112 GACTGCCCATCAGAGTCAACCGG - Intergenic
1183769499 22:39911905-39911927 TACTGTGCATAAGAATCACCAGG - Intronic
1185355741 22:50368912-50368934 GACTCAAGATTAGAATAAACAGG + Intronic
949311892 3:2709316-2709338 GGCTGCATATTAGAATCATCTGG + Intronic
949744209 3:7269513-7269535 GGCTGCATATTAGAATCACCAGG - Intronic
949776751 3:7641638-7641660 GGCTGTACATTAGAATCATCTGG - Intronic
949934771 3:9108176-9108198 TCCTGTACACTAGAATCAACTGG + Intronic
950201835 3:11050067-11050089 GACTGTATGCTAGAATCACCAGG - Intergenic
950274425 3:11646501-11646523 GACTGCATATTGGAATCACCTGG - Intronic
950297644 3:11846048-11846070 GGCTGCGCATTAGAATCACCTGG + Intronic
950406175 3:12806520-12806542 GACTGCATGTTAGAATCACCTGG + Intronic
950954995 3:17043198-17043220 GGCTGTACATTAGAAACACCTGG - Intronic
951256947 3:20460710-20460732 TAGTGTACATCAGAATCATCTGG + Intergenic
951362457 3:21740956-21740978 GGCTGTACAAAAGAATCACCTGG - Intronic
951383930 3:22021899-22021921 GTCTGCACATTAGAATCACCTGG - Intronic
951465880 3:23000040-23000062 GGCAGCACATTAGAATCATCTGG - Intergenic
951574715 3:24101820-24101842 GATTGCACATTGGAATCATCTGG + Intergenic
951616309 3:24549367-24549389 ATCTGAACATTAGAATCAACTGG - Intergenic
951849829 3:27126733-27126755 GGCTGCAAATTAGAATCACCTGG + Intronic
952232379 3:31445421-31445443 GACTCCACATTAGAATTAGCAGG - Intergenic
952429332 3:33206811-33206833 GGCTGTACATTAAAATCACAAGG + Intronic
953058008 3:39403755-39403777 GGCTGCACATTGGAATCATCTGG + Intergenic
953093793 3:39755136-39755158 GGCTGTTCATTACAATCAACTGG - Intergenic
953137147 3:40190799-40190821 GAGTGCACAGTAGAATCACCAGG - Intronic
953290687 3:41658380-41658402 GGCTGTACATTAGTATCACTTGG - Intronic
953799845 3:46014298-46014320 GGCTGTACATTAGAACCACCAGG + Intergenic
954204622 3:49049207-49049229 GGCTGGACATTAAAATCACCTGG - Intronic
954726486 3:52615656-52615678 GTCTGTGCATTAGAATCACCTGG - Intronic
954863193 3:53707203-53707225 GGCTGTACGTTATAATCACCTGG + Intronic
954991188 3:54841970-54841992 CACTGTACATTAGAATGGACAGG + Intronic
955062896 3:55508801-55508823 GACTGTACATCGAAATCAAATGG + Exonic
955154925 3:56407687-56407709 GACTGCACATTAGAGTCACATGG + Intronic
955350977 3:58192757-58192779 GACTGTAGTTTAAATTCAACTGG + Exonic
955655864 3:61244250-61244272 GGCTGTAAGTTAGAATCACCTGG - Intronic
955814927 3:62832245-62832267 AACTGTACAATAGGATCACCTGG - Intronic
955830361 3:62994985-62995007 GGCTGTACATTGTAATCACCTGG - Intergenic
955837921 3:63078089-63078111 GGCTTTACATTAGAATCACCTGG + Intergenic
955981503 3:64531976-64531998 GGCTGTACATTTGAATCATTTGG + Intronic
956022312 3:64945803-64945825 TACTGTACGTTAGAATCAACTGG - Intergenic
956105730 3:65816153-65816175 GACTCTACATTAAAATCACCTGG - Intronic
956150528 3:66237313-66237335 GCCTGCACATTAGAATCTACTGG + Intronic
956225726 3:66955942-66955964 GAGTGTGCATCAGAATCACCTGG + Intergenic
956660469 3:71592349-71592371 CACTGCACATTAGAATCACCTGG - Intergenic
956698056 3:71935399-71935421 GGCTGTGCATTAGAAGCACCTGG + Intergenic
956740231 3:72269940-72269962 GGCTTTACATTAGAATAAACTGG - Intergenic
956885018 3:73550381-73550403 GGCTGCACATTATAATCACCTGG + Intronic
956979748 3:74622101-74622123 CACTGCACATTAGAATCACCTGG + Intergenic
957239241 3:77637080-77637102 AACTGCACATTAGAACCATCTGG + Intronic
957540790 3:81566349-81566371 GTCTGTACATTGGAATCACCTGG - Intronic
957564447 3:81866203-81866225 GGCTGTACCTTAGAATCACCTGG + Intergenic
957950866 3:87124794-87124816 GGCTGTACATTAGAATCACCTGG + Intergenic
958411669 3:93824791-93824813 GACTGCACATTGGCATCACCTGG + Intergenic
959010347 3:101068704-101068726 GGCTGCACATTGGAATCACCTGG - Intergenic
959183779 3:103016450-103016472 AACTGTACATCAGTATAAACTGG + Intergenic
959425419 3:106181093-106181115 GACTACACATTAGAATCATCTGG - Intergenic
959565779 3:107831592-107831614 AATTGCACATTAGAATCACCTGG - Intergenic
959622053 3:108409303-108409325 GACCGCACCTTAGAATCACCTGG + Intronic
959667686 3:108939810-108939832 GGCTACACATTAGAATCATCAGG + Intronic
959761663 3:109973401-109973423 GGCTGCACACTAGAATCATCTGG - Intergenic
959817456 3:110691643-110691665 AACTGTACATCAGAATCACCTGG - Intergenic
959829190 3:110840048-110840070 GGCTGCACATTAGAATAATCTGG - Intergenic
959839360 3:110956388-110956410 GCTTGTACATTAGAATCTCCCGG - Intergenic
959915109 3:111808002-111808024 GGCTGCACATTAGAGTCACCTGG + Intronic
960049998 3:113230028-113230050 GACTGCACAGGAGAATCATCTGG - Intronic
960155820 3:114296089-114296111 GGCTGCCCATTAGAATCACCTGG - Intronic
960194004 3:114742731-114742753 GATTGCACATTAGAAGCACCTGG + Intronic
960262167 3:115580389-115580411 CATTGTACATAAGAATCACCTGG - Intergenic
960335540 3:116413094-116413116 AACTTTACATCAGAATCACCTGG - Intronic
960475339 3:118117596-118117618 GGCTGTAGGTTAGAATCACCTGG - Intergenic
960511919 3:118559675-118559697 CACTCAACATTAGAATCATCAGG - Intergenic
960594558 3:119396322-119396344 GACTGCATATCAGAATCACCTGG - Intronic
960619813 3:119626997-119627019 GACTGCACGTTAGAATCACCTGG + Intronic
960704789 3:120471564-120471586 GACTACACATTAGAATCATCGGG + Intergenic
961107206 3:124252172-124252194 GGCTGCACATTAGAATCACCAGG + Intronic
961142491 3:124567076-124567098 GGCTGCACATGAGAATCATCTGG + Intronic
961209261 3:125112881-125112903 GGCTGCACATTAGAATCACCTGG - Intronic
961906501 3:130268538-130268560 GATTGTACACTAGAGTCACCTGG + Intergenic
961915072 3:130365765-130365787 GGCTGCACATTGGAATCACCAGG + Intronic
962043504 3:131732015-131732037 AACTGTGCATTGGAATCACCTGG - Intronic
962461997 3:135622748-135622770 GGTTGCACATTAGAATCACCTGG - Intergenic
962478969 3:135782052-135782074 GAGTGTGCGTTAGAATCACCTGG - Intergenic
962630162 3:137267708-137267730 TGCTGTGCATTAGAATCACCTGG + Intergenic
962731693 3:138289611-138289633 GGCTGCATATTAGAATCACCTGG + Intronic
963126062 3:141817897-141817919 TGCTGCACATTAGAATCACCTGG - Exonic
963486701 3:145943159-145943181 GGCTGCACATTGGAATCACCTGG - Intergenic
963514977 3:146298040-146298062 AATTGTACATCAGAATCACCTGG - Intergenic
963723318 3:148889562-148889584 GACTTCCCATTAGAATCATCAGG + Intronic
963751791 3:149187536-149187558 GACTGCACATTAGAATCAACTGG - Intronic
963927034 3:150961399-150961421 GGCTGCACTTTAGAATCATCTGG - Intronic
964339622 3:155694349-155694371 GGCTGTGCATTGGAATCACCTGG - Intronic
964340987 3:155708103-155708125 GACTACACATTAGAATCATCTGG + Intronic
964363477 3:155923739-155923761 GGCTGTATGTTAGAATCATCTGG + Intronic
964428092 3:156574326-156574348 GTCTGCTCATTAGAATCACCTGG + Intergenic
964433356 3:156627521-156627543 TGCTGCACATTAGAATCAACTGG + Intergenic
964504817 3:157387719-157387741 GGCTGCACATTAGAATCCCCTGG + Intronic
964528770 3:157644551-157644573 GGCTGCACATTAAAATCACCTGG - Intronic
964544180 3:157815248-157815270 GGATGCACATTAGAATCACCTGG - Intergenic
964606741 3:158568507-158568529 GACTGTACATTATATACACCAGG + Intergenic
964873697 3:161341791-161341813 GGCTGTACATTAGAATCGTCTGG - Intergenic
964905976 3:161721231-161721253 TGCTGCACATTAGAATCACCTGG + Intergenic
965389859 3:168092078-168092100 GACTGCCCATTAGTATCACCTGG - Intronic
965508093 3:169538091-169538113 GGCTGCACATTAGAATCAACTGG - Intronic
965603386 3:170476376-170476398 GGCTGTGCATCAGAATCACCGGG + Intronic
965611343 3:170547044-170547066 GGCTGCACATTAGAATCACCTGG - Intronic
965611496 3:170548578-170548600 GGCTGCACTTGAGAATCAACTGG + Intronic
966081419 3:176007313-176007335 GACTGTACATTAGAATCACTGGG - Intergenic
966273952 3:178142127-178142149 GACTGAACGTTAGAATCACCCGG + Intergenic
966281678 3:178238295-178238317 GGCTATACATTAGAATCACCTGG - Intergenic
966572582 3:181461954-181461976 GATTGCACATTAAAATCATCTGG - Intergenic
966751075 3:183322862-183322884 GTATGTACGTTAGAATCATCTGG + Intronic
966937781 3:184725156-184725178 GGCTGTACATTAGAATCACCTGG + Intergenic
967004104 3:185367322-185367344 GGCTGCACATTAGACTCAGCTGG - Intronic
967130793 3:186469063-186469085 CATTATACATTAGAATCACCTGG - Intergenic
967440778 3:189505845-189505867 GTCTGTAAATTAGAATCACTTGG + Intergenic
967440790 3:189505971-189505993 GACTGTACATTAGAATCACCTGG - Intergenic
967613570 3:191537605-191537627 TGCTGCACATTAGAATCATCTGG - Intergenic
967743429 3:193028404-193028426 GGCTGCACATTAGAGTCAGCTGG + Intergenic
967752257 3:193128125-193128147 CACTGTGCATTAGAATCACCTGG - Intergenic
967822071 3:193847584-193847606 GACTGCATATCAGAATCACCTGG + Intergenic
967827346 3:193888166-193888188 GCCTGCACATTAGAATAACCCGG + Intergenic
967883221 3:194315943-194315965 GACTTCACATTAGAATCACTTGG + Intergenic
967935043 3:194720417-194720439 GATTGTACATTAGAATCACCTGG - Intergenic
968149504 3:196325862-196325884 GAATGTGCATGAGAATCACCTGG - Intronic
968177361 3:196562584-196562606 CACTGTACATCAGGATCACCTGG - Intronic
968724091 4:2233044-2233066 ACTTGTACATTAGAATCATCAGG - Intronic
969261919 4:6039012-6039034 GACTGTTCATGAGAATCCAGGGG + Intronic
970338112 4:15074272-15074294 GCCTGTACAGTAGAATCACCTGG - Intergenic
970897951 4:21125141-21125163 GAATGTGCATCAGAATCAGCAGG + Intronic
971073787 4:23125386-23125408 GACTGCACATTAGAATCACTTGG + Intergenic
971228164 4:24774256-24774278 GTCTGTACTTTAGAATCATCTGG - Intergenic
971263124 4:25075225-25075247 GACTGCACATCAGATTCACCTGG + Intergenic
971323938 4:25628716-25628738 GGCTGCACATTAAAATCATCAGG + Intergenic
971428936 4:26543370-26543392 GACTACACATTAGAGTCACCTGG - Intergenic
971582578 4:28361510-28361532 GGCTGTACATTAGAATTATATGG + Intergenic
971975105 4:33674051-33674073 GGCTGAATATTAGAATCAAATGG - Intergenic
972095000 4:35337544-35337566 TACTGTGCATAAGAATCAATGGG + Intergenic
972136276 4:35898420-35898442 AAATGCACATTAGAATCATCTGG - Intergenic
972171442 4:36350406-36350428 GCCTACAAATTAGAATCAACTGG - Intergenic
972444530 4:39130632-39130654 GGCTGCACATTAGAATCACCTGG - Intergenic
972679636 4:41293122-41293144 GACTGTACATTGTAATCAACTGG + Intergenic
972981523 4:44709499-44709521 TAGTGTACATAAGAATCACCTGG - Intronic
973345577 4:49051368-49051390 GGCTGCACATTAGATTCACCTGG + Intronic
973345601 4:49051490-49051512 AACTGCACATTAGAATAACCTGG - Intronic
973785793 4:54331790-54331812 GGCTGCACATTAGAATCATCTGG - Intergenic
974005528 4:56552785-56552807 GGCTGTACATTGGAATCACCTGG + Intronic
974067834 4:57096546-57096568 GGCTGTACATCAGAATCACCTGG - Intronic
974079378 4:57196396-57196418 AGCTGTACATTAGAAACACCGGG - Intergenic
974793848 4:66723114-66723136 GACCATATATTAGAATCACCTGG - Intergenic
975114887 4:70669199-70669221 CAGTGCACATCAGAATCAACTGG - Intronic
975569901 4:75804640-75804662 AGCTATACATTAGAATCACCTGG - Intronic
975772711 4:77745787-77745809 GTCTGTTCATTATAATCACCTGG - Intronic
976083585 4:81383961-81383983 GACTGTACACTAGAATCACTTGG + Intergenic
976208333 4:82642714-82642736 GACTGCACATTAGAATAAATTGG + Intronic
976209368 4:82651993-82652015 TACTGTGCATTTGAATCACCTGG + Intronic
976325953 4:83771865-83771887 GGCTGTGCATTAGAATCACTTGG + Intergenic
976476024 4:85483894-85483916 TAGTGTACATCAGAATCACCTGG - Intronic
976570232 4:86598727-86598749 GCCTGTACCTTAGAATCACCTGG + Intronic
976844309 4:89470370-89470392 GAATATAAATTAGAAGCAACTGG - Intergenic
976847501 4:89506739-89506761 GAATGCACATTATAATCACCTGG - Intergenic
977179391 4:93855526-93855548 GACCGCACATTAGAGTCACCTGG + Intergenic
977252994 4:94709476-94709498 GGCTGCACATTAGAATCACCTGG - Intergenic
978322434 4:107512889-107512911 TAGGGCACATTAGAATCAACTGG - Intergenic
978624298 4:110666975-110666997 AGCTGAACATTAGAATCACCTGG - Intergenic
978714748 4:111827957-111827979 GGCTGCACATTAGAATCAGCTGG - Intergenic
979022072 4:115514945-115514967 CATTGAACATTAGAATCACCTGG - Intergenic
979040399 4:115784309-115784331 GACTGAACATTAAAATTACCTGG + Intergenic
979346736 4:119595887-119595909 GACTGTGTATTACAACCAACTGG - Intronic
979466015 4:121039511-121039533 GGCTGTATATTAGAATCACCTGG + Intronic
979631027 4:122903433-122903455 AACTTTACATCAGAATCACCTGG + Intronic
980732435 4:136840156-136840178 GGCTGCATATTAGAATCAGCTGG + Intergenic
980785393 4:137547634-137547656 GACTGTAGATTATAATCACCTGG - Intergenic
981147286 4:141339946-141339968 GAGTACACATTAAAATCAACTGG + Intergenic
981227651 4:142315510-142315532 GGCTGTACATTAGAATCACCTGG + Intronic
981228296 4:142322909-142322931 GGCTTCACATTAGAATCAAGTGG - Intronic
981353710 4:143762554-143762576 GTTTGTATATTAGAATCACCTGG - Intergenic
981507238 4:145515825-145515847 GGCTGTATATTAGAATCACATGG + Intronic
981893144 4:149763510-149763532 GGCTGTAAATTAGGATAAACTGG + Intergenic
981909574 4:149963417-149963439 TAGTGCACATTAGAATCACCTGG - Intergenic
982080789 4:151787511-151787533 TGCTGTACATTAGAATCACTTGG + Intergenic
982105054 4:152004516-152004538 TGCTGCACATTAGAATCACCTGG + Intergenic
982105079 4:152004635-152004657 GGCTGCACATTAGAATCATCTGG - Intergenic
982186700 4:152809217-152809239 GGCTGCACATTAGAATCACCTGG + Intronic
982300139 4:153869927-153869949 TACTGTGCATGAGAATCACCTGG + Intergenic
983692309 4:170485429-170485451 AACTGTATAATAGAATCCACTGG - Intergenic
983737180 4:171076130-171076152 GGCTGCACATTAGAATCACCTGG + Intergenic
983924806 4:173389199-173389221 TACTATGCATTAGAATCACCTGG + Intronic
984035006 4:174655942-174655964 CAGTGTACAATAGAATCATCTGG + Intronic
984599361 4:181708762-181708784 GGCTACACATTAGAATCACCTGG - Intergenic
984748004 4:183241564-183241586 GACTGCATATTAGAATAATCTGG + Intronic
984935510 4:184886400-184886422 GGATGTGCACTAGAATCAACAGG - Intergenic
985032808 4:185808111-185808133 TGCTGTACATTAAAATCAGCTGG + Intronic
985397660 4:189561295-189561317 GACTGTGCATAAGAAACATCTGG + Intergenic
986264316 5:6179880-6179902 GTCTGTGCATTGGAATCACCAGG + Intergenic
986722753 5:10571779-10571801 GACTGTACATTAGAATCATCTGG + Intronic
986973959 5:13373221-13373243 CAATGTACATTTGAATCAACTGG - Intergenic
987027355 5:13940633-13940655 GGCTGTACATTAGAATCACCAGG - Intronic
987368910 5:17175279-17175301 GACTTCACATTAAAATCACCAGG - Intronic
989122207 5:38016087-38016109 GCCTGCACATTATAATCACCTGG - Intergenic
989133439 5:38129975-38129997 GGATGTACATTAGGATCACCTGG + Intergenic
989156439 5:38348887-38348909 GGCTGCACATTAGAATCACCTGG + Intronic
989247625 5:39272072-39272094 GGCTGCACATTAAAATCACCTGG + Intronic
989362093 5:40613345-40613367 GGCTGAACACCAGAATCAACTGG - Intergenic
989453676 5:41616754-41616776 GGCTGCACATCAGAATCACCTGG - Intergenic
989545470 5:42667487-42667509 GGCTGCACATTAGAATCACCTGG + Intronic
989606331 5:43247535-43247557 GACTGCACATTAGAATTACCTGG + Intronic
989734239 5:44683844-44683866 GATTGAACATTAGAATCACCTGG - Intergenic
990047645 5:51454008-51454030 TAACGTACATCAGAATCAACTGG - Intergenic
990086670 5:51987143-51987165 GCCTGCACATTAGAATCACCTGG - Intergenic
990312651 5:54554377-54554399 AATTGTACATCAGAATCATCTGG - Intergenic
990353314 5:54940267-54940289 AGCTGAACATTAGAATCATCTGG + Intergenic
990371824 5:55127500-55127522 GACTGTGTATTAGGATCAGCTGG + Intronic
990483106 5:56230391-56230413 GGCTGTACTTAAGAATCATCTGG - Intronic
990633313 5:57694983-57695005 GGCTGCACATCAGAATCACCTGG - Intergenic
990815746 5:59783195-59783217 GGCTGCATATTAGAATCACCCGG + Intronic
990897852 5:60718036-60718058 GTCTGCACATTACAATCACCTGG + Intergenic
990907975 5:60823854-60823876 GGCTGCATATTAGAATCATCTGG - Intronic
990938597 5:61177163-61177185 GGCTGTACATTAGAATCACCTGG + Intergenic
991022728 5:61997417-61997439 GGCTACACATTAGAATCACCTGG + Intergenic
991037247 5:62140032-62140054 CATTGTACTTTAGAATCACCTGG - Intergenic
991058789 5:62349194-62349216 TACTGTACATTAGAATTACCTGG + Intronic
991166843 5:63573095-63573117 GATAGTGCATTAGAATTAACTGG - Intergenic
991430737 5:66542188-66542210 TACTGCACATTAGAATCACATGG + Intergenic
991684876 5:69172558-69172580 GACAACACATTAGAAACAACTGG - Intronic
991769542 5:70027824-70027846 GGCTGCACATTAGAATCACCTGG + Intronic
991769815 5:70029661-70029683 GGCTGCACATTAGAATCACCTGG - Intronic
991848837 5:70903242-70903264 GGCTGCACATTAGAATCACCTGG + Intronic
991849110 5:70905079-70905101 GGCTGCACATTAGAATCACCTGG - Intronic
992001694 5:72442452-72442474 GGCTGTACATTAGAAGCATCTGG - Intergenic
992179588 5:74183490-74183512 GGCTGTGCATTAGAATTACCTGG - Intergenic
992199432 5:74369146-74369168 GGCTGTGCATTAAAATCACCTGG - Intergenic
992233961 5:74689169-74689191 AGCTGTACATTAGAATCACTTGG - Intronic
992263623 5:74994996-74995018 AGCTGCACATTAGAATCACCTGG + Intergenic
992263634 5:74995106-74995128 ACTTGTACATTAGAATCACCTGG - Intergenic
992430554 5:76706931-76706953 AAGTGTACATCAGAATCATCTGG - Intronic
992503642 5:77365165-77365187 GGCTGCACATTGGAATCACCTGG + Intronic
992649401 5:78842986-78843008 TGCTGTACATTAGAATTACCTGG + Intronic
992649416 5:78843098-78843120 GGCTGCACATTGGAATCATCTGG - Intronic
992661140 5:78961966-78961988 GACCATATATTAGAATCATCTGG - Intronic
992667021 5:79020292-79020314 GGCTGGACATTAGAATCATCTGG - Intronic
992680031 5:79144221-79144243 GACTGCATGTTGGAATCAACTGG - Intronic
992949010 5:81838379-81838401 GGCTGTACATTTGAATCACCTGG - Intergenic
993102302 5:83555722-83555744 GGCTGTTCATTAGAATCACCTGG + Intronic
993197616 5:84769070-84769092 GGCTTTACATTAGAATCACATGG + Intergenic
993856801 5:93086472-93086494 GGCTATACAATAGAATCACCTGG + Intergenic
994058586 5:95447769-95447791 GGTTGTACATTAGAATCACCTGG + Intronic
994071722 5:95610355-95610377 TGCTGCACATTAGAATCACCTGG - Intergenic
994115148 5:96053283-96053305 GGCTGAACATTAGAATCCCCTGG - Intergenic
994133916 5:96263172-96263194 GTCTGCACATTAGAATCACTTGG - Intergenic
994172200 5:96669863-96669885 GGCTGTATATTGGAATCATCTGG + Intronic
994188963 5:96846351-96846373 TTCTGCACATTAGAATCAACTGG + Intronic
994292235 5:98041432-98041454 GGCTGACCATTAGAATCACCTGG + Intergenic
994493372 5:100477658-100477680 GGCTGTACATTACAATAACCTGG - Intergenic
994656568 5:102601289-102601311 GGTTGTACATTAGAATCACCTGG - Intergenic
994689798 5:103003316-103003338 GACTGAATATTAGAATCATCTGG + Intronic
994691972 5:103030850-103030872 GACTGCACAATAGAAACACCTGG - Intronic
995411111 5:111858214-111858236 GAGTGTGCATCAGAATCACCTGG - Intronic
995477218 5:112560462-112560484 GGCTACACATTAGAATCACCTGG + Intergenic
995958222 5:117806361-117806383 GGCTGTACATTAAGATCATCTGG - Intergenic
996138130 5:119870256-119870278 TACTGAACATCAGAATCACCTGG - Intergenic
996545507 5:124674287-124674309 CGCTGCACATTGGAATCAACTGG + Intronic
996688526 5:126311271-126311293 GGCTGCACATTAGATTCACCTGG - Intergenic
997551514 5:134757592-134757614 GACTGTACTTCAGAATTACCTGG + Intergenic
997595629 5:135105437-135105459 GACTGCACATGAGAATCAGCTGG + Intronic
997595646 5:135105560-135105582 GGCTGTGCATTACAATCACCTGG - Intronic
997773939 5:136581681-136581703 GGTTGCACATTAGAATCATCTGG + Intergenic
997844616 5:137275555-137275577 GGCTGCACATTAGAATCACCTGG - Intronic
997893140 5:137692992-137693014 GGCTGTACATTAGAAGCACCTGG - Intronic
998347918 5:141480761-141480783 GTCTGCACATTAGGATCAAGTGG - Intronic
998393220 5:141801191-141801213 GACAGTACATTGGAATCATCTGG + Intergenic
998518946 5:142782505-142782527 TGCTGCACATTAGAATCACCTGG - Intronic
998919083 5:147047978-147048000 GACTGTACATAAGATTCACTTGG + Intronic
999222704 5:149994403-149994425 GTCTGCACATTGGAATCACCTGG + Exonic
999376910 5:151093196-151093218 GACTGCACATTTAAATCACCTGG + Intronic
999518943 5:152330623-152330645 GGCTGTATGTTGGAATCAACTGG - Intergenic
999545156 5:152620899-152620921 AGCTGTGCATTAGAATCAGCTGG + Intergenic
999682346 5:154072082-154072104 GGCTGCACATTAGAAACACCTGG + Intronic
999995491 5:157088388-157088410 GACTGTTCACTAGAATCACCTGG + Intronic
1000142126 5:158415700-158415722 GTCTGCACAATAGAATCACCCGG + Intergenic
1000561852 5:162799128-162799150 GGATGTATATTAGAATCACCTGG + Intergenic
1000760406 5:165216468-165216490 GAATGTACATCAGAATCACTGGG + Intergenic
1000911244 5:167025045-167025067 ACCTGTACCTTAGAATCAACTGG - Intergenic
1001047005 5:168381610-168381632 GGTTGAACATTAGAATCACCCGG - Intronic
1001066260 5:168537221-168537243 GGCTGTACCTTAGAATCACGTGG - Intergenic
1001089072 5:168723747-168723769 AGCTGCACATTAGAATCACCTGG + Intronic
1001165574 5:169362559-169362581 GGCTGCACATTGGAATCACCTGG + Intergenic
1001327247 5:170738043-170738065 GGCTGCACATCAGAATCACCTGG + Intergenic
1001740377 5:174048238-174048260 AACTGCATATTAGAATCACCTGG + Intronic
1002364621 5:178700337-178700359 GACTCTACAATGGAATCAGCTGG + Intergenic
1002899395 6:1398387-1398409 GAGTGCACATCAGAATCACCTGG + Intergenic
1002965426 6:1961356-1961378 CTCTGTACATAAAAATCAACTGG - Intronic
1002995258 6:2277070-2277092 GACTATGCATTAGAATCACCTGG - Intergenic
1003044416 6:2720051-2720073 GTCTGTGTATTAGAATCACCTGG - Intronic
1003046069 6:2733901-2733923 CACTGTAGATAAGAATCACCTGG - Intronic
1003238043 6:4316332-4316354 GGCTGCACATCAGAATCACCTGG + Intergenic
1003316322 6:5015454-5015476 GGCTGCACATTAAAATCACCTGG + Intergenic
1003422191 6:5968593-5968615 CATTGCACATTAGAATCACCTGG + Intergenic
1003534236 6:6962227-6962249 GACTGTACATTAGAACTACTTGG - Intergenic
1003818379 6:9867087-9867109 GACAGAACATTAGAATTACCTGG - Intronic
1003887074 6:10531516-10531538 GGCTGTACATGAGAATCACTTGG - Intronic
1004478868 6:16000013-16000035 GGCTGCACATTAGAATCACCTGG + Intergenic
1004569854 6:16834652-16834674 GGCTGTACCTTAGAATCACCTGG - Intergenic
1004602901 6:17167633-17167655 GATTGCATATTAGAATCATCTGG + Intergenic
1004634783 6:17456222-17456244 GTGTGTCCATCAGAATCAACTGG - Intronic
1004689242 6:17977201-17977223 GAATGTGCATCAGAATCACCTGG - Intronic
1004705969 6:18124036-18124058 GGCTGTACATTATAATCACCTGG - Intergenic
1004762952 6:18690817-18690839 GACTGTACATTAGAATCATTTGG - Intergenic
1004850480 6:19693512-19693534 GATTGTACATTAGAATCACCTGG - Intergenic
1004866586 6:19858796-19858818 GGCTGCACATTGGAATCACCAGG + Intergenic
1004896718 6:20155294-20155316 GAGTGTGCATCAAAATCAACTGG - Intronic
1004990014 6:21126333-21126355 GATGGCACATTAGAATCAGCTGG + Intronic
1005014150 6:21361467-21361489 GGCTGTACATTAGAATCACCTGG - Intergenic
1005337073 6:24807981-24808003 AACTTTATATTAGAATCACCTGG + Intronic
1005357342 6:24997214-24997236 AACTGTATATTAGAATCACCTGG - Intronic
1006367894 6:33626313-33626335 GGCTGTACCTGAGAATCACCTGG + Intronic
1006526178 6:34607169-34607191 GACGGTGCATTGGCATCAACTGG - Intronic
1006627778 6:35409811-35409833 GGCTGTACATTACAATCACCAGG + Intronic
1006893351 6:37448830-37448852 GCCTGCACAGTAGAATCATCTGG + Intronic
1006972577 6:38062018-38062040 GTCTGCACATTAGAATCCACTGG + Intronic
1007014528 6:38450842-38450864 GAGTGTACATTAGAATCACCTGG - Intronic
1007102169 6:39256727-39256749 GTCAGCACATTAGAATCCACTGG + Intergenic
1007144590 6:39615604-39615626 GGCTGCACACTAGAATCACCTGG - Intronic
1007565302 6:42845733-42845755 AACAATACATCAGAATCAACTGG + Intronic
1007687947 6:43678344-43678366 GGCTGCACATTAGAATCACCTGG - Intronic
1007713161 6:43837637-43837659 GGCTGCCCATTAGAATCACCTGG - Intergenic
1007715507 6:43853390-43853412 GAGTGCACAGAAGAATCAACTGG + Intergenic
1007832767 6:44651448-44651470 GGCTGCACAGTAGAATCACCTGG + Intergenic
1007926698 6:45655472-45655494 GACTGCACATTAAAATCACCTGG - Intronic
1008000921 6:46358767-46358789 GGCTGTACTTTAGAATCACCTGG + Intronic
1008128203 6:47691808-47691830 GAATGTACATTAGAATCACCCGG - Intronic
1008174476 6:48250549-48250571 GACTACACATTAGAATCACCTGG + Intergenic
1008335570 6:50300684-50300706 GACTGTACATTAGAATTGCCTGG + Intergenic
1008371033 6:50730809-50730831 CACTATACATCAGAATCACCTGG - Intronic
1008716147 6:54292403-54292425 GGCTGAAGATTAGAATCACCTGG - Intergenic
1008759498 6:54836897-54836919 GAATTTAAATTAAAATCAACTGG + Intergenic
1008872719 6:56290910-56290932 GGCTGCACATTTGAATCACCTGG - Intronic
1009027484 6:58017148-58017170 CAGTGTTCATTAGAATCACCTGG - Intergenic
1009203016 6:60768624-60768646 CAGTGTTCATTAGAATCACCTGG - Intergenic
1009796117 6:68470355-68470377 GCCTGTACATTAGAATATAGTGG + Intergenic
1009935548 6:70230716-70230738 GGCTGCACATTAAAATCACCTGG + Intronic
1010169435 6:72957576-72957598 GGCTGCATATTAGAATCATCAGG - Intronic
1010629593 6:78182261-78182283 GGCTATACATTAAAATCAACTGG + Intergenic
1010720916 6:79282506-79282528 GAGGGTACATTAGAATCATCTGG + Intergenic
1010871782 6:81051368-81051390 TACTGCACATTTGAATCACCTGG - Intergenic
1010903776 6:81460250-81460272 GGCTGATCATTAGAATCACCTGG + Intergenic
1010952043 6:82048660-82048682 GGCTGTACAAGAGAATCATCTGG + Intergenic
1011013309 6:82726436-82726458 GTCTGTATATTAGAATCACCTGG - Intergenic
1011163469 6:84419198-84419220 GACTGTACATTAGGATCACCTGG + Intergenic
1011163485 6:84419323-84419345 GACTGTGCATTGGAATCACCTGG - Intergenic
1011329631 6:86189159-86189181 GGCTATGCATTAGAATCACCTGG - Intergenic
1011347435 6:86387422-86387444 GACAGCACATTTGAATCACCTGG + Intergenic
1011352576 6:86438720-86438742 CACTGTGCATCAGAATCACCTGG + Intergenic
1011385155 6:86788464-86788486 GACTGTACATAAAAATACACAGG - Intergenic
1011401344 6:86965538-86965560 GACTGCACATTAGAACCACCTGG - Intronic
1011452158 6:87504957-87504979 TAGCGTACATCAGAATCAACTGG + Intronic
1011663111 6:89610995-89611017 GGGTGCACATTAGAATCACCTGG - Intronic
1011663633 6:89615226-89615248 GGCTGCATATGAGAATCAACAGG + Intronic
1011695813 6:89911648-89911670 GGCTGCAAATTAGAATCACCTGG - Intergenic
1011984439 6:93425039-93425061 CACTGAACATTATAATCATCTGG + Intergenic
1012185520 6:96210393-96210415 GAATGCACATTAGAACCATCTGG + Exonic
1012394147 6:98776282-98776304 CAGTGTGCATTAGAATCACCTGG - Intergenic
1012784673 6:103608392-103608414 GACTGCACATTAGAATCATCTGG - Intergenic
1012871814 6:104682148-104682170 GAGTGTGCATCAGAATCACCTGG + Intergenic
1013024449 6:106256450-106256472 GGCTATATATTAGAATCATCTGG - Intronic
1013461352 6:110378010-110378032 GACTGTGCATTAGAATCACCTGG - Intergenic
1013646477 6:112146531-112146553 TAGTGTGCATTAGAATCACCTGG - Intronic
1013783012 6:113749277-113749299 GACTATACATGAGAATCACCTGG - Intergenic
1013925767 6:115469597-115469619 AAGTATACATTAGAATCAAAAGG - Intergenic
1013970268 6:116009395-116009417 TAATGTACATTAGATTCAGCTGG - Intronic
1014610509 6:123539047-123539069 GTCTGTACATGAGAATTATCTGG + Intronic
1014627836 6:123751489-123751511 GGCAGCACATTATAATCAACTGG + Intergenic
1014695863 6:124621041-124621063 GGCTGCACATTGGAATCACCTGG + Intronic
1014868107 6:126556783-126556805 GGCTGCACATTGGAATCACCTGG - Intergenic
1015033570 6:128625743-128625765 GACAGTGCATTGGAATCACCTGG + Intergenic
1015092389 6:129374383-129374405 GACTGCACATTGGAATTACCAGG + Intronic
1015118802 6:129678609-129678631 GCCTGCACATTAGAATCACCTGG + Intronic
1015143922 6:129964679-129964701 AACTGTACATATGAATCATCTGG - Intergenic
1015662130 6:135587978-135588000 GGCTGCACATTAGAATCTCCTGG + Intergenic
1015726580 6:136305701-136305723 GAATGTACATTACAGTCACCTGG - Intergenic
1015859356 6:137659355-137659377 GGCTGCAAATTAGAATCACCTGG + Intergenic
1016066936 6:139693309-139693331 GTCTGTTCATGAGAATCACCTGG - Intergenic
1016268166 6:142256515-142256537 AACTGAATATTAGAATCACCTGG + Intergenic
1016279882 6:142404332-142404354 AACTGAACATTAGAATCTTCTGG + Intronic
1016376896 6:143430407-143430429 GACTGCCCGTTAGAATCACCTGG - Intronic
1016462573 6:144292522-144292544 GGCTGTACAGATGAATCAACTGG + Intronic
1016582848 6:145648710-145648732 TAATGTACATTAGAATCATTTGG - Intronic
1016608404 6:145961226-145961248 GACTGCACATTAGAATCACCAGG + Intronic
1016696530 6:147002718-147002740 GGCTGCACATTAGAATCATCTGG + Intergenic
1017033728 6:150248262-150248284 GAGTGTGCATCAGAATCACCAGG - Intronic
1017034100 6:150251566-150251588 GAGTGTACATTTGAATCACTGGG + Intergenic
1017191679 6:151660989-151661011 AACTTCACATTAGAATCAGCTGG - Intronic
1017275998 6:152569201-152569223 GATTGTGCATAAGAATCACCTGG - Intronic
1017401250 6:154066118-154066140 GATTATACATTATAATCAACTGG - Intronic
1017487147 6:154913911-154913933 GTCTGCATATTAGAATCACCTGG + Intronic
1017574337 6:155785641-155785663 GGCTGCATATTAGAATCATCTGG + Intergenic
1017625373 6:156342151-156342173 GACTACACACTAGAATCACCAGG + Intergenic
1017687636 6:156928988-156929010 AACTGTACACTAGAGACAACTGG - Intronic
1020675718 7:11182746-11182768 GACTGCACATTAGAATCACCTGG - Intergenic
1020823104 7:12994962-12994984 GACTGTGCATTACAATCATTGGG + Intergenic
1020957144 7:14754232-14754254 TAGTGTACCTCAGAATCAACCGG - Intronic
1021067920 7:16199180-16199202 GGTTGTACATTACAATCACCTGG + Intronic
1021121025 7:16796041-16796063 GGCTGCACATTGGAATCATCTGG + Intronic
1021239719 7:18185232-18185254 GACTATACATTAAAATAACCTGG + Intronic
1021362765 7:19736568-19736590 GACTGTACACTAGAATCACCTGG - Intronic
1021521798 7:21546007-21546029 CACTGTACATTAGAATCACCTGG - Intronic
1021563159 7:21988890-21988912 GGCTGAACATTAGAATCACCTGG + Intergenic
1021591752 7:22271152-22271174 GACTGCACATTAGAATCATTTGG + Intronic
1021614190 7:22486157-22486179 GACTGTACAATGAAATCACCTGG - Intronic
1021619280 7:22535551-22535573 GAGTGTGTATTAGAATCACCTGG + Intronic
1021628258 7:22616130-22616152 GACTGCACATTGGAATCTCCTGG - Intronic
1021631468 7:22651700-22651722 GGTTGCACATTAGAATCACCTGG + Intergenic
1021799314 7:24287939-24287961 GGCTGCACATTAGAATCACCTGG - Intronic
1021808640 7:24381193-24381215 GACTGCACGTTGGAATCACCTGG + Intergenic
1021816362 7:24451204-24451226 GGCTGTACATTAGACCCACCTGG + Intergenic
1021886910 7:25148208-25148230 GGCTGCACATTAGAATCACCAGG - Intronic
1021900730 7:25282602-25282624 GGCTGCACGTTAGAATCACCTGG + Intergenic
1022115701 7:27258652-27258674 CACTGTACATCAGGATCACCTGG - Intergenic
1022190531 7:28013165-28013187 GACTGCACATGAGAGTCACCGGG - Intronic
1022190569 7:28013414-28013436 GAGTGTGCATCAGAATCACCTGG + Intronic
1022300802 7:29100404-29100426 GCCTGCACATTAGAACCACCTGG - Intronic
1022616789 7:31940034-31940056 GGCTGCACATTAGAATCACCGGG + Intronic
1022755752 7:33287163-33287185 GACTTAAAATTAGAATCAAAAGG + Intronic
1022759379 7:33331060-33331082 GACAGTACATTATGATCAAGTGG + Intronic
1022836684 7:34123536-34123558 GATTGCACTTTAGAATCATCAGG - Intronic
1022978694 7:35581856-35581878 GGCTGAACATTACAATCACCTGG - Intergenic
1023077512 7:36498692-36498714 GGCTGTACATTGGAATAACCCGG - Intergenic
1023135125 7:37043708-37043730 GCCTGCACATTAGATTCACCGGG - Intronic
1023663597 7:42495801-42495823 GGCTGTAGCTTAGAATCACCTGG + Intergenic
1023925699 7:44667967-44667989 GGCTGGACATTAGAACCACCTGG + Intronic
1024099384 7:46015062-46015084 GATAATACATTACAATCAACTGG + Intergenic
1024499385 7:50087307-50087329 GATTATACATCATAATCAACTGG + Intronic
1024528986 7:50374947-50374969 CAGTGTACATTAGAATCTTCTGG + Intronic
1024589084 7:50865416-50865438 GACTCAACATTTGCATCAACAGG - Intergenic
1024604167 7:51011194-51011216 CACTGCACACTAGAATCCACGGG - Intergenic
1024920457 7:54548524-54548546 GAGTGTACATTAGAATCACCTGG - Intronic
1024938773 7:54740536-54740558 GTCTGCACATTAGAATCACCTGG + Intergenic
1026173502 7:67975068-67975090 GATTGCATATTAGAATCATCTGG - Intergenic
1026598533 7:71754147-71754169 GGCTGCACATTTGAATCATCTGG - Intergenic
1027860685 7:83575462-83575484 GATTCTACATTAAATTCAACAGG + Intronic
1028229980 7:88295505-88295527 GGCTGTACATTTGAATCACCTGG - Intronic
1028347491 7:89800092-89800114 GGCTGCACATTGGAATCACCTGG - Intergenic
1028371981 7:90102039-90102061 GAGTGTGTATTAGAATCACCTGG - Intergenic
1028673411 7:93430822-93430844 GAGTGTACATCAGAATCACCTGG - Intronic
1028675854 7:93459683-93459705 GGCTGCACTTCAGAATCAACAGG - Intronic
1028718506 7:94002581-94002603 GACTGTACATTAGAATCCCTTGG - Intronic
1028841338 7:95433024-95433046 GACTGCTCATTAGAATTATCAGG + Intronic
1028841379 7:95433450-95433472 CTCTGTACATTAGAATCTCCTGG - Intronic
1028876164 7:95825630-95825652 GGCTGCACATTAGAATCACCTGG + Intronic
1029063719 7:97826614-97826636 GTCTGCACATTAGAATCACTGGG - Intergenic
1029255969 7:99269837-99269859 GGCTATACATTAGACTCATCTGG + Intergenic
1029315347 7:99707383-99707405 AGCTGTACATTGGAATCACCAGG - Intronic
1029321067 7:99760390-99760412 AGCTGTACATTGGAATCACCAGG - Intronic
1029982783 7:104894939-104894961 GAGTGTACATGAGAATCACCTGG + Intronic
1030120621 7:106107377-106107399 TATTGTACATTAGAAGCAAAGGG - Intronic
1030294959 7:107914691-107914713 GAATGTATATTAAAATCATCTGG - Intronic
1030317102 7:108127152-108127174 TACTGCACATTAAAATCACCAGG + Intronic
1030318741 7:108142801-108142823 GGCTGCATATTAGAATCATCTGG + Intergenic
1030356729 7:108551717-108551739 TGCTGTTCATTAGAATCACCTGG + Intronic
1030363772 7:108623698-108623720 TACTGTACATTAGAAATACCTGG - Intergenic
1030726541 7:112932825-112932847 GAGTTTACATTACAATAAACTGG + Intronic
1030861637 7:114638771-114638793 GTCTGCATATTAGAATCACCTGG - Intronic
1030895710 7:115057489-115057511 GAGGGCACATTAGAATCATCTGG - Intergenic
1030995192 7:116351624-116351646 GGTTGCACATTAGAATCACCTGG - Intronic
1031044032 7:116867033-116867055 CCCTGTACCTTACAATCAACTGG + Intronic
1031044436 7:116871895-116871917 GGCTGCACATTAGAATCAACTGG + Intronic
1031469759 7:122155246-122155268 GAGTGTGCATCAGAATCACCAGG + Intergenic
1031531357 7:122880598-122880620 GACTGTACACTGAAATCAATTGG + Intronic
1031531370 7:122880703-122880725 AACTGCACATTAGAATCACCTGG - Intronic
1031771163 7:125846286-125846308 GCCTGCATATTAAAATCAACTGG - Intergenic
1031793125 7:126135347-126135369 GCCTGTACATTAGAATCACCTGG - Intergenic
1031845008 7:126794899-126794921 GGCTGTACATTATACTCACCTGG + Intronic
1031993555 7:128213249-128213271 GAATGTGCATCAGAATCACCTGG - Intergenic
1032023992 7:128426935-128426957 TGCTGTACATTAGAAACACCTGG - Intergenic
1032128231 7:129210068-129210090 GGGTGCTCATTAGAATCAACTGG - Intronic
1032215526 7:129954098-129954120 CACTGTGCATAAGAATCACCTGG - Intergenic
1032545836 7:132741654-132741676 AGCTGTACATTAGAATCACTAGG + Intergenic
1032693997 7:134317394-134317416 GTCTGTACATTGGAATCACTTGG + Intergenic
1032956387 7:136976678-136976700 GACTAGACATTAGCAACAACAGG + Intronic
1033159912 7:138986099-138986121 GACTGCAAATTAAAATCACCTGG + Intergenic
1033387313 7:140890740-140890762 GCCTGTACATCAGAAGCACCTGG - Intronic
1033932621 7:146543218-146543240 GGTTGAACATTAGAATCACCTGG - Intronic
1034044871 7:147917151-147917173 GGCTTCACATTAGAATCACCTGG + Intronic
1034486339 7:151366416-151366438 GGCTGTACACTAGAATCAGCTGG + Intronic
1034782595 7:153894547-153894569 GGCTGAACAGTAGAATCAGCTGG + Intronic
1035126408 7:156611073-156611095 GGCTGTACATTGGAATCACCTGG - Intergenic
1036036061 8:5020659-5020681 TAATGCACATTAGAATTAACTGG - Intergenic
1036971477 8:13360276-13360298 GCCTGCACATTAGAATCACATGG + Intronic
1037352362 8:17974780-17974802 GACTGTACATTTCAAACAGCAGG - Intronic
1038077444 8:24092018-24092040 TACTGCACATTAGAATCACCAGG - Intergenic
1038329039 8:26593251-26593273 GACTGCACATTAGAATCCCCTGG + Intronic
1038559839 8:28564471-28564493 GGCTGCAGATTAGAATCACCTGG - Exonic
1039019723 8:33191582-33191604 GGCTTCACATTAGAATCACCTGG + Intergenic
1039227583 8:35404891-35404913 GAATGTACATAAGAATCACATGG - Intronic
1039254320 8:35702422-35702444 GGCTGCATATTAGAATCACCTGG - Intronic
1039569875 8:38578225-38578247 GGCTGCACATTGGAATCACCTGG - Intergenic
1039987935 8:42463708-42463730 GGCTGTACTTTAGAATGACCCGG - Intronic
1040423571 8:47261849-47261871 GACTGTATCTTATAATCAAGAGG - Intronic
1040697909 8:50024271-50024293 GATTGTGCATCAGAATCACCTGG - Intronic
1040979697 8:53233845-53233867 GGCTGCACATTGGAATCACCTGG - Intronic
1041247715 8:55904921-55904943 GGCTGCTCATTAGAATCAATGGG + Intronic
1041528918 8:58840496-58840518 GGCTGCACATTAGAGTCACCTGG + Intronic
1042063529 8:64848042-64848064 GACTAGATATTAGAATCAATTGG + Intergenic
1042510894 8:69609749-69609771 GACTGCACGTTAGAATCATATGG + Intronic
1042511603 8:69618061-69618083 AACTGCACATTAGAATCATCTGG + Intronic
1042536876 8:69867967-69867989 GGATGTACAATAGAGTCAACTGG - Intergenic
1042687617 8:71460348-71460370 GGCTGCACATTCGAATCATCTGG - Intronic
1042714984 8:71762776-71762798 AACTATACATTAAAATCACCTGG - Intergenic
1042714992 8:71762841-71762863 GGCTGTACATTAGAATCACCTGG + Intergenic
1042715006 8:71762961-71762983 GGCTGAACGTTAGAATCACCTGG - Intergenic
1043389796 8:79781441-79781463 GGCTGCATATTAGAATCACCTGG - Intergenic
1043423547 8:80125035-80125057 ACTTGTACATTAGAATCATCAGG - Intronic
1043571053 8:81602671-81602693 GGCTGTACGTTAGAACCACCTGG - Intergenic
1043749539 8:83918205-83918227 GTCTGTACATTAGAATCAGCCGG - Intergenic
1043915026 8:85912384-85912406 GCCTGTATATTTGAATCATCTGG - Intergenic
1043960668 8:86414664-86414686 GGCTGTACATTACAATCAACAGG - Intronic
1044065641 8:87696609-87696631 CACAATGCATTAGAATCAACTGG + Intergenic
1044076641 8:87830726-87830748 AACTGCACATCAGAATCAGCTGG + Intergenic
1044319827 8:90790087-90790109 GCCTGTACATTGGAATCACCTGG - Intronic
1044654902 8:94537394-94537416 GGCTGTACATTAGAATTACCTGG - Intronic
1044824949 8:96186841-96186863 GGCTATACATTAGAATTACCAGG + Intergenic
1044877631 8:96686102-96686124 GACAGCACAAGAGAATCAACTGG - Intronic
1044912962 8:97081451-97081473 GACTGTACTTTAAAATCACCTGG + Intronic
1045261192 8:100575888-100575910 GGCTGCACATTGGAATCACCTGG - Intronic
1045327394 8:101127057-101127079 GGCTGTCCATTAGAATCATTGGG + Intergenic
1045572138 8:103379011-103379033 GGCTGAACATTAGAATGACCAGG - Intronic
1045760465 8:105600156-105600178 CACTGTAGACTAAAATCAACAGG - Intronic
1045838768 8:106554778-106554800 GGTTGTCCATTAGAATCAGCAGG + Intronic
1045982696 8:108210199-108210221 GACAACACATTAGAATCAAATGG - Intronic
1046391591 8:113579922-113579944 GGATGTACATTAAAATCACCTGG + Intergenic
1046597274 8:116274923-116274945 GATTGTGCAATAGAATCAGCTGG - Intergenic
1046713673 8:117543820-117543842 GGCAGCACATTAGAATCAACTGG + Intergenic
1046820049 8:118624081-118624103 GGCTGAACATTAGAATCACCTGG + Intergenic
1047023136 8:120798174-120798196 GATTGTAGATTAGAACCACCTGG + Intronic
1047245698 8:123142131-123142153 GGCTGCATATTAGAATCACCTGG - Intronic
1047326311 8:123839587-123839609 GGCTGTTCATTAGAATCACCTGG - Intergenic
1047506079 8:125481597-125481619 GACTGCACATTTGAATCACCTGG - Intergenic
1047685381 8:127299992-127300014 GGGTGTACATCAGAATCACCTGG + Intergenic
1047696585 8:127409452-127409474 GGCTTCACATTAGAATCACCTGG + Intergenic
1047723040 8:127659896-127659918 GGCTGCACATGAGAATCATCTGG + Intergenic
1047786236 8:128156324-128156346 GGCTATATATTAGAATCACCTGG - Intergenic
1047953612 8:129956330-129956352 TCCTGAACATTAGAATCATCTGG + Intronic
1048285495 8:133138061-133138083 GACCGTTCATTGGAATCACCTGG + Intergenic
1049209593 8:141379385-141379407 GCCTGTGCATCAGAATCACCGGG + Intergenic
1049927550 9:424224-424246 GGCTGCACATTAGAATCACCTGG + Intronic
1049967684 9:794088-794110 CACTGTACATCAGAATCACCTGG + Intergenic
1050072029 9:1825236-1825258 GGTTGCACATTAGAATCACCTGG + Intergenic
1050150409 9:2614206-2614228 GAATGCACATTAGACTCACCTGG + Intergenic
1050237755 9:3599993-3600015 GGCTGAACATTAGAGTCACCTGG + Intergenic
1050530628 9:6585966-6585988 GACTGTGTATTAGAATCACTTGG + Intronic
1050614005 9:7382771-7382793 GGCTGTACATTGGAATCACCTGG + Intergenic
1050648035 9:7743260-7743282 AACTGTGCCTTAGAATCAGCTGG + Intergenic
1050682082 9:8123517-8123539 GATTGCACATTAGAATTACCTGG + Intergenic
1050725738 9:8646027-8646049 AACTGGACATTAGAATCACCTGG + Intronic
1051173215 9:14340492-14340514 CACTGCACATTAGAATCATCTGG - Intronic
1051420914 9:16888389-16888411 GACTGCACATTAGAATCACTTGG - Intergenic
1051467482 9:17396764-17396786 GTCTGCACATTGGATTCAACAGG - Intronic
1051556047 9:18383872-18383894 TACTGTACATATGAATCACCTGG + Intergenic
1051616993 9:19015986-19016008 CAGTGTACCTGAGAATCAACTGG - Intronic
1051750256 9:20334100-20334122 GACTGCATATTAGAATAATCTGG + Intergenic
1052324906 9:27207101-27207123 GAGTGTGCATCAGAATCACCTGG + Intronic
1053226697 9:36364730-36364752 CAATGTGCATTAGAATCACCTGG + Intronic
1053257807 9:36633446-36633468 GACTGCACATGAGAAACACCTGG - Intronic
1053332872 9:37232322-37232344 GGCTACACATTAGAATCATCTGG + Intronic
1053405523 9:37872076-37872098 TACTGTGCATTAGAATCACCTGG + Intronic
1054721381 9:68607441-68607463 GGAGGTACATTAGAATCACCTGG + Intergenic
1054762960 9:69019721-69019743 GGCTGTGCATTAGAATCACCTGG - Intergenic
1054866436 9:70007013-70007035 GACTGCACTTTACAATCACCTGG - Intergenic
1054907917 9:70426850-70426872 TACTGTGCATAAGAATCACCTGG + Intergenic
1054931765 9:70642514-70642536 TGCTGCACATTAGAATCACCTGG + Intronic
1055051469 9:71985599-71985621 GGCTGCACATTAAAATCATCTGG + Intronic
1055222880 9:73959229-73959251 GGATGCACATTAGAATCACCTGG - Intergenic
1055501652 9:76907376-76907398 AACTGCACATTAGAATCACTTGG - Intergenic
1055612627 9:78038619-78038641 GGCTGCACATTAGCATCACCTGG + Intergenic
1055699624 9:78928940-78928962 TGCTGTACATCAGAATCAGCTGG + Intergenic
1055760247 9:79599335-79599357 GCCTGCACATTAGATTCACCTGG + Intronic
1056225503 9:84491058-84491080 GACTGTACTTTAGAATCACCTGG - Intergenic
1056905556 9:90644683-90644705 GCCTGCACATTAGAATCAGCAGG + Intergenic
1056987612 9:91377998-91378020 GGCTGTACATTGGAATCATCTGG - Intergenic
1057903951 9:98970068-98970090 GGCTGCACAGTAGAATCACCTGG - Intronic
1058389082 9:104473747-104473769 AAGTGTACATAAGAATCACCTGG - Intergenic
1058389097 9:104473932-104473954 GACTGCACATTAGAATCACCTGG - Intergenic
1058695369 9:107554497-107554519 GGCTGCACAATAGAATCACCTGG - Intergenic
1058883609 9:109306288-109306310 GACTGCACCTCAGAATCACCTGG + Intronic
1058956925 9:109957822-109957844 GAATCTCCATTAGAATCACCTGG - Intronic
1059082118 9:111261325-111261347 GTCTGCACATTAGAATCACTAGG + Intergenic
1059082183 9:111261773-111261795 GCCTGGCCATTAGAATCACCTGG - Intergenic
1059107364 9:111523388-111523410 TACTGTACTTTAGAATCACATGG - Intergenic
1059250609 9:112884518-112884540 GGTTGTACATTTGAATCACCTGG + Intronic
1059407680 9:114111967-114111989 GGCTGTGCATTAGAGTCACCTGG - Intergenic
1059585669 9:115603442-115603464 GACTATACATTATAATCACCTGG + Intergenic
1059609924 9:115881659-115881681 GGCTGCACATTAGAATCTCCTGG + Intergenic
1059778454 9:117501016-117501038 GACTGGACACTGGAATCACCTGG + Intergenic
1059785135 9:117573902-117573924 GACTGAACATTGGAATCACATGG + Intergenic
1059864877 9:118503347-118503369 GACTGTGTATTAGAATCACCTGG - Intergenic
1059948224 9:119434953-119434975 GGCTGTCCATTAGAATCACCTGG - Intergenic
1059967707 9:119632158-119632180 CACTGTGCATTAGAATTACCTGG + Intergenic
1059967842 9:119633431-119633453 GGTTGCACATTAGAATCACCTGG - Intergenic
1060289136 9:122284207-122284229 GGCTGTGCATCAGAATCACCAGG - Intronic
1060326866 9:122625242-122625264 CACTGTGCGTTAGAATCACCTGG - Intergenic
1060627521 9:125127176-125127198 GCCTGTACATCAGAATCCCCAGG + Intronic
1060863918 9:126979822-126979844 GGCTGCACATCAGAATCACCTGG + Intronic
1061772218 9:132934488-132934510 GGATGTACATCAGAATCACCTGG + Intronic
1186263078 X:7801895-7801917 GGCTGCACATTAGAATAACCTGG - Intergenic
1186859314 X:13655773-13655795 GGCTGCACATTAGAATCCTCTGG - Intronic
1186892036 X:13968458-13968480 GACTACACATTAGAATCCCCTGG + Intergenic
1186956809 X:14691557-14691579 GCCTGCACATTAGAATCGCCTGG + Intronic
1186970181 X:14833639-14833661 GGCTGTACATTAGAATCACCTGG + Intergenic
1186980389 X:14952234-14952256 GGCTGCACATTGGAATCACCAGG - Intergenic
1186990144 X:15058099-15058121 GGCTGCACATTAGAATCCCCTGG - Intergenic
1187205087 X:17174471-17174493 GGCTGCACATTAGAATCACCTGG - Intergenic
1187224633 X:17363513-17363535 GGCTGTACATTAGAAACACCTGG + Intergenic
1187254633 X:17630830-17630852 GACTGCACCTCAGAATCACCTGG + Intronic
1187377693 X:18770978-18771000 GACTGCACATTAGAATCACCTGG - Intronic
1187407416 X:19016316-19016338 AACTGTACATTAGAAATACCTGG - Intronic
1187407771 X:19019396-19019418 AGCTGCACATTAGAATCACCTGG - Intronic
1187427694 X:19193218-19193240 GACTGCATAGTAGAATCACCCGG - Intergenic
1187431482 X:19229101-19229123 GGCTGCACATTAGAATCTCCTGG - Intergenic
1187439075 X:19301433-19301455 GGCTGAACATTAAAATCACCTGG + Intergenic
1187441642 X:19326171-19326193 GGCTTTACATTAGAATCACCTGG - Intergenic
1187455243 X:19435847-19435869 GGCTGCATATTAGAATCACCTGG + Intronic
1187487168 X:19715566-19715588 GGCTGCACATTAGAATCACATGG - Intronic
1187638041 X:21254687-21254709 AGCTGTACATTAGTATCACCTGG + Intergenic
1187696708 X:21929734-21929756 GGCTGCATATTAGAATCAACTGG - Intergenic
1187718824 X:22130905-22130927 GACTGCACATTAGAATTACCTGG + Intronic
1187720438 X:22145208-22145230 GGCTGTACATTAGAATCACCTGG + Intronic
1187753573 X:22495072-22495094 GGCTGCATATTAGAATCACCTGG + Intergenic
1187753642 X:22495748-22495770 GGCTGCACATTAGAATCCCCCGG - Intergenic
1187799956 X:23050562-23050584 CAGTGTACATCAGAATCAACTGG + Intergenic
1187809775 X:23162825-23162847 GGATGGACATTAGAATCAACTGG + Intergenic
1187985733 X:24808537-24808559 GACTGTACAGTGGAATCACCTGG - Intronic
1188012909 X:25076341-25076363 GGCTATACATTAGAATCACCTGG + Intergenic
1188054026 X:25521177-25521199 GGCTGCACATTAAAATCACCTGG + Intergenic
1188054042 X:25521284-25521306 GGCTACACATTAGAATCACCTGG - Intergenic
1188160984 X:26802145-26802167 GGCTGCACATTAGAATCACTTGG - Intergenic
1188314408 X:28656136-28656158 CACTTGACATTAGAAGCAACTGG - Intronic
1188387392 X:29577915-29577937 GGCTGTACATTAGAATCACCTGG + Intronic
1188460983 X:30426871-30426893 AGCTGTACATTAGAATCACCTGG - Intergenic
1188485437 X:30676517-30676539 GGATGCACATTAGAATCACCTGG + Intronic
1188580212 X:31702638-31702660 GTCTGTGCATTTGAATCAAGAGG + Intronic
1188620604 X:32218277-32218299 GACTGTACATTGAAATCACCTGG - Intronic
1188637389 X:32451263-32451285 GAATGGACATCAGAATCACCTGG - Intronic
1189102960 X:38210112-38210134 GAGTGTACATAAGAATCATTTGG + Intronic
1189128146 X:38469915-38469937 CAATGTACATTAGAATCACCTGG + Intronic
1189141375 X:38610486-38610508 GACTGCGCATTAGAATCACCTGG + Intronic
1189149620 X:38691867-38691889 GCCTGAACATTCTAATCAACTGG - Intergenic
1189236907 X:39494313-39494335 GCCTGCACATTGGAATCACCTGG - Intergenic
1189446975 X:41088932-41088954 GACTGGACATGAGAATCACTTGG + Intronic
1189534099 X:41918958-41918980 GGCTGCATATTAGAATCATCCGG - Intronic
1189841614 X:45084978-45085000 GGCTGTATATTAGAATCCTCTGG - Intronic
1190390958 X:49931117-49931139 GTTTGCACATTAGAATCACCTGG - Intronic
1190407429 X:50101771-50101793 AGCTGTACATCAGAATCATCTGG + Intergenic
1190484346 X:50910068-50910090 GGCTGTAGATTGGAATCATCTGG - Intergenic
1191677778 X:63809780-63809802 GGCTGTACATGAGAATCAGCTGG + Intergenic
1191755485 X:64587992-64588014 GACTGCACATTAGAATCACCTGG + Intergenic
1191858072 X:65643634-65643656 GGCTGCACATTAGAATCACTTGG - Intronic
1191953839 X:66623151-66623173 GACTGCACATGAGAATCACTTGG - Intronic
1192182740 X:68926622-68926644 GGCTTCACATTAGAATCACCTGG - Intergenic
1192237769 X:69306695-69306717 GGCTGCACACTAGAATCACCTGG - Intergenic
1192535789 X:71926451-71926473 AACTGTATTTTAGAATCACCGGG + Intergenic
1192624034 X:72709632-72709654 GGCTATACATTAAAATCACCCGG + Intronic
1193333435 X:80260743-80260765 GGCTGCACATTAAAATCATCTGG + Intergenic
1193754083 X:85385029-85385051 TAGTGTACATCAGAATCACCAGG - Intergenic
1193979464 X:88163798-88163820 CAATGTACATTAGAATAAAAAGG + Intergenic
1194371650 X:93080601-93080623 GGCTGCAGATTATAATCAACTGG + Intergenic
1195039468 X:101001126-101001148 GACTGCATACTAGAATCACCGGG + Intergenic
1195308981 X:103611628-103611650 CACTGTACATCAGAATCACCTGG - Intronic
1195373250 X:104200878-104200900 GGCTGAACATCAGAATCATCCGG + Intergenic
1195659033 X:107360498-107360520 GACTGGACATCAGAATCACGTGG - Intergenic
1195675037 X:107501581-107501603 GGCTGCACCTTAGAATCACCTGG + Intergenic
1195770457 X:108345828-108345850 GACTGCACATTAGAATCACTTGG + Intronic
1195879883 X:109581522-109581544 GGCTGTACATTAGAATCATCTGG + Intergenic
1195928642 X:110051225-110051247 GGCTGTACATTGAAATCAGCTGG + Intronic
1195965625 X:110427652-110427674 GACTGTATATTAGAAGCACCTGG - Intronic
1196041957 X:111214428-111214450 GTCTGAACATTAGAATCACTTGG - Intronic
1196062300 X:111423492-111423514 GGCTGTACTTTAGAATCACCAGG - Intergenic
1196111421 X:111951156-111951178 GATTGTACATGAGAATCCTCTGG + Intronic
1196129949 X:112144699-112144721 GAATTCACATTAGAATCACCTGG - Intergenic
1196198975 X:112864116-112864138 GACTGCACATTAAAATCAACTGG + Intergenic
1196747264 X:119082229-119082251 CACTGTGCATCAGAATCACCTGG - Intronic
1196787118 X:119430613-119430635 GGCTGCACATCAGAATCAGCTGG + Intronic
1196910432 X:120479362-120479384 GGCTGTACATTAGAATCATCTGG - Intergenic
1196938681 X:120754375-120754397 GACTATACATTAGAATCATCTGG - Intergenic
1196991003 X:121328622-121328644 AGCTGTACGTTAGAATCACCTGG + Intergenic
1197183007 X:123556722-123556744 GGCTGTACATTGGAATTATCTGG - Intergenic
1197315053 X:124955337-124955359 GACTGGACATTAAAATCATCTGG - Intronic
1197331364 X:125157056-125157078 GGTTGCACATTAGAATCACCTGG + Intergenic
1197379268 X:125719375-125719397 TACTGTCCAGTAAAATCAACTGG - Intergenic
1197657403 X:129132032-129132054 TACTATACATTAGAATCACCTGG - Intergenic
1197676018 X:129331053-129331075 CACTGCACATTAGAATCAGCTGG - Intergenic
1197845565 X:130798293-130798315 GGCTGCACATTAGAATCACCTGG - Intronic
1198013842 X:132588710-132588732 GGCCATACACTAGAATCAACTGG - Intergenic
1198110488 X:133498564-133498586 TGCTGTATATTAGAATCACCTGG + Intergenic
1198110513 X:133498686-133498708 GACTGCACATTAGAATCACCTGG - Intergenic
1198208817 X:134496846-134496868 GATTGCACATCAGAATCACCTGG - Intronic
1198432385 X:136580597-136580619 GCCTGCACAGTAGAATCACCTGG + Intergenic
1198432624 X:136582610-136582632 GCCTGCATATTAGAATCACCTGG - Intergenic
1198732406 X:139746393-139746415 TACTGCACATTGAAATCAACTGG - Intronic
1198786606 X:140295728-140295750 GGCTGTAAATTGGGATCAACTGG + Intergenic
1198992089 X:142526384-142526406 GACAATACATTTGAATCACCTGG + Intergenic
1199034867 X:143038084-143038106 CACTTCACATCAGAATCAACTGG - Intergenic
1199151800 X:144495956-144495978 AGCTGTATATTAGAATCACCTGG + Intergenic
1199161003 X:144611711-144611733 GGCTGTACATTAGAAGCATGTGG - Intergenic
1199429238 X:147740327-147740349 GAATGCACATTAGAATCACCTGG + Intergenic
1199440510 X:147862835-147862857 GGCTGCACATTAGAATCAGTGGG - Intergenic
1199458232 X:148053445-148053467 GGCTGCACAACAGAATCAACTGG + Intergenic
1199470728 X:148192633-148192655 GGCTGCACATTAGAATCACCTGG - Intergenic
1199784586 X:151092964-151092986 GAATGTACTTTAGAAACCACTGG - Intergenic
1199861591 X:151805650-151805672 GGCTGTACATTAGAGTCATCAGG + Intergenic
1199934023 X:152553653-152553675 TGCTGTACATTGGAATCACCTGG - Intergenic
1200679440 Y:6192492-6192514 GGCTGCAGATTATAATCAACTGG + Intergenic
1202304645 Y:23455579-23455601 GGCTGTACAGCAGAATCACCTGG + Intergenic
1202566165 Y:26215012-26215034 GGCTGTACAGCAGAATCACCTGG - Intergenic