ID: 1158251991

View in Genome Browser
Species Human (GRCh38)
Location 18:55499544-55499566
Sequence ACTGTACATTAGAATCAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1630
Summary {0: 1, 1: 6, 2: 68, 3: 404, 4: 1151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158251987_1158251991 20 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251991 18:55499544-55499566 ACTGTACATTAGAATCAACTGGG 0: 1
1: 6
2: 68
3: 404
4: 1151
1158251989_1158251991 13 Left 1158251989 18:55499508-55499530 CCATCTGTTTATGTAGGACAGAA 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1158251991 18:55499544-55499566 ACTGTACATTAGAATCAACTGGG 0: 1
1: 6
2: 68
3: 404
4: 1151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158251991 Original CRISPR ACTGTACATTAGAATCAACT GGG Intronic
901135024 1:6987521-6987543 ACTGGACACTAGAATCATTTGGG - Intronic
903000049 1:20258748-20258770 GCTGCACATTAGAATCATCTGGG + Intergenic
903627808 1:24744190-24744212 AGTGTGCATCAGAATCACCTAGG - Intergenic
904485277 1:30820710-30820732 CTTGCACATTAGAATCAACTGGG - Intergenic
904827183 1:33281227-33281249 GCTGCTCATTAGAATCATCTGGG - Intronic
904953760 1:34266066-34266088 GCTGAATATTAGAATCACCTGGG - Intergenic
905093152 1:35446065-35446087 ACTGTAGATTAAATTCACCTGGG + Intronic
905338145 1:37259569-37259591 GCTGCACATTAGAATCACCTGGG - Intergenic
905439463 1:37985386-37985408 GCTGCACATTAGAATCACCTGGG + Intronic
906282571 1:44564428-44564450 GCTGCACAATAGAATTAACTGGG - Intronic
907183846 1:52594061-52594083 ACTGCACCTTAAAATCAGCTGGG + Intergenic
907183866 1:52594181-52594203 GCTGCACCTTAGAATCACCTGGG - Intergenic
907482695 1:54755549-54755571 ACTGCACATTACAATCAGCTGGG + Intergenic
907970775 1:59378715-59378737 AATATATATTAGAATCAATTAGG - Intronic
908046392 1:60174271-60174293 GTTGAACATTAGAATCATCTGGG + Intergenic
908089369 1:60670217-60670239 ACTACACATTAGAATCACCTGGG - Intergenic
908138604 1:61159382-61159404 AATGTGCATACGAATCAACTGGG + Intronic
908284915 1:62585961-62585983 GCTGCACATTAGATTCACCTGGG - Intronic
908418828 1:63939322-63939344 GCTGCACATTAGGATCACCTAGG - Intronic
908488295 1:64617104-64617126 ACTGAACATCAGAGTCACCTGGG + Intronic
908570367 1:65403637-65403659 ATTGTGCATTAGAATTACCTGGG - Intronic
908626059 1:66043889-66043911 ACTGTAAATTACAGACAACTAGG + Intronic
909040010 1:70638286-70638308 GCTGTACATTAGAATCTCCTAGG - Intergenic
909063596 1:70906351-70906373 ACAGTATATTAGTATCACCTGGG + Intronic
909337783 1:74496026-74496048 GCTGCACATTAGAATCATCTGGG + Intronic
909815492 1:79987408-79987430 ACTGTAAATTAAAATGATCTGGG + Intergenic
910108779 1:83659730-83659752 ATTGTGCATAAGAATCATCTGGG + Intergenic
910260248 1:85287268-85287290 GATCTGCATTAGAATCAACTGGG - Intergenic
910836688 1:91520030-91520052 ATTATGCATTAGAATCACCTTGG - Intronic
911112425 1:94204325-94204347 AGTGCTCATCAGAATCAACTGGG + Intronic
911112865 1:94210298-94210320 GCTGCACATTAGAATTACCTGGG + Intronic
911236261 1:95415579-95415601 AGTGTGCATGAGAATCAACTGGG + Intergenic
912262577 1:108123627-108123649 GCTGAACATTAGAACCACCTGGG - Intergenic
912322129 1:108723870-108723892 ACTGCATAGTAGAATCAACTGGG - Intronic
912428415 1:109614602-109614624 GCTGTACACTAGAATCAGCTGGG - Exonic
912534320 1:110353537-110353559 ACTGCACGTTACAATCACCTGGG - Intergenic
912672226 1:111641390-111641412 GCTATACATTAGATTTAACTGGG + Intronic
912750273 1:112281796-112281818 GCTGTACATTAGAAATATCTGGG + Intergenic
912788858 1:112631088-112631110 GCTACACATTAGAATCACCTGGG - Intronic
913090963 1:115476250-115476272 GCTGCACATTGGAATCACCTGGG - Intergenic
913235029 1:116773142-116773164 ACTATACATTACAACCAAGTGGG + Intergenic
913414660 1:118591614-118591636 CCTGCACATTAAAATCATCTGGG + Intergenic
913691710 1:121285845-121285867 GCTGTTCATTAGAATCACCTGGG - Intronic
913705463 1:121417837-121417859 ACTGTAAATTATAATCTACATGG + Intergenic
914145836 1:144994110-144994132 GCTGTTCATTAGAATCACCTGGG + Intronic
914335553 1:146711954-146711976 AATGCACATTAGAATCACCTTGG + Intergenic
914390940 1:147222552-147222574 TCTGCACATTGGAATCATCTGGG + Intronic
914417465 1:147497079-147497101 ACTGCACATTGGAATCACCTGGG + Intergenic
914682867 1:149951732-149951754 ATTGTACATAAGAATAATCTGGG - Intronic
914723145 1:150305918-150305940 TCTGTACATTGGAATCACCTTGG + Intronic
914865138 1:151420609-151420631 AATGTATATTAGAATCAACCGGG - Intronic
914903804 1:151727924-151727946 GCTGTACATCAGAATCACCTGGG + Intronic
914903823 1:151728042-151728064 CCAGTCCATTAGAATCACCTGGG - Intronic
914999250 1:152573139-152573161 ACTGTGCATCAGAATCACCTGGG - Intronic
915122014 1:153635191-153635213 GCTGCACATTAGAAGCACCTAGG + Intronic
915948531 1:160171935-160171957 ATTGAACATTAGAATCACCAGGG + Intronic
915956338 1:160223503-160223525 CCTGGACATTAGAATCATGTGGG + Intronic
916166325 1:161969962-161969984 TCTGCACATTAGAATCACCTGGG - Intergenic
916422191 1:164647686-164647708 GCTGAACATTAAAATCACCTGGG + Intronic
916466365 1:165078047-165078069 GCTGTACATTAGAGTCACCTGGG + Intergenic
916500543 1:165383388-165383410 CCTGCACATTAGCATCACCTGGG + Intergenic
916667413 1:166978640-166978662 ACTGTGCATTGGAAGCACCTGGG - Intronic
916811722 1:168311815-168311837 GCTGTACATTACAGTCACCTGGG + Intronic
916932508 1:169593417-169593439 ATTGTCCATTAGAATCACCTAGG - Intronic
917045174 1:170851770-170851792 AGTGTGCATCAGAATCACCTAGG + Intergenic
917780862 1:178395249-178395271 GCTGCATATTAGAATCATCTGGG - Intronic
917805177 1:178606825-178606847 TCTGCTCATTAGAATCACCTGGG + Intergenic
917838356 1:178958435-178958457 GCTGTACATTAAGATCACCTGGG - Intergenic
918023492 1:180718564-180718586 GTTGCACATTAGAATCACCTGGG + Intronic
918063347 1:181081402-181081424 GCTGTACGTTAGAATCACCTGGG - Intergenic
918178786 1:182068612-182068634 GCTGTACATAAGAATAATCTGGG + Intergenic
918243915 1:182642744-182642766 ACCGGAGATTAAAATCAACTAGG + Intergenic
918426484 1:184415359-184415381 AGTGCACATCAGAATCATCTAGG + Intronic
918447874 1:184632865-184632887 GCTGCACACTAGAATCACCTGGG + Intergenic
918549047 1:185718910-185718932 AGTCTCCATTAGAAACAACTGGG - Intergenic
919430221 1:197483212-197483234 GCTGTACATTTGAATCATTTGGG + Intergenic
919447596 1:197728206-197728228 ACAGCACATAAGAATCACCTGGG - Intronic
919607820 1:199707459-199707481 ATTGCACATTAGACTCTACTGGG - Intergenic
919935342 1:202247160-202247182 GCTGTGCATCAGAATCACCTGGG - Intronic
919968838 1:202557623-202557645 GCTGTACAGCAGAATCACCTGGG + Intronic
920248815 1:204608498-204608520 GCTGTGCATTAGAATCACCTGGG - Intergenic
920479040 1:206304354-206304376 GCTGTTCATTAGAATCACCTGGG - Intronic
920512132 1:206559151-206559173 ACTGTATATCAGAATTACCTGGG - Intronic
920611321 1:207440553-207440575 ACTGTACATTAGAATCACTTGGG + Intergenic
920611346 1:207440884-207440906 ACAGTATATTAGAATCACTTGGG - Intergenic
920652885 1:207851838-207851860 TCTGAATATTAGAATCACCTTGG - Intergenic
920690529 1:208143119-208143141 GCTGCACATTAGAATCATCTGGG + Intronic
920721970 1:208396146-208396168 ACTGTCTGTTGGAATCAACTGGG - Intergenic
920798594 1:209164632-209164654 ACTATACATGAGAATCACCTGGG + Intergenic
920855552 1:209658444-209658466 GCTGCACATTAGAATCATCTAGG - Intergenic
921256729 1:213348118-213348140 ACTGAACATGAGAACCAACCGGG + Intergenic
921344223 1:214165553-214165575 GCTGCACATAAGAATCAACTTGG - Intergenic
921450543 1:215300848-215300870 ATTGGACATCAGAAACAACTGGG - Intergenic
921481196 1:215666522-215666544 GCTGCACATGAGAATCACCTGGG + Intronic
921481218 1:215666642-215666664 TTTGTGCATTAGAATCACCTGGG - Intronic
921489344 1:215755237-215755259 AATGAGCATTAGAATCACCTAGG - Intronic
921492152 1:215790420-215790442 ACTGCACATTTAAATCACCTTGG - Intronic
921528556 1:216250301-216250323 GCTGTTTATTATAATCAACTTGG + Intronic
921660345 1:217793643-217793665 ACTGTGCATTTGAATCACCTGGG - Intronic
921777722 1:219121852-219121874 GCTGCACATTAGAATCAGCAGGG + Intergenic
921862890 1:220057427-220057449 ACTGCATATCAGAATCACCTAGG - Intergenic
922144881 1:222932339-222932361 GCTGCACATTAGAATCACTTTGG - Intronic
922182742 1:223248085-223248107 ACTGTGCATGTGAATCACCTGGG - Intronic
922346834 1:224703356-224703378 GCCGCACATTAGAATCACCTGGG + Intronic
922369478 1:224895230-224895252 GCTGTACATTGGGATCACCTGGG + Intergenic
922382875 1:225050647-225050669 TCTTTCCATTAGCATCAACTGGG + Intronic
922530753 1:226343080-226343102 GCTATACATTAGAATCACCTGGG - Intergenic
923056766 1:230432372-230432394 GCTGTACATTAGGATCACCTGGG + Intergenic
923123731 1:231017618-231017640 TCTACACATTAGAATCACCTGGG + Intergenic
923584892 1:235259718-235259740 AGTGTAAATTAGAATCACCCAGG + Intronic
924159919 1:241220430-241220452 GCTCTACATTAGAATTATCTGGG - Intronic
924369564 1:243333456-243333478 GCTGCACATTGGAATCACCTAGG - Intronic
924645800 1:245876383-245876405 ACTGTGCATTGGAATCACCTGGG - Intronic
924658522 1:245995168-245995190 ACTGGACATTAGAAACTTCTAGG - Intronic
1062958568 10:1556512-1556534 GCTGTGCATTCGAATCACCTGGG + Intronic
1063273029 10:4533300-4533322 AATGCACATTAAAATAAACTAGG - Intergenic
1063451290 10:6151946-6151968 GCTTCACATTAGAATTAACTGGG + Intronic
1063898143 10:10703620-10703642 GCTGTACATTAGAACCATCTAGG - Intergenic
1063952089 10:11233054-11233076 ACTGTACATTAAGATTTACTGGG + Intronic
1063987711 10:11523913-11523935 CCTGCACATTAGAATCAGCTGGG - Intronic
1064300798 10:14121040-14121062 AATGTACATATGAATCACCTGGG + Intronic
1064388811 10:14923314-14923336 ACTGTGGATCAGAATCACCTGGG - Intronic
1064834118 10:19505923-19505945 GCTGCATATTAGAATCATCTAGG + Intronic
1064971476 10:21071530-21071552 GCTGTACATTACAATCACCTAGG + Intronic
1065111085 10:22440447-22440469 GCTGTTCATTAGAATCTCCTGGG - Intronic
1065759547 10:28969059-28969081 TCTGTTCATCAGAATTAACTAGG - Intergenic
1065764018 10:29009577-29009599 ACAGTACATGAGAACCATCTAGG - Intergenic
1065809169 10:29425366-29425388 GCTACACATTAGAATCATCTGGG - Intergenic
1065884619 10:30065992-30066014 ACTGTATGTGAGAATCATCTGGG - Intronic
1066501820 10:36002310-36002332 ACTGCATATTAGAATCAACTGGG + Intergenic
1067284542 10:44898089-44898111 GCTGCACATTAATATCAACTGGG - Intergenic
1067568354 10:47353910-47353932 ACTGACCATCAGAATCACCTGGG - Intronic
1067766656 10:49092166-49092188 ACTGTGCAGAAGAATCAACTGGG + Intronic
1067798170 10:49335827-49335849 GCTGTAGATTAGAATCCACAGGG - Intergenic
1068003546 10:51365708-51365730 ATTGTACATTTGAATCCCCTAGG - Intronic
1068075613 10:52249368-52249390 ACTGTGCATCAAAATCACCTGGG + Intronic
1068602072 10:58966942-58966964 GCTGCATATTAGAATCACCTGGG - Intergenic
1068680872 10:59818432-59818454 ACTGTACTTGAGAATCCACACGG - Intronic
1068943570 10:62705475-62705497 GCTGTAAATTAGAATCACCTGGG + Intergenic
1069874450 10:71553132-71553154 GCTGCATATTAGAATCACCTGGG - Intronic
1070292821 10:75131871-75131893 ACTGTGCATTAGAATCACGTGGG + Intronic
1070507648 10:77128466-77128488 ACTGTACATTTAAATCACCTGGG + Intronic
1070590877 10:77800159-77800181 ACTGTGCATTAGAATTAGCTGGG + Intronic
1070682005 10:78455318-78455340 ACTGTTCATTAAAACCAACCTGG + Intergenic
1071176973 10:82938356-82938378 GCTATACATTAGAAACACCTCGG - Intronic
1071267696 10:83978933-83978955 TCTGCACATTAGAATCACCTGGG + Intergenic
1071267707 10:83979053-83979075 TCTGTACATTGGAATCATCTGGG - Intergenic
1071444186 10:85730696-85730718 GCTGTGCATTAGAATCACCTGGG - Intronic
1071750290 10:88467743-88467765 GCTGCTCATTAGAATCCACTAGG - Intronic
1071780585 10:88839957-88839979 ACTGTGCATCAGAATCACCAGGG - Intronic
1071832952 10:89390382-89390404 ACTGCACATTAGAATCAGCCAGG - Intronic
1072043441 10:91631402-91631424 TCTGGTCATTAGAATCACCTGGG - Intronic
1072327196 10:94310372-94310394 ACTGTACATTTGTATCACCTGGG + Intronic
1072398278 10:95068220-95068242 ACTGGGCATTAGAATCACCTGGG - Intronic
1072484204 10:95839167-95839189 TCTGCACATTAGAATCATGTGGG + Intronic
1072501380 10:96021510-96021532 GCTGCACATTGGCATCAACTGGG - Intronic
1072523946 10:96254920-96254942 GCTGCACATTAGAATCACTTAGG + Intronic
1072546195 10:96441391-96441413 GCTGCACATTAGATTCAACTGGG + Intronic
1072547454 10:96450462-96450484 GCTGTACCATAGAATCACCTGGG - Intronic
1072755079 10:98014353-98014375 GCTGTGCATTGGAATCATCTGGG + Intronic
1072819102 10:98538563-98538585 ACTGTACACTGGAATCATCTGGG + Intronic
1072935755 10:99711588-99711610 TCTGCACATTGGAATCACCTGGG + Intronic
1073029827 10:100516841-100516863 ACTGTGAATTAGGATCCACTGGG - Intronic
1073093092 10:100960912-100960934 AATGTACATAGGAATCAACTAGG + Intronic
1073117717 10:101101196-101101218 GCTGCACATTAGAATCACCTGGG - Intronic
1073151935 10:101317605-101317627 GCTACACATTAGAATCAGCTGGG - Intergenic
1073257772 10:102165152-102165174 CCTGTTCATTAGAATCATCTGGG - Intergenic
1073397687 10:103231514-103231536 GCTGAACATTAGAATCACCAGGG + Intergenic
1073485293 10:103813825-103813847 GCTGTACATTACAATCACCTGGG + Intronic
1073568326 10:104554770-104554792 AGTGCACATTAGATTCACCTGGG - Intergenic
1073619161 10:105029095-105029117 CCTCTGCATTAGAATCAGCTGGG + Intronic
1073652103 10:105372039-105372061 ACTATGCATTGGAATCAACTTGG + Intergenic
1074007752 10:109445635-109445657 GCTGCACATTAGAATCAACTGGG - Intergenic
1074027147 10:109648222-109648244 ACTGCACACAAGAATCACCTGGG + Intergenic
1074061240 10:109967843-109967865 GCTGTACTTCAGAATCACCTGGG - Intergenic
1074084399 10:110196886-110196908 CCTGTACATCAGAATCACTTGGG - Intergenic
1074343328 10:112655907-112655929 AGTGTGCACTAGAATCATCTAGG - Intronic
1074538921 10:114348835-114348857 GCTGTGCATTAGACTCACCTGGG - Intronic
1074558089 10:114510204-114510226 TCTGTGCATTAGAATCAACAGGG + Intronic
1074585433 10:114763797-114763819 CCTGTACATAAGAAATAACTGGG + Intergenic
1074702319 10:116103316-116103338 GCTGAACATTAGAATGAACCAGG - Intronic
1074796753 10:116953953-116953975 ACTGCACATCAGAATCATGTGGG - Intronic
1074796942 10:116956257-116956279 GATGTACATTAGAATCACCTGGG - Intronic
1074799363 10:116983780-116983802 GCTGTACATTGGAATTACCTGGG - Intronic
1074911166 10:117910377-117910399 GCTGCACATTAGAATCTCCTGGG + Intergenic
1074942559 10:118249201-118249223 ACTGCACATTAGAATTACGTAGG - Intergenic
1075082995 10:119396439-119396461 ACTGCACATCAGAATCAGCAGGG - Intronic
1075130800 10:119737407-119737429 GCTGTACAGTAGAATCACCAGGG + Intronic
1075425270 10:122337204-122337226 ATTGCACATCAGAATCACCTGGG + Intronic
1075747582 10:124738382-124738404 GCTGCACATTAGAGTCACCTGGG - Intronic
1076429760 10:130393556-130393578 GCTCCACATTAGAATCACCTGGG - Intergenic
1077668116 11:4133884-4133906 TCTGCATCTTAGAATCAACTGGG + Intronic
1077671535 11:4162141-4162163 GGTTTACATTAGAATCACCTAGG + Intergenic
1078270911 11:9793796-9793818 ACTGAACATTAGAATCACCTGGG - Intronic
1078350879 11:10592163-10592185 GCTGCACATTAGAATCACCTGGG + Intronic
1078484122 11:11706060-11706082 GCTGTCCATTAGAATCCCCTGGG - Intergenic
1078639307 11:13080421-13080443 GCTGCATATTAGAATCACCTGGG + Intergenic
1079219873 11:18550930-18550952 GCTGTGCATCAGAATCATCTGGG - Intronic
1079352530 11:19703897-19703919 GCTTTACATTAGAGTCACCTGGG - Intronic
1079431769 11:20396767-20396789 AATGTGCATAGGAATCAACTGGG + Intronic
1079469469 11:20764672-20764694 ACTGTGCATCAGAATCACCTGGG - Intronic
1079505802 11:21150646-21150668 TCTGTACATTTGAATCATCTGGG + Intronic
1079631879 11:22687434-22687456 GCTGCACATTAGAATCACCTGGG - Intronic
1079942997 11:26705192-26705214 ATTCTACACTAGAGTCAACTGGG - Intronic
1080029695 11:27647527-27647549 CCTGTACATTTGAATCACATAGG - Intergenic
1080110994 11:28567672-28567694 AATGTACATTAGGATGACCTGGG + Intergenic
1080299203 11:30765495-30765517 ACTGAACAGTAGAATCACCTGGG - Intergenic
1080421797 11:32117378-32117400 TGTGTACATCAGAATCACCTGGG - Intergenic
1080526159 11:33121813-33121835 CCTGTATAGTAGAATCAACTAGG - Intronic
1080602283 11:33831368-33831390 AATGTACATGAGGATCACCTGGG - Intergenic
1080928761 11:36785372-36785394 AGTGCACATTAAAATCACCTGGG - Intergenic
1081002177 11:37688634-37688656 ATCGCACATCAGAATCAACTGGG - Intergenic
1081135254 11:39432370-39432392 ACAGTACATTGGAATCAACTGGG - Intergenic
1081631543 11:44693065-44693087 CCTGATCACTAGAATCAACTGGG + Intergenic
1082095012 11:48122791-48122813 ACGGTGCCTTAGAATCATCTAGG + Intronic
1082700241 11:56420560-56420582 GTTGTACATTAGAATCACTTGGG - Intergenic
1082771326 11:57210059-57210081 GCTACACATTAGAATCACCTGGG + Intergenic
1082819060 11:57531263-57531285 GCTGTACATACGAATCACCTGGG - Intergenic
1082895710 11:58187975-58187997 ACTGCACATTAGAATCACCTGGG - Intergenic
1083283268 11:61640746-61640768 GCTGCTCATTAGAATCACCTGGG - Intergenic
1083953424 11:65969421-65969443 CCTGCACATTAGACTCACCTAGG + Intronic
1084368828 11:68724159-68724181 ACAGTACATAATAATCAAATTGG + Intronic
1085783289 11:79428907-79428929 GCTGTACCTTAGAATCACCTGGG + Intronic
1085783304 11:79429023-79429045 GCGGTGCATTAGAATCACCTAGG - Intronic
1086448240 11:86890287-86890309 GCTGCCCATTAGACTCAACTGGG - Intronic
1086720743 11:90118145-90118167 ACCTCACATTAGAATCACCTGGG - Intergenic
1086930561 11:92688489-92688511 GCTGAACATTAGAATCACCTAGG + Intronic
1087173370 11:95073754-95073776 AGTGCATATTAGAATCACCTGGG - Intergenic
1087177281 11:95107389-95107411 GCTGCACATCAGAATCACCTGGG - Intronic
1087652039 11:100879188-100879210 ATTATGCATTTGAATCAACTAGG - Intronic
1087737166 11:101847403-101847425 ACTGTCTATTAGAATCATCTGGG - Intronic
1087787146 11:102367989-102368011 ACTATACATCAGAATCATTTGGG + Intronic
1087828326 11:102791600-102791622 GCTGCAGATTAGAATCATCTAGG + Intronic
1088139764 11:106602008-106602030 CCTGCACATTAGAATTATCTGGG - Intergenic
1088222352 11:107582533-107582555 TATGTGCATTAGAATCACCTGGG + Intergenic
1088501631 11:110489391-110489413 ACTGTATGTTACAATCACCTGGG + Intergenic
1088584282 11:111347148-111347170 GCTGCACATTAGAATCACTTGGG - Intergenic
1088698451 11:112390482-112390504 GCTGCACATTGGAATCACCTAGG + Intergenic
1088740080 11:112760189-112760211 GCTGCTCATTAGAATCATCTGGG - Intergenic
1088756387 11:112888768-112888790 ACTGCCCATTAAAATCAGCTGGG - Intergenic
1088804044 11:113334650-113334672 GCAGAACATTAGAATCATCTAGG - Intronic
1089755743 11:120685342-120685364 AATGAACATGAGAATCACCTGGG - Intronic
1089869322 11:121657939-121657961 GCTGTACATTACAACCACCTGGG - Intergenic
1090470386 11:126975759-126975781 ATTGTGCATGAGAATCAACTGGG - Intronic
1091059201 11:132445692-132445714 ACTGTACATTAGAGTCCCCTGGG - Intronic
1091147000 11:133288747-133288769 GCTATTCATTAGAATCACCTGGG - Intronic
1091200921 11:133780505-133780527 GGTGCACATTAGAATCACCTGGG + Intergenic
1091504086 12:1049509-1049531 ACTTCACATTAGAATGACCTGGG - Intronic
1091638602 12:2216618-2216640 TCTGTACAGTAGAATAATCTGGG + Intronic
1091661312 12:2385781-2385803 GGTGTATATTAGAATCACCTGGG + Intronic
1092279370 12:7088214-7088236 GCTGTGCATTAGAATCACCTGGG + Intronic
1092696851 12:11181607-11181629 ACTGCACATTGGAGTTAACTTGG + Intergenic
1092954540 12:13537665-13537687 GCTGTATATTAAAATCACCTGGG + Exonic
1092987899 12:13864812-13864834 ACTGCACTCTAGAATCACCTGGG + Intronic
1093621757 12:21299235-21299257 GCTGCACATTGGAATCACCTAGG - Intronic
1093768036 12:22987369-22987391 AATGACCATTAGAATCACCTGGG + Intergenic
1093818346 12:23578413-23578435 AGTGTGCATCAGAATCACCTGGG - Intronic
1093853042 12:24064328-24064350 AGTGTACATAAGAGTCATCTTGG - Intergenic
1093916832 12:24812459-24812481 ACTTTAGATTATTATCAACTTGG - Intronic
1094094088 12:26684397-26684419 ACTGTAAATTAGAACCACCTGGG - Intronic
1094346018 12:29469912-29469934 TCTGCACATTAGAATCATTTGGG + Intronic
1094625456 12:32119372-32119394 ACTGTATGTTAGAATCACCTGGG + Intronic
1094788833 12:33885345-33885367 ATAGTACATTACTATCAACTGGG + Intergenic
1095211499 12:39500146-39500168 GCTGCACATCAGAATCATCTTGG - Intergenic
1095255584 12:40032034-40032056 GCTTCACATTAGAATCACCTAGG + Intronic
1095374276 12:41507577-41507599 GATGTACAATAGAATCACCTGGG + Intronic
1095435163 12:42179163-42179185 ACTGCACATTAGAATCATCTTGG - Intronic
1095564098 12:43600450-43600472 AATATGCATTAGAATCACCTAGG - Intergenic
1095675831 12:44917114-44917136 GCTGCACATTAGAATCACTTGGG - Intronic
1095725781 12:45451250-45451272 ACTGTACATTATGATCAAGTGGG + Intergenic
1095800197 12:46264099-46264121 ACTTCACATTAGACTCATCTAGG - Intronic
1096254618 12:50055482-50055504 GCTGCACATTCGAATCACCTGGG - Intergenic
1096332828 12:50729373-50729395 TATGTACATAAGAATCACCTGGG + Intronic
1096378589 12:51135599-51135621 GCTGAACATCAGAATCACCTGGG + Intronic
1096810784 12:54168455-54168477 AATGTACATAAAAATCACCTGGG - Intronic
1096866040 12:54563819-54563841 AGTGTATATTAGAATAATCTGGG + Intronic
1097515643 12:60601930-60601952 ACTGGACATTTGAATCTAATAGG - Intergenic
1097695971 12:62775230-62775252 CCTGTACATCAGAATCACCTGGG - Intronic
1097750676 12:63348990-63349012 ACTGCACATCAGAATCACCTGGG - Intergenic
1097910746 12:64966521-64966543 ACCATACATTAGAATCCCCTGGG + Intergenic
1097926926 12:65139196-65139218 ACTGCACATTTGAATCCACCTGG - Intergenic
1098027041 12:66214663-66214685 ACTATATATTAGAATTATCTAGG + Intronic
1098057135 12:66519709-66519731 GGTGTACATTAGTATCAACTGGG + Intronic
1098147978 12:67517058-67517080 GCTGTACATTAGAATCACCTGGG + Intergenic
1098426437 12:70370017-70370039 GCTGTACCTTAGAATCACCAGGG + Intronic
1098452264 12:70632747-70632769 GCTGCACATCAGAATCACCTAGG + Intronic
1098679114 12:73327957-73327979 AGTGTGCATAACAATCAACTGGG + Intergenic
1098682111 12:73369425-73369447 AAAGTACATTAGAATTACCTGGG - Intergenic
1098782611 12:74705978-74706000 GCTGCACATTTTAATCAACTGGG + Intergenic
1098908349 12:76184118-76184140 ACTGCACATTAGAATTATCTGGG - Intergenic
1099834521 12:87891775-87891797 ACAGCACATAAGAATCACCTAGG + Intergenic
1099933068 12:89095753-89095775 AGGGTACATTAGAATTACCTAGG + Intergenic
1100008214 12:89919926-89919948 TTTTCACATTAGAATCAACTGGG + Intergenic
1100698856 12:97124721-97124743 GCTACACATTAGAATCACCTGGG + Intergenic
1100703019 12:97167845-97167867 ACTGCACATTAGAATCGCCTGGG + Intergenic
1100780866 12:98024805-98024827 ACTGCCCATTAGAATCACCTGGG + Intergenic
1101076229 12:101132424-101132446 ACCATACATTAGAATCACCTGGG + Intergenic
1101615207 12:106329501-106329523 ACTACAAATTAGAATCATCTGGG + Intronic
1101759050 12:107644303-107644325 GCTGCACATTAGAATCACCTGGG + Intronic
1101764771 12:107687496-107687518 TCTGTACATCAGAATCACCTAGG - Intronic
1101799994 12:108013398-108013420 GCTGCACATTAGAATTACCTGGG - Intergenic
1101805818 12:108062652-108062674 AGTGTATATCAGAATCACCTGGG + Intergenic
1101811496 12:108111819-108111841 ACTGCAAATTGGAATCACCTGGG + Intergenic
1101956842 12:109219374-109219396 GCTGTACATTAGAATCACCTAGG + Intronic
1102075117 12:110053519-110053541 GCTATGCATTAGAATCAGCTGGG - Intronic
1102527380 12:113521482-113521504 CCTGCACATTAGAATCACCTGGG + Intergenic
1102982693 12:117254671-117254693 AATGCACATCAGAATCACCTAGG - Intronic
1103065857 12:117896855-117896877 ACTCCATATTAGAATCACCTGGG - Intronic
1103257776 12:119557155-119557177 CCTGCACATTAGAATCACGTGGG - Intergenic
1103312042 12:120018108-120018130 ATTGCATATTAGAATCACCTGGG + Intronic
1103475096 12:121212022-121212044 GCTGAACATGAGAATCACCTGGG - Intronic
1104297191 12:127527461-127527483 GCTTTACATTAGAATTACCTGGG + Intergenic
1104307567 12:127623290-127623312 GCTGCAGATTAGAATCACCTGGG - Intergenic
1104417625 12:128608319-128608341 CCTGCATATTAGAATCACCTGGG + Intronic
1104473815 12:129053848-129053870 GCTGTACATCAGAATCAACTGGG + Intergenic
1104495370 12:129232044-129232066 GCTGTACATTGGAATCACCTGGG + Intronic
1104547701 12:129727042-129727064 ACTATGCTTTAGAATCATCTGGG - Intronic
1106055534 13:26233230-26233252 ACTGCATATTAGAATAATCTGGG - Intergenic
1106108169 13:26752754-26752776 AGCGTGCATCAGAATCAACTTGG + Intergenic
1106415746 13:29544560-29544582 GTTGCACATTAGAATCATCTGGG + Intronic
1106440144 13:29759307-29759329 GCTGTACATTAGAATCACTTAGG - Intergenic
1107399023 13:40050114-40050136 ACTGTGCATAAGAATCACCTGGG - Intergenic
1107431751 13:40346499-40346521 ACAGTACATAAGAATCACCTGGG - Intergenic
1107584621 13:41831509-41831531 ACTGTACGTTAGAATCTTCTGGG + Intronic
1107726981 13:43308740-43308762 TCTGCACATGAGAATCACCTGGG - Intronic
1107925614 13:45259100-45259122 GCTGTATACTAGAATCACCTGGG + Intronic
1108020297 13:46121234-46121256 GCTGCACATTAGAGTCATCTGGG + Intergenic
1108091391 13:46853562-46853584 GCAGCACATTAGAATCATCTGGG - Intronic
1108107403 13:47026490-47026512 GCTGCACATCAGAATCAGCTGGG + Intergenic
1108490471 13:50976402-50976424 GCTGCACATTGGAATCACCTGGG + Intergenic
1108598339 13:51969152-51969174 CCTGTACATTAGGATCACCTGGG - Intronic
1108675413 13:52733618-52733640 GCTGTACTTTAGAAGCATCTGGG + Intronic
1108710687 13:53029410-53029432 ACTATATATTAGAATCACCTGGG - Intronic
1109006953 13:56890122-56890144 ACTTTATATGAGAGTCAACTGGG - Intergenic
1109766383 13:66905389-66905411 ACTGTATATTAGAATCACCTGGG + Intronic
1109879589 13:68453409-68453431 CCTGTACATTAGAAGCAATTGGG + Intergenic
1109923987 13:69109896-69109918 ACTACACATTAAAATCATCTGGG + Intergenic
1110246261 13:73327697-73327719 AATGCACAATAGAATCACCTGGG + Intergenic
1110348049 13:74471454-74471476 AATGGTCATTAGAATTAACTAGG + Intergenic
1110416226 13:75256033-75256055 GCTACACATTAGAATCACCTAGG + Intergenic
1110568049 13:76976073-76976095 TCTGCACATGAGAATCATCTGGG + Intergenic
1110624827 13:77641653-77641675 ACTGTACATTAGATTAATCAAGG - Intronic
1110839655 13:80127499-80127521 GCTGTACATTATGATCACCTGGG + Intergenic
1111339125 13:86861350-86861372 ACTGTATTTTAGAATCACATTGG + Intergenic
1111404077 13:87779014-87779036 AATGTACATAAGAATTACCTAGG - Intergenic
1111539613 13:89653617-89653639 TCTGTACATTAGAAATAACTGGG + Intergenic
1111791775 13:92865816-92865838 ATTTTACATTAGAATAAAGTAGG - Intronic
1111857080 13:93651813-93651835 GCTGCACATTAGAATCACCTGGG + Intronic
1111896946 13:94153827-94153849 ATTGCACATAAGAATCACCTGGG - Intronic
1111902647 13:94218773-94218795 ACTTTGCATAAGAATCACCTTGG + Intronic
1111912778 13:94330362-94330384 ACTGTACATGAAAATTACCTGGG + Intronic
1111913161 13:94334344-94334366 GCTGTACATTACAACCACCTGGG + Intronic
1111979468 13:95001945-95001967 GCTGCACATTAGAATCAGCTGGG - Intergenic
1112131621 13:96530863-96530885 AATGTGCATTAGAATCACCTGGG + Intronic
1112265692 13:97921300-97921322 ACCCCACATTAGAATCATCTGGG + Intergenic
1112308386 13:98296005-98296027 ACTGCACATTAGCCTCACCTGGG + Intronic
1112441655 13:99428516-99428538 GCTGCACATTGGAATCACCTGGG - Intergenic
1112479072 13:99757414-99757436 GCTGCGCATTAGAATCACCTTGG + Intronic
1112743639 13:102503361-102503383 CCTGAACATTAGCATCACCTGGG + Intergenic
1113036813 13:106059038-106059060 GCTGCACGTTAGAATCATCTGGG + Intergenic
1113355148 13:109572209-109572231 AGTGTACATTTAAATCACCTAGG - Intergenic
1114513807 14:23284880-23284902 ACTGCACACTAGAATTACCTGGG + Intronic
1114612173 14:24050079-24050101 GATGCACATTAGAATCACCTGGG + Intergenic
1114790859 14:25656810-25656832 GCTATACATTAGAGTCACCTGGG + Intergenic
1114830035 14:26129337-26129359 ACTGTAAACTAGAATAAACAGGG - Intergenic
1114954066 14:27795918-27795940 GCTGCACATTAGAGTCACCTTGG + Intergenic
1114974942 14:28083976-28083998 ACTGCACATATGAATCACCTGGG + Intergenic
1115236668 14:31214506-31214528 ATTGCACATTAGATTCACCTGGG + Intergenic
1115260072 14:31442916-31442938 AGTGTACACAAGAATCATCTTGG + Intronic
1115269476 14:31535935-31535957 GCTATACATTAGAGTCAAGTGGG + Intronic
1115282921 14:31685056-31685078 TCTGTATATTAGAATCATCTAGG + Intronic
1115370746 14:32611357-32611379 CCTGTACTTTAGAATCACCTGGG - Intronic
1115535334 14:34367492-34367514 ACTGTACATTACAATCATGTGGG - Intronic
1115617502 14:35110291-35110313 GCTGCACATTAGAATCACCTAGG + Intronic
1115833948 14:37376208-37376230 AGTTTACATTAGAATTCACTTGG + Intronic
1115954363 14:38761596-38761618 GCTGTTCATTAGAATTACCTGGG - Intergenic
1116024567 14:39499291-39499313 GTTGTACATTAGAATCATCTGGG - Intergenic
1116524967 14:45892577-45892599 GCTGCACATTGGAATCACCTGGG - Intergenic
1116605934 14:46995234-46995256 AATGTCCATTAGAACCAATTAGG + Intronic
1116762935 14:49037444-49037466 AATGTGCATAAGAATCACCTGGG - Intergenic
1116771596 14:49132394-49132416 AATGTACGTAAGAATCACCTGGG + Intergenic
1116784925 14:49277158-49277180 GCTACACATTAGAATCACCTGGG + Intergenic
1117006723 14:51428217-51428239 ACTATGCATTAGAATCACCTGGG + Intergenic
1117006870 14:51429361-51429383 GTTGCACATTAGAATCACCTGGG - Intergenic
1117106250 14:52399851-52399873 ACTGCATATTAGTATCACCTAGG + Intergenic
1117263036 14:54056472-54056494 GCTGTTCATTAGAATTACCTGGG + Intergenic
1117342303 14:54802940-54802962 GCTGCCCATTAGAATCACCTGGG - Intergenic
1117390212 14:55255486-55255508 GCTGCACTTTAGAATCATCTAGG - Intergenic
1117521229 14:56553086-56553108 ACTGCACATCAGAAACAGCTGGG - Intronic
1117526197 14:56607819-56607841 ACTGCACATTAAAATCACCTGGG - Intronic
1117584384 14:57185344-57185366 TCTGCACATTAGAATCACCTGGG + Intergenic
1117818949 14:59628319-59628341 TCTGCCCATTAGAATCACCTGGG - Intronic
1117903906 14:60564934-60564956 ATTGTACATTTGTATCACCTAGG + Intergenic
1117961843 14:61171057-61171079 ATTGTACCTAAGAATCAACCAGG - Intergenic
1118112868 14:62742403-62742425 GCTGTACACAAGAATCACCTGGG - Intronic
1118132581 14:62983683-62983705 GCTATATATTAGAATCATCTGGG + Intronic
1118132593 14:62983810-62983832 GCTGTACATTGTAATCACCTGGG - Intronic
1118462220 14:65997514-65997536 TATGCACATTAGAATCACCTAGG - Intronic
1118699066 14:68415201-68415223 GCTGCACATTAGAATCACATGGG - Intronic
1118882487 14:69841322-69841344 GCTGTGCATTAGAATCACCTGGG + Intergenic
1119119007 14:72055672-72055694 ACTGCACGTTAGAATCACCTGGG - Intronic
1119166416 14:72498691-72498713 GCTGTGCATCAGAATCACCTGGG + Intronic
1119238534 14:73039874-73039896 GCTGCACATTAGAATCATCTGGG - Intergenic
1119578865 14:75756034-75756056 ACTTTACATTATAATTACCTGGG - Intronic
1119781295 14:77278209-77278231 GCTGCACATTAGGATCACCTGGG + Intronic
1119861943 14:77942341-77942363 ACTGTACATGAGAATCCAACAGG + Intergenic
1119887293 14:78153631-78153653 TCTGCACATTAGAATCACCTGGG + Intergenic
1119921904 14:78454511-78454533 GCTACACATTAGAATCACCTGGG - Intronic
1119992766 14:79217790-79217812 GCTGCACATTACAATCACCTAGG - Intronic
1120452562 14:84687472-84687494 ACTGTACATTAGAAGGACTTTGG + Intergenic
1120656888 14:87201108-87201130 ACTGTATTTTAGAAACAACCTGG - Intergenic
1120805366 14:88742059-88742081 GCTTCACATTAGAATCACCTGGG + Intronic
1121165395 14:91791314-91791336 GGTATACATTAGAATCATCTGGG - Intronic
1121178437 14:91908681-91908703 ACTGTACATTTGAATCACCTGGG + Intronic
1121205161 14:92158623-92158645 ACTGCACATAAGAATCATCTGGG + Intronic
1121225466 14:92318702-92318724 GCTGCACATTTGAATCACCTGGG - Intergenic
1121944224 14:98103756-98103778 TCTGTACATCAGAATCACCTGGG - Intergenic
1122046254 14:99026085-99026107 GCTGCATATTAGAATCATCTGGG - Intergenic
1122737581 14:103852128-103852150 TCTATACGTTAGTATCAACTCGG + Intergenic
1122759499 14:104011978-104012000 ACTGTCCATAAGACTCTACTGGG - Intronic
1123905821 15:24920399-24920421 AGTGTGCATTAGTATCACCTGGG + Intronic
1124249654 15:28098564-28098586 ACTGCACATTAGAGTCACCTGGG + Intronic
1124252805 15:28117888-28117910 GCTGTGCATCAGAATCATCTGGG + Intronic
1124362615 15:29049143-29049165 GCTGTATATTGGAATCACCTGGG + Intronic
1124449884 15:29778351-29778373 GCTGCTCATTAGAATCACCTGGG - Intronic
1124868712 15:33519538-33519560 ACTGTGCATTTGAATTACCTGGG + Intronic
1124906021 15:33869234-33869256 TTTGCACATTAGAATCACCTGGG - Intronic
1125005418 15:34811329-34811351 ACTGAACATTAGAATTTCCTGGG - Intergenic
1125085763 15:35727204-35727226 AATGTGTATTAGAATCACCTGGG - Intergenic
1125264108 15:37859935-37859957 GGTGTACATTAGAATCACCCAGG + Intergenic
1125267716 15:37902329-37902351 GCTGCACCTTAGAATCACCTGGG + Intergenic
1125293022 15:38170687-38170709 ACTACACATTGGAATCACCTAGG - Intergenic
1125295290 15:38196248-38196270 GCTGTACATTGGAATCTCCTAGG + Intergenic
1125448681 15:39785121-39785143 ACAGAGCATTAGAATCACCTGGG + Intergenic
1125747131 15:42004775-42004797 ACTGTGCATCAGAATCACCCAGG - Intronic
1125824215 15:42661856-42661878 CCTATACATTAGAATCACCTGGG - Intronic
1125878877 15:43174893-43174915 ACTGCACATTGGAATCATCCAGG - Intronic
1125878896 15:43175073-43175095 GCTGCACATTAGAATAACCTAGG - Intronic
1125882360 15:43205756-43205778 GCTGCACATTAGAATCACCTGGG - Intronic
1126193222 15:45900981-45901003 ACTGTATATTAGAATCACCTGGG + Intergenic
1126197474 15:45948374-45948396 AGTGTACACTAGAATCACCTGGG - Intergenic
1126354735 15:47783189-47783211 GTTGTACATTAGAATCATCTGGG + Intergenic
1126462813 15:48931213-48931235 ACTGCATATTAGAATCACTTGGG + Intronic
1126560148 15:50034621-50034643 TCTGTACATTAGATTCATCTTGG + Intronic
1126580693 15:50240036-50240058 ACTGTGCATGAGAATCACTTGGG + Intergenic
1126580706 15:50240157-50240179 CCTGCACATTAGAATCATCTGGG + Intergenic
1126634716 15:50769129-50769151 GCTGCATATTAGAATCATCTGGG - Intergenic
1126855603 15:52836065-52836087 AGGGTGCATGAGAATCAACTTGG + Intergenic
1126927766 15:53609659-53609681 GCTGCATATTAGAATCACCTGGG + Intronic
1126994178 15:54420956-54420978 ATTATACATTAGAATCACCAGGG + Intronic
1127147343 15:56037800-56037822 ACTGCACATTAGAATTACCTGGG - Intergenic
1127294459 15:57597375-57597397 GCTGCACATTAGAATCGCCTGGG - Intronic
1127325091 15:57886981-57887003 ACTGTACATTGGGATCACCTGGG + Intergenic
1127479640 15:59366601-59366623 ACTGTACATGTGAATGAAGTTGG - Intronic
1127499449 15:59542972-59542994 GCTGCACATTAGAATCACCTGGG - Intergenic
1127571897 15:60251687-60251709 AGTGTAAATGAAAATCAACTGGG + Intergenic
1127710362 15:61591262-61591284 GCTACACATTAGAATCACCTGGG - Intergenic
1127794316 15:62425273-62425295 GCAGCACATTAGAATCACCTGGG - Intronic
1127825587 15:62699884-62699906 ACTGGCCATTAGAATCACCTGGG - Intronic
1127860083 15:62986714-62986736 ACTGCACATCAAAATCAGCTGGG - Intergenic
1127896647 15:63306068-63306090 GCTGCACATCAGAATCACCTGGG - Exonic
1128229757 15:66026134-66026156 GCTGCACATTAGAATCACCTGGG - Intronic
1128229762 15:66026199-66026221 AATGTGCATGAGAATCACCTGGG + Intronic
1128250194 15:66158550-66158572 GCTGCACATCAGAATCATCTGGG + Intronic
1128730557 15:70017950-70017972 ACTCCACATTAGAATCCTCTGGG - Intergenic
1128874394 15:71190346-71190368 GCTGCACATTAGAATCACCTAGG + Intronic
1129133389 15:73521962-73521984 ACAGTACATTACAATGAATTGGG + Intronic
1129145429 15:73642611-73642633 GCTACACATTAGAATCAACTAGG + Intergenic
1129184102 15:73895146-73895168 ACCGTACTTTAGAACCACCTGGG - Intergenic
1129894543 15:79093584-79093606 GCTGCACATCAGAATCACCTGGG + Intergenic
1129894674 15:79094531-79094553 GCTGTGCATTGGAATCATCTGGG - Intergenic
1129962648 15:79701733-79701755 GCTGTACATTGGAATCCCCTAGG + Intergenic
1130077664 15:80703585-80703607 GCTGTACTTTAGAATCTCCTAGG + Intronic
1130665053 15:85862464-85862486 ATTGCACATTAGATTCAACTGGG - Intergenic
1130764144 15:86852848-86852870 GTTGCATATTAGAATCAACTGGG + Intronic
1131018037 15:89074071-89074093 TCTGTACATAAGAGTCACCTGGG + Intergenic
1131029190 15:89172044-89172066 ATTGCACATTAGAATCACCTGGG - Intronic
1131200654 15:90393078-90393100 TGTGTGCATTAGAATCACCTGGG + Intronic
1131324674 15:91430778-91430800 ACTGCCCATTATAATCACCTAGG + Intergenic
1131365351 15:91834480-91834502 GCTGCACACTAGAATCACCTGGG + Intergenic
1131547430 15:93327650-93327672 TCTGTGCATTACAATCACCTGGG + Intergenic
1131941220 15:97567929-97567951 ACTGCACATTAGTCTCACCTGGG + Intergenic
1132131458 15:99284236-99284258 ACTGCACATTAGAATCACCAGGG - Intronic
1132250034 15:100329125-100329147 GCTGTACCTTAGCATCACCTGGG - Intronic
1132270916 15:100524098-100524120 TCTGAAAATTAAAATCAACTAGG - Intronic
1133929534 16:10221020-10221042 ACTGCACATTAAAATCATCCAGG + Intergenic
1133985403 16:10664524-10664546 GCTGTGCATTAGAGTCACCTGGG + Intronic
1134327254 16:13218322-13218344 AATGTACATAAGAATCACCCAGG - Intronic
1134365458 16:13573194-13573216 ATTGTACATTGGAATCACGTGGG - Intergenic
1134536521 16:15030860-15030882 ACTGCACATTAGAGTCATCCGGG + Intronic
1135126019 16:19809957-19809979 ACTGTACATTAGAAACACCAGGG + Intronic
1135258641 16:20962410-20962432 GCTGCACATTGGAATCACCTGGG - Intronic
1135270248 16:21063168-21063190 GCTGCACTTTAGAATCACCTGGG + Intronic
1135351504 16:21733337-21733359 GCTGCACATTAGAATCACCTGGG + Intronic
1135449986 16:22549465-22549487 GCTGCACATTAGAATCACCTGGG + Intergenic
1135478448 16:22799501-22799523 GCTGCACATTAGAATCACCCAGG + Intergenic
1135478468 16:22799628-22799650 GCTGCACATTAGAATCACCTGGG - Intergenic
1135672988 16:24390809-24390831 GCTGCCCATTAGAATCACCTGGG + Intergenic
1135763909 16:25160331-25160353 AGTGGTCATCAGAATCAACTGGG - Intronic
1136098004 16:27972808-27972830 AGTGTACATTGGAATCACCTGGG - Intronic
1137248105 16:46721818-46721840 GCTGTACATTGGAATCATCAGGG + Intronic
1137850575 16:51738008-51738030 ACTGTGCACCAGAATCACCTAGG + Intergenic
1138038121 16:53629164-53629186 GCTGCACATTAGAATCACCAGGG + Intronic
1138110927 16:54323190-54323212 GCTGTACTTTAGAATCAGCTAGG + Intergenic
1138209351 16:55150222-55150244 ACTGCATTTTAGAATCATCTTGG + Intergenic
1138226931 16:55303934-55303956 GCTACACATTAGAATCATCTGGG - Intergenic
1138327507 16:56188123-56188145 AATTTACATTAGAATTAGCTGGG - Intergenic
1138449721 16:57086437-57086459 ACTGCACATTAGAGTCACCTGGG + Intergenic
1138580489 16:57937799-57937821 GCTGTGCATTGGAATCACCTGGG + Intronic
1139205459 16:65024344-65024366 GCTGCACATTAGAATTAACCGGG + Intronic
1139321184 16:66115664-66115686 GCTGCATATTAGAATCACCTGGG + Intergenic
1139859546 16:70009927-70009949 ACTGCACATTAGAGTCATCCGGG - Intergenic
1139873236 16:70124489-70124511 TCTGCACATTAGAATCAGCTGGG + Intronic
1139998073 16:70999274-70999296 AATGCACATTAGAATCACCTTGG - Intronic
1140152083 16:72377916-72377938 ACTGTGCATAATACTCAACTGGG - Intergenic
1140362545 16:74356816-74356838 TCTGCACATTAGAATCAGCTGGG - Intergenic
1140946566 16:79773848-79773870 GTTGCACATTAGATTCAACTGGG - Intergenic
1141012204 16:80413103-80413125 CCTGCACGTTAGAATCACCTGGG - Intergenic
1141087636 16:81108288-81108310 AGTGCACCTTAGAATCACCTGGG - Intergenic
1141730697 16:85821113-85821135 GCTGCACGTTAGAATCACCTGGG + Intergenic
1141813553 16:86393199-86393221 GCTATACATTAGAATGACCTGGG + Intergenic
1142616947 17:1142206-1142228 CCTATACATTAGAGTCACCTGGG - Intronic
1143195681 17:5074653-5074675 ACTGCACATTGGAATCACCTGGG - Intergenic
1143813220 17:9489351-9489373 GCTGCATATTAGAATCACCTGGG - Intronic
1143855872 17:9848463-9848485 GCTGCATATTAGAATCATCTGGG - Intronic
1143996936 17:11014581-11014603 GATGCACATTAGAATCATCTGGG - Intergenic
1144024427 17:11265329-11265351 GCTGCACATTGGAATCAACTGGG + Intronic
1144024453 17:11265460-11265482 GCTCCACATTAGAATCACCTGGG - Intronic
1144050652 17:11494816-11494838 GCTGTGCATTAGAATCGCCTGGG + Intronic
1144115074 17:12080863-12080885 GCTGTACCTTACAATCACCTGGG - Intronic
1144236730 17:13268805-13268827 GCTGGACACTAGAATCAACTGGG - Intergenic
1144284231 17:13757352-13757374 GCTGCACATTAGAATCACCGAGG + Intergenic
1144404365 17:14938599-14938621 ACTATACATTAGAATCACCAAGG + Intergenic
1144406936 17:14960972-14960994 GCTGCATATTAGAATCCACTGGG - Intergenic
1144554497 17:16269777-16269799 ACTGTGCCTTAGGATCATCTGGG - Intronic
1144614264 17:16753858-16753880 ACTGAACTTTAGAATAAACTAGG + Intronic
1144898444 17:18561820-18561842 ACTGACCTTTAGAATAAACTAGG - Intergenic
1145037107 17:19548845-19548867 ACAGCACAGTAGAATCACCTAGG - Intronic
1145133932 17:20383901-20383923 ACTGACCTTTAGAATAAACTAGG + Intergenic
1145814444 17:27785433-27785455 GCTGTGCATTAGAATCACCTGGG + Intronic
1145845041 17:28031194-28031216 GCTGCATATTAGAATCTACTGGG + Intergenic
1146029510 17:29353076-29353098 ACTGCACATTACAATTACCTAGG + Intergenic
1146279351 17:31535327-31535349 GCTGTGCATTGGAATCACCTGGG + Exonic
1146314188 17:31794456-31794478 GCTGTACATTAGAGCCACCTGGG - Intergenic
1146554283 17:33810330-33810352 GCTGCACATTAGAATCATTTGGG + Intronic
1146592030 17:34135565-34135587 GCTGCACATTGGAATCACCTGGG - Intronic
1146719646 17:35114903-35114925 GCTGCACGTTAGAATCATCTGGG - Intronic
1146780626 17:35668354-35668376 GCTGTACATTAGAATCAACTGGG + Intronic
1146996909 17:37328923-37328945 ACTGTTCATCAGAATCACCTCGG - Intronic
1147300798 17:39525455-39525477 GCTGTATATTAGAATCATCCTGG + Intronic
1147464665 17:40601825-40601847 GCTGCATATTAGAATCACCTGGG - Intergenic
1147773534 17:42884323-42884345 ACTGCACATTGAAATCACCTGGG + Intergenic
1147850160 17:43436278-43436300 GCTGCACATTAGAATCACCTAGG - Intergenic
1148215440 17:45831669-45831691 GCTGCACATTAGAATCACCTGGG - Intronic
1148255691 17:46129878-46129900 ACCATACATTAGAATCATCTAGG + Intronic
1148257860 17:46152030-46152052 GCTATACACTAGAATCACCTGGG - Intronic
1148358616 17:46993988-46994010 GCTGCACATTAGAATCCACTGGG - Intronic
1148478254 17:47943028-47943050 TCTGTGCATCAGAATCACCTGGG - Intronic
1148843641 17:50515568-50515590 ACTGTGCATCAGAATCACCTAGG + Intronic
1148986512 17:51627276-51627298 AGTGTGCATCAGAATCATCTAGG + Intergenic
1149210756 17:54297436-54297458 AATGCACATTAGAATTAACTGGG - Intergenic
1149288958 17:55197188-55197210 TCTGCACATTAGAATCACCTGGG - Intergenic
1149493472 17:57101519-57101541 ACTGCACATTGTAATCACCTTGG + Intronic
1149501314 17:57154689-57154711 GCTGTACATTGCAATCACCTGGG + Intergenic
1149605587 17:57922840-57922862 GCTGCACATTAGAATCACCCAGG + Intronic
1150332081 17:64302471-64302493 GCTAAACATTAGAATCACCTGGG + Intergenic
1150446380 17:65229934-65229956 TCTGGACATTAGAATCCACTGGG + Intergenic
1150605420 17:66686595-66686617 ACTGTACATTGGAATCACATGGG - Intronic
1151263551 17:72936289-72936311 ACTGCACATTGGGATCATCTCGG - Intronic
1151360943 17:73588503-73588525 ACTGTGCATCAGAATCACCTGGG - Intronic
1153485407 18:5593089-5593111 TCTGATCATTACAATCAACTGGG - Intronic
1153621661 18:6984588-6984610 TCTGCACATTGGAATCACCTGGG - Intronic
1155248554 18:23934452-23934474 GCTGTACTTCAGAATCACCTGGG - Intronic
1155252560 18:23966213-23966235 GCTCTTCATTAGAATCACCTGGG - Intergenic
1155502086 18:26497015-26497037 GCTGAACATTAGAAGCACCTGGG - Intronic
1155566030 18:27135608-27135630 ACTGAATATTAAAATCACCTGGG + Intronic
1155868433 18:30995557-30995579 GCTGCACATTTGAATCATCTCGG + Intronic
1155977629 18:32148096-32148118 GCTGTACATTAGAATCATCTGGG - Intronic
1156263486 18:35466376-35466398 GCTGCACATTAGAAGCATCTTGG + Intronic
1156645239 18:39153894-39153916 CTTGAATATTAGAATCAACTGGG + Intergenic
1156671393 18:39474106-39474128 CTTGCACATTAGAATCACCTGGG - Intergenic
1156762605 18:40611677-40611699 ATTGTATATTAGAATCATCTGGG + Intergenic
1156779035 18:40828227-40828249 GCTGTCCATAAGAATCATCTGGG - Intergenic
1156958859 18:42998569-42998591 GCTGCACATTAGAATCACCAAGG - Intronic
1157090171 18:44627562-44627584 GCAGTACATTAGAATCACCTGGG + Intergenic
1157211792 18:45749159-45749181 ACTGCACATCAGAATCATCTGGG - Intronic
1157378334 18:47187481-47187503 ACTGATCATCAGAATCATCTAGG + Intergenic
1157802829 18:50634912-50634934 ACTGCACCTTAGAATCAGCGGGG + Intronic
1158009692 18:52714740-52714762 TCGGTATATTAGTATCAACTTGG - Intronic
1158170727 18:54596393-54596415 ACTGCATATTAGAATCACCTGGG + Intronic
1158170749 18:54596517-54596539 GTTGTACATTAGATTCATCTGGG - Intronic
1158243092 18:55399736-55399758 GCTGCACATTAGAATAACCTGGG + Intronic
1158251991 18:55499544-55499566 ACTGTACATTAGAATCAACTGGG + Intronic
1158490890 18:57908780-57908802 GCTGCACATTAGAATCACCTGGG + Intergenic
1158505181 18:58041292-58041314 AATGCACATTAGCATCACCTGGG + Intergenic
1158514473 18:58119738-58119760 GCTGCACATCAGAATCACCTGGG + Intronic
1158578662 18:58662189-58662211 ACTGCATATTAGAATCATTTGGG - Intergenic
1159056209 18:63466851-63466873 ACTGCACATCAGAATCAAGAAGG - Intergenic
1159605271 18:70468376-70468398 GCTGTACATTACAATCACCTGGG - Intergenic
1159619103 18:70617146-70617168 CCTGTTCATTAGTATCACCTGGG - Intergenic
1159642288 18:70877345-70877367 ACTGTACAATGGAATCTGCTGGG - Intergenic
1159854297 18:73565879-73565901 GCTGAGCATTAGAATCATCTGGG - Intergenic
1160492045 18:79346872-79346894 ACTGTACATTTGAATAAAGGAGG + Intronic
1161473818 19:4473746-4473768 ACTGGACCTTAGAATGAAGTTGG + Intronic
1162882877 19:13673238-13673260 GCTGCACATTAGAATCTCCTGGG + Intergenic
1163076757 19:14899445-14899467 ACTGTATATATGAATCACCTAGG + Intergenic
1163261560 19:16193641-16193663 AATTTACATTAGAATCACCTGGG + Intergenic
1164407489 19:27964932-27964954 GCTGTACATTGGAATCACTTGGG + Intergenic
1165580519 19:36858801-36858823 AGTGTACATTAGAATCACTTGGG - Intronic
1165715000 19:38038750-38038772 GCTGTACATTAGAATTATGTTGG + Intronic
1167800392 19:51737066-51737088 ACTGTACGTAAGAATTACCTGGG - Intergenic
1168569509 19:57454089-57454111 ACTATATATTAGTAACAACTAGG - Intronic
925454788 2:4006980-4007002 GAAGTACATTAAAATCAACTGGG - Intergenic
925521358 2:4749337-4749359 AGTGCACATTAGAATGACCTGGG - Intergenic
925892867 2:8449966-8449988 ATAATACATTAGAATCACCTGGG - Intergenic
926291002 2:11530361-11530383 AGTGTGCATAAGAATCACCTAGG - Intergenic
926298309 2:11584165-11584187 ACTGTACATTAAACTCAACCGGG - Intronic
926615341 2:14991654-14991676 GCTGAACATTGGAATCATCTGGG - Intergenic
926667176 2:15538555-15538577 GCTGTATCTTAGAATCACCTGGG - Intronic
926764971 2:16316328-16316350 GATGTACATTACAATCACCTGGG + Intergenic
926785707 2:16516605-16516627 GCTGCACATCAGAATCACCTGGG - Intergenic
926860623 2:17305026-17305048 ACTTCACTTTAGAATCATCTTGG + Intergenic
926874429 2:17458888-17458910 AATGCACATTAAAATCAACTGGG + Intergenic
926899441 2:17734416-17734438 ACCGTTCATTAGAATCAACTTGG - Intronic
927295065 2:21444513-21444535 ACTATACATTAGAATCCTCTTGG + Intergenic
927647150 2:24885223-24885245 GCTGTGCCTTAGAATCACCTGGG + Intronic
928469247 2:31557291-31557313 GCTGCACATTAAAATCATCTGGG - Intronic
928485437 2:31726513-31726535 CTTGGACATTAGAATCAACTGGG - Intergenic
928492058 2:31794478-31794500 ATGTTACATTAGAATCAAGTGGG - Intergenic
928561178 2:32487235-32487257 ACTATAGATTAGAATCATCTGGG - Intronic
928613788 2:33016560-33016582 GCTGTACATTAGAATCACCTGGG - Intronic
928951287 2:36815359-36815381 GCTGTGCATTAGAATCACTTAGG + Intergenic
929000090 2:37339078-37339100 GCTGCACGTTAGAATCACCTGGG + Intergenic
929085888 2:38166999-38167021 GCTGCACATTAGAGTCAACTGGG - Intergenic
929177110 2:38991023-38991045 GCTGTACATTAGAATCCTATGGG + Intronic
929225252 2:39505594-39505616 GCTGTACTTTAGAATCACCTGGG + Intergenic
929245873 2:39702921-39702943 AGTGTACATCAGAATCACCTAGG - Intronic
929423155 2:41815754-41815776 ACTGCACATCAGAATCACCTGGG - Intergenic
929427412 2:41857227-41857249 ACTGCACATTAGAATCACCTGGG + Intergenic
929459634 2:42093341-42093363 GCTGCATATTAGAATCACCTAGG - Intergenic
929671719 2:43881081-43881103 ACTGCACATTAGAATTACCTGGG - Intergenic
929959933 2:46488861-46488883 ATTGCTTATTAGAATCAACTGGG - Intergenic
929997371 2:46837139-46837161 GCTGCACCTTAGAATCCACTGGG + Intronic
930004169 2:46882742-46882764 GCTGTACATGAGAATCACCTGGG - Intergenic
930090931 2:47531029-47531051 GCTGCACAATAGAATCACCTGGG + Intronic
930252609 2:49052442-49052464 GATGTACATTAGAATCATCAAGG + Intronic
930344889 2:50167697-50167719 ACTGTACACTAGAGTTAACTAGG + Intronic
930381232 2:50632582-50632604 AATGTACACTAGAATCACCTTGG - Intronic
930464455 2:51729184-51729206 AAGGCACATTAAAATCAACTTGG - Intergenic
930579513 2:53193612-53193634 AATATGCATTAGAATCATCTGGG + Intergenic
930608893 2:53519933-53519955 ACTGCATGTTAGAATCACCTGGG - Intergenic
930814748 2:55583735-55583757 ATTTTATTTTAGAATCAACTTGG - Intronic
930844810 2:55891395-55891417 ACTGTACAGTACAATTAACAAGG - Intronic
931029596 2:58157269-58157291 AATGCACATCAGAATCGACTGGG - Intronic
931070855 2:58647935-58647957 GCTGCACATTAGAATCACCTGGG + Intergenic
931141575 2:59464200-59464222 GCTGTACAGCAGAATCACCTGGG - Intergenic
931292460 2:60886260-60886282 GATGTACATCAGAATCACCTAGG - Intronic
931580632 2:63768594-63768616 GCTGTACATTAAAAGCACCTGGG - Intronic
931633094 2:64318820-64318842 GCTGTGCATTAGAATCATCTGGG - Intergenic
931756440 2:65378855-65378877 ACTGTACATTAGAATTACTGGGG - Intronic
931830794 2:66049271-66049293 AATGTACATTTGAGTCACCTGGG + Intergenic
931830898 2:66050307-66050329 GTTGTGCATTAGAATCATCTGGG - Intergenic
931874793 2:66500226-66500248 GCTGTATGTTATAATCAACTTGG + Intronic
931916835 2:66965434-66965456 GCTGTACATTTGAATCACCAAGG - Intergenic
932000320 2:67878886-67878908 GCTGTATATTAGAATCACCAGGG + Intergenic
932001206 2:67886788-67886810 ACTGCACATTAGAATCACCTGGG + Intergenic
932093923 2:68830254-68830276 ATTGTATATTGGAATCAACTGGG - Intergenic
932174452 2:69586773-69586795 ACAGCACATCAGAATCACCTTGG + Intronic
932210361 2:69923252-69923274 GCTGCACATGAGAATCACCTGGG - Intronic
932269849 2:70399791-70399813 AGTGCACATTAGAATCACCTAGG - Intergenic
932887748 2:75562120-75562142 AATGCACATTTGAATCATCTAGG - Intronic
933372679 2:81436546-81436568 GCTGCACATTAGAATCACCTGGG + Intergenic
933583064 2:84149253-84149275 CCTGCACATTGGAATCACCTTGG - Intergenic
933608504 2:84409405-84409427 GCTGCACATTAGAATCACCTGGG + Intergenic
933688759 2:85163102-85163124 GCTGCACATTTGAATCATCTGGG + Intronic
933693734 2:85199502-85199524 GCTGCACATTAGAGTCAACTGGG + Intronic
933722521 2:85407385-85407407 CCTGCACATTAGAATCATTTGGG + Intronic
934057722 2:88266418-88266440 ACTGCACATTAGAATCATGCAGG - Intergenic
934483201 2:94673051-94673073 GCTGCACATTAGAGTCACCTTGG - Intergenic
934610191 2:95729816-95729838 ACTGCACCTTAGAATCATCTGGG + Intergenic
935305003 2:101728824-101728846 GTTGCACATTAAAATCAACTAGG - Intronic
935419395 2:102851691-102851713 ACTGCAAATTAAAATCACCTGGG - Intergenic
935583884 2:104783634-104783656 CCTGCACATTAGAATCATCCAGG - Intergenic
935627602 2:105184254-105184276 ACTGTGCCATAGAATCACCTGGG - Intergenic
935662991 2:105485985-105486007 GCTGAGCATTAGAATCAGCTGGG - Intergenic
935925303 2:108061922-108061944 ACTATAAATTAGAATCACCTGGG + Intergenic
936006971 2:108897735-108897757 ACTGTACATTAGACTCACCTAGG + Intronic
936482558 2:112898388-112898410 ATTGTACATTAGGGTCATCTGGG + Intergenic
936543521 2:113371414-113371436 ACTGCACCTTAGAATCATCTGGG + Intergenic
936616979 2:114057785-114057807 GCTGCATATTAGAATCACCTGGG + Intergenic
936645083 2:114359470-114359492 ACTGCACTTTAGAATCACGTGGG + Intergenic
936930817 2:117786952-117786974 GCTGAACATTATAATCAACTGGG + Intergenic
937117151 2:119415975-119415997 AGTGCACATTAAAATCACCTAGG + Intergenic
937117219 2:119416418-119416440 ACTGCACATTAGAATCACCTGGG - Intergenic
937121526 2:119442713-119442735 GCTGCACATTAGAATCACCTGGG + Intronic
938593548 2:132763583-132763605 GCAGTACATCAGAATCACCTGGG - Intronic
938797672 2:134731880-134731902 ACTGCACATGAGATTCACCTGGG + Intergenic
938961967 2:136352216-136352238 GCTGCACATTAGAATCACCTGGG + Intergenic
939095362 2:137827623-137827645 GCTGCATATTAGAATCACCTGGG - Intergenic
939191566 2:138922336-138922358 AAGGGACATTAGAATCACCTTGG + Intergenic
939204167 2:139078610-139078632 GCTGTCCACTAGAATCAACTGGG - Intergenic
939234235 2:139470414-139470436 CCTGCACATTAGAATCAGTTGGG - Intergenic
939401385 2:141699168-141699190 GCTTCACATTAGAATCATCTGGG + Intronic
939614561 2:144348034-144348056 GCTGCACATTAGAATCACCTGGG + Intergenic
939670520 2:145006193-145006215 GCTGTATATTAGAATTACCTAGG - Intergenic
939748032 2:146002725-146002747 ACTGTGTTTTATAATCAACTAGG + Intergenic
939833294 2:147098540-147098562 ATTGTGCATTAGAATCATCATGG + Intergenic
939863839 2:147450576-147450598 AGTGTATATTAGAATGTACTAGG - Intergenic
939881998 2:147641474-147641496 TCTGGACATTAGAATCACCTGGG + Intergenic
940026473 2:149213850-149213872 GCTGCACATCAGAATCACCTCGG - Intronic
940424024 2:153510574-153510596 GCGGCACATTAGAATCACCTGGG + Intergenic
940646334 2:156396461-156396483 TCTGCATATTAGAATCACCTGGG + Intergenic
940646382 2:156397020-156397042 ACTGTACATTAGACTCACTGAGG - Intergenic
941046364 2:160680162-160680184 ATTGCACATTAGAACCATCTGGG + Intergenic
941222560 2:162802015-162802037 AGTGTGCATCAGAATCACCTAGG + Intronic
941312953 2:163957367-163957389 TCTGCACATTAGAATCACCTAGG + Intergenic
941323502 2:164084688-164084710 GCTGCACATTACAATCACCTGGG - Intergenic
941658800 2:168173024-168173046 GCTGCACATTAGAACCACCTGGG - Intronic
941746249 2:169089761-169089783 AATGTGCATTTGAATCACCTGGG + Intronic
941884967 2:170518579-170518601 GCTGTACATTAGAAACACCCAGG - Intronic
942032992 2:171981347-171981369 ATTGTAATGTAGAATCAACTTGG - Intronic
942243934 2:173990251-173990273 GCTGCACAATAGAATCATCTGGG - Intergenic
942389706 2:175479257-175479279 GCTGCACATTAGAATCATCTGGG - Intergenic
942571256 2:177316897-177316919 ACTGGACATCAGAATCACCTTGG + Intronic
942789149 2:179738641-179738663 GCTGCACATTAGAATCACGTTGG + Intronic
942792817 2:179780061-179780083 GCTGCCCATTAGAATCACCTGGG - Intronic
942804058 2:179909093-179909115 GCTGTACATTAACATCACCTGGG + Intergenic
942821949 2:180125002-180125024 CCTACACATTAGAATCACCTCGG - Intergenic
942841596 2:180368261-180368283 ACTGGATATTAGAATAAATTAGG + Intergenic
942889347 2:180968745-180968767 ACCATACATTGGAATCACCTAGG + Intronic
942889363 2:180968874-180968896 GCTACACATTAGAATCATCTGGG - Intronic
943122312 2:183752032-183752054 ATGGCACATTAGAATCACCTGGG - Intergenic
943288350 2:186034566-186034588 GCTGCACATTAGAATCACCTGGG + Intergenic
943332365 2:186574761-186574783 GCTGTACATTAGAAAAATCTGGG - Intergenic
943363637 2:186949155-186949177 GCTGCACATTAGAATCACCTAGG + Intergenic
943686885 2:190827866-190827888 GCTGTACACTGGAATCACCTGGG - Intergenic
944044475 2:195392950-195392972 ACTGCACATAAGAATCACCCAGG + Intergenic
944121528 2:196245849-196245871 ACTGCACATTAGAATCACTTAGG + Intronic
944213076 2:197226676-197226698 ACTATACATCAGAATCACCAGGG - Intronic
944284974 2:197939287-197939309 AATGCACATTAGAATGACCTGGG + Intronic
944293384 2:198033856-198033878 ACTGTGCATTAGAATTGCCTGGG + Intronic
944315663 2:198283269-198283291 ATTGTGCATTTGAATCATCTTGG + Intronic
944391075 2:199220297-199220319 ACTGTACTTTAGAATCCCATGGG - Intergenic
944541449 2:200757523-200757545 ACTGCACGTTAGAATCATCTGGG + Intergenic
944851397 2:203723140-203723162 ATTGAATATTAGAATCAAGTGGG + Intronic
944869449 2:203895070-203895092 GCTGCACATTAGAATCAACTGGG - Intergenic
944887355 2:204077023-204077045 TCTGCACATTACAATCAACTAGG - Intergenic
944898338 2:204188767-204188789 GCTGTACTTTAGAATCACTTGGG - Intergenic
945111210 2:206361373-206361395 GCTGCACATTAGAGTCACCTGGG - Intergenic
945335132 2:208583109-208583131 TCTGTACATTAGGTTCACCTGGG - Intronic
945379265 2:209120121-209120143 TCTGTACATTAAAATCACTTAGG + Intergenic
945444721 2:209922669-209922691 ACAGTACATTACAACCAACTGGG + Intronic
945695495 2:213098086-213098108 ACTGTGCATCAGAATTATCTGGG + Intronic
945941273 2:215953317-215953339 GCTGTATATTAGAATCACCCAGG + Intronic
945969464 2:216221712-216221734 GCTGTACACTGGAATCAGCTGGG - Intergenic
946184475 2:217971796-217971818 TCTGCACATTAGAATCACCTTGG - Intronic
946616616 2:221517120-221517142 ACTGTACAGGAGAATAAACCTGG + Intronic
946666171 2:222052131-222052153 ACTGTGCATGTGAATCACCTGGG - Intergenic
946774264 2:223121185-223121207 ACTGTACATTAAAATCACTTGGG + Intronic
946827555 2:223694603-223694625 ACTGCATATTAAAATCACCTTGG + Intergenic
946854441 2:223939249-223939271 AATGTGCATCAGAATCACCTGGG - Intronic
948505590 2:238425274-238425296 GCTGCACTTTAGAATCACCTGGG + Intergenic
1168901711 20:1370509-1370531 ACTGCACATGAGAGTCACCTGGG - Intronic
1168937014 20:1674236-1674258 GCTGCTCATTAGAATCATCTGGG - Intergenic
1169062362 20:2670641-2670663 GCTGCACATTACAATCACCTGGG + Intergenic
1169094004 20:2879980-2880002 GCTACACATTAGAATCACCTGGG - Intronic
1169302364 20:4455292-4455314 GCTGTGCATTAGAATCACCTAGG + Intergenic
1169507688 20:6230398-6230420 ATTATGCATTAGAATCACCTCGG - Intergenic
1169537189 20:6557844-6557866 ACTGTACATTGAAATCACCTAGG - Intergenic
1169633146 20:7656470-7656492 ACTGTACATATGAATTACCTGGG + Intergenic
1169648148 20:7836952-7836974 ACCGAACATTGGAATCACCTGGG - Intergenic
1169653412 20:7894530-7894552 GCTGCACATTGGAATCATCTGGG - Intronic
1169785476 20:9355068-9355090 GTGGTACATTAGAATCACCTGGG - Intronic
1169876056 20:10298081-10298103 GCTGTACATTAGAATCACCAGGG + Intronic
1169911494 20:10651142-10651164 GCTGTATATCAGAATCACCTGGG - Intronic
1169916397 20:10687993-10688015 GCTGTACATTGGAATCACCTAGG + Intergenic
1169965140 20:11208903-11208925 TCTGTACTTTAAAATCACCTGGG - Intergenic
1169979901 20:11372670-11372692 AGTGCACATTAGATTCACCTGGG - Intergenic
1169980341 20:11377702-11377724 GCAGTACATTAGAATCATCTGGG + Intergenic
1170036050 20:11991304-11991326 GCTGCACATTAGAATCACCCTGG + Intergenic
1170137931 20:13095666-13095688 AGTATACATTATAATCATCTGGG - Intronic
1170252877 20:14304972-14304994 ACTATATATTAGAATCAATGGGG + Intronic
1170295612 20:14821511-14821533 ACTGCACATTGAAATCATCTGGG - Intronic
1170408446 20:16063832-16063854 ACTGCACATTACAATCATCCAGG + Intergenic
1170412230 20:16104213-16104235 AGTGCACATCAGAATCACCTAGG + Intergenic
1170478716 20:16743934-16743956 GCTGCATATTAGAATCATCTGGG + Intergenic
1170549268 20:17462289-17462311 TCTGCACATTGGAATCACCTGGG - Intronic
1170599077 20:17827409-17827431 TCTGCACATTATAATCACCTGGG + Intergenic
1170721771 20:18887202-18887224 GCTGTACATTAGAGTCACATTGG + Intergenic
1170860002 20:20094001-20094023 ACTGCACCTTGGAATCATCTGGG - Intronic
1170962466 20:21037583-21037605 GCTGCACATTAGAATCACCTGGG - Intergenic
1171916460 20:31065583-31065605 CCTGTACATTACATTCTACTGGG - Intergenic
1171917297 20:31070875-31070897 CCTGTACATTACATTCCACTGGG - Intergenic
1172488091 20:35311706-35311728 ATTGCACATTAAAATCACCTGGG + Intronic
1173036969 20:39421288-39421310 GCTGCACAGTAGAATCAGCTGGG + Intergenic
1173041533 20:39468690-39468712 GCTGTACCTTAGAATCATCAGGG + Intergenic
1173258937 20:41415944-41415966 CCTGTGCATCAGAATCACCTGGG + Intronic
1173258945 20:41416039-41416061 ACTGCACATTGGAATCAGCTGGG - Intronic
1173299584 20:41789898-41789920 AGTGAACAATAGAATCTACTTGG - Intergenic
1173340205 20:42146463-42146485 ACTGCACATTAGAATCACCTGGG + Intronic
1173365616 20:42382075-42382097 TCTGAACATTAGAATCAACTTGG + Intronic
1173478163 20:43377809-43377831 GCTGCACATTAGAATCCCCTGGG - Intergenic
1173807578 20:45935846-45935868 GCTGTGCATCAGAATCATCTTGG - Intronic
1173938649 20:46891316-46891338 GCTGTATATTGGAATCACCTAGG + Intergenic
1174002097 20:47382292-47382314 GCTACACATTAGAATCAGCTGGG - Intergenic
1174422506 20:50408818-50408840 GCTGTGCATCAGAATCACCTGGG - Intergenic
1174488360 20:50875079-50875101 ACTCTGCATGAGAATCACCTGGG + Intronic
1174735943 20:52965941-52965963 GCTGAACATCAGAATCACCTGGG - Intergenic
1174852082 20:54005545-54005567 ACTGGATTTTAGAATCACCTGGG + Intronic
1175034580 20:55988100-55988122 ACTGTACTTAAGAATCATCTGGG - Intergenic
1175503713 20:59467653-59467675 ACTGCTCATTAGAATCCCCTGGG - Intergenic
1175504479 20:59471797-59471819 GCTGAACATTCAAATCAACTGGG - Intergenic
1175637211 20:60595855-60595877 GCTGCACATTAGAACCACCTGGG - Intergenic
1175655880 20:60770355-60770377 ACTGCATATTAGAATCATGTTGG + Intergenic
1176920336 21:14680174-14680196 ACTGCACATTAGAATCACCTGGG + Intergenic
1177045401 21:16162639-16162661 ACTGCACATTAGAGTCACCTGGG + Intergenic
1177805935 21:25874827-25874849 GCTGTGTATTAGAATCATCTGGG + Intergenic
1177958499 21:27631042-27631064 GGTGCACATTAGCATCAACTTGG - Intergenic
1178129168 21:29550478-29550500 CCAGCACATTAAAATCAACTGGG + Intronic
1178139193 21:29662920-29662942 GCTGTACATAAGTATCACCTGGG - Intronic
1178149419 21:29777042-29777064 ACTGTACATTAGAGTCATATTGG + Intronic
1178327271 21:31656171-31656193 GCTGCACAATAGAATCACCTGGG - Intergenic
1178503424 21:33144409-33144431 ACTGCGCATCAGAATCACCTCGG + Intergenic
1178586152 21:33873109-33873131 ACTGTACGTTAGAATCCTTTTGG - Intronic
1178964663 21:37104887-37104909 ACTGCACATTAGTACCATCTGGG - Intronic
1180631593 22:17233832-17233854 GCTGCACCTTAGAATCACCTGGG + Intergenic
1181772001 22:25132345-25132367 GCTGCACCTTAGAATCACCTAGG - Intronic
1181789935 22:25257223-25257245 GCTGCACATTAGGATCACCTGGG + Intergenic
1181909823 22:26229755-26229777 GCTGCACATTTGAATCATCTGGG - Intronic
1182012314 22:27011193-27011215 ACTGCTCATTGGAATCACCTGGG - Intergenic
1182169126 22:28208930-28208952 ACTGCTCATTGGAATCATCTGGG + Intronic
1182805235 22:33064160-33064182 ACTATACATTAGTGTCATCTGGG - Intergenic
1183145230 22:35984291-35984313 ACTGTGCGTTAGAATCACCTGGG - Intronic
1183769498 22:39911904-39911926 ACTGTGCATAAGAATCACCAGGG - Intronic
1183910062 22:41072268-41072290 ACTGAAAATTAGAATCAGCCAGG + Intergenic
1183926833 22:41212304-41212326 TCTGCACATTAGAATCATCTAGG + Intronic
1183927258 22:41215089-41215111 GCTGCACATTAGGATCACCTGGG - Intronic
1184006452 22:41713134-41713156 GCTGCACATTAGACTCACCTAGG - Intronic
949311893 3:2709317-2709339 GCTGCATATTAGAATCATCTGGG + Intronic
949723497 3:7017624-7017646 GCTGTACATTATTATCACCTGGG + Intronic
949776750 3:7641637-7641659 GCTGTACATTAGAATCATCTGGG - Intronic
949934773 3:9108177-9108199 CCTGTACACTAGAATCAACTGGG + Intronic
949968547 3:9381379-9381401 AATGTACATGTGAATCACCTAGG + Intronic
950274424 3:11646500-11646522 ACTGCATATTGGAATCACCTGGG - Intronic
950297645 3:11846049-11846071 GCTGCGCATTAGAATCACCTGGG + Intronic
950406176 3:12806521-12806543 ACTGCATGTTAGAATCACCTGGG + Intronic
950406212 3:12806704-12806726 CCTGTGCATTGGAATCACCTGGG + Intronic
950954994 3:17043197-17043219 GCTGTACATTAGAAACACCTGGG - Intronic
951362456 3:21740955-21740977 GCTGTACAAAAGAATCACCTGGG - Intronic
951383929 3:22021898-22021920 TCTGCACATTAGAATCACCTGGG - Intronic
951465879 3:23000039-23000061 GCAGCACATTAGAATCATCTGGG - Intergenic
951574755 3:24102166-24102188 ACTGTGCTTGAGAATCACCTGGG - Intergenic
951594023 3:24297735-24297757 GCTGCACATTATAATCACCTGGG + Intronic
951596437 3:24323457-24323479 ACTGTGCATAAAAATCACCTGGG + Intronic
951632608 3:24737930-24737952 GCTGCACATTAGAAGCACCTGGG + Intergenic
951637425 3:24794968-24794990 AAGGAACATAAGAATCAACTGGG - Intergenic
951849830 3:27126734-27126756 GCTGCAAATTAGAATCACCTGGG + Intronic
952961204 3:38590249-38590271 GCTGCACATTAGAGTCACCTGGG - Intronic
953093792 3:39755135-39755157 GCTGTTCATTACAATCAACTGGG - Intergenic
953290686 3:41658379-41658401 GCTGTACATTAGTATCACTTGGG - Intronic
953572633 3:44083249-44083271 GCTGCACATTAGAATTACCTGGG + Intergenic
953735392 3:45489845-45489867 GCTGCACATCAGAATCAACTAGG - Intronic
954204621 3:49049206-49049228 GCTGGACATTAAAATCACCTGGG - Intronic
954493301 3:50928592-50928614 AATATGCAATAGAATCAACTAGG - Intronic
954726485 3:52615655-52615677 TCTGTGCATTAGAATCACCTGGG - Intronic
954863194 3:53707204-53707226 GCTGTACGTTATAATCACCTGGG + Intronic
955062897 3:55508802-55508824 ACTGTACATCGAAATCAAATGGG + Exonic
955154926 3:56407688-56407710 ACTGCACATTAGAGTCACATGGG + Intronic
955655863 3:61244249-61244271 GCTGTAAGTTAGAATCACCTGGG - Intronic
955734087 3:62018204-62018226 AATGTACATCAGAATTAAGTGGG + Intronic
955803600 3:62710646-62710668 GCTGTGCATCAGAATCACCTGGG - Intronic
955830360 3:62994984-62995006 GCTGTACATTGTAATCACCTGGG - Intergenic
955837922 3:63078090-63078112 GCTTTACATTAGAATCACCTGGG + Intergenic
955981504 3:64531977-64531999 GCTGTACATTTGAATCATTTGGG + Intronic
956060243 3:65341558-65341580 GCTGCAGATTAGAATCACCTGGG + Intergenic
956105729 3:65816152-65816174 ACTCTACATTAAAATCACCTGGG - Intronic
956150530 3:66237314-66237336 CCTGCACATTAGAATCTACTGGG + Intronic
956202753 3:66723304-66723326 AATGTACATGTGAATCACCTAGG - Intergenic
956296242 3:67716662-67716684 ACTGTACGTTGAAATCACCTGGG + Intergenic
956410282 3:68971857-68971879 CCTGTACATCAGAACCACCTGGG + Intergenic
956660468 3:71592348-71592370 ACTGCACATTAGAATCACCTGGG - Intergenic
956698057 3:71935400-71935422 GCTGTGCATTAGAAGCACCTGGG + Intergenic
956725617 3:72154401-72154423 ACTGTATATTGGAATAACCTGGG - Intergenic
956740230 3:72269939-72269961 GCTTTACATTAGAATAAACTGGG - Intergenic
956764879 3:72476285-72476307 ACTCTGTATTAGAATCACCTGGG + Intergenic
956774466 3:72553408-72553430 GCTGCACATTAGAATCACATAGG - Intergenic
957065427 3:75518158-75518180 GCTGCACATCAGAATCAGCTGGG + Intergenic
957194658 3:77051850-77051872 ACTGAACATTTGAATGAAGTCGG + Intronic
957540789 3:81566348-81566370 TCTGTACATTGGAATCACCTGGG - Intronic
957564448 3:81866204-81866226 GCTGTACCTTAGAATCACCTGGG + Intergenic
957578535 3:82040274-82040296 ACTGTATATTAAAATCAAGAAGG - Intergenic
958568267 3:95844541-95844563 ACTGCACATTAGAAGTATCTAGG + Intergenic
958801841 3:98765018-98765040 AGTGTGCATAAGAATCAAATTGG + Intronic
958911573 3:100000076-100000098 ATTATATATTAGAATCAACTTGG - Intronic
958982961 3:100746239-100746261 ACTATGCTTTAGAATCACCTGGG + Intronic
959011162 3:101078076-101078098 ACTCTAGATTTGAATTAACTTGG + Intergenic
959425418 3:106181092-106181114 ACTACACATTAGAATCATCTGGG - Intergenic
959646788 3:108712498-108712520 GCTACACATTAGAATCACCTGGG + Intergenic
959699903 3:109289032-109289054 ACTATGCATTACAATAAACTTGG + Intergenic
959761662 3:109973400-109973422 GCTGCACACTAGAATCATCTGGG - Intergenic
959817455 3:110691642-110691664 ACTGTACATCAGAATCACCTGGG - Intergenic
959824605 3:110778752-110778774 TTTGCACATTAGAATCACCTGGG + Intergenic
959829189 3:110840047-110840069 GCTGCACATTAGAATAATCTGGG - Intergenic
959829771 3:110846845-110846867 ACTGTACTTTAGTATCAACAAGG - Intergenic
959915110 3:111808003-111808025 GCTGCACATTAGAGTCACCTGGG + Intronic
960049997 3:113230027-113230049 ACTGCACAGGAGAATCATCTGGG - Intronic
960065210 3:113364850-113364872 ACTGTACTTTAGAATCAGCTAGG - Intronic
960077069 3:113498207-113498229 ACTGCACATTAGAATCAGTCAGG - Intronic
960475338 3:118117595-118117617 GCTGTAGGTTAGAATCACCTGGG - Intergenic
960511918 3:118559674-118559696 ACTCAACATTAGAATCATCAGGG - Intergenic
960594557 3:119396321-119396343 ACTGCATATCAGAATCACCTGGG - Intronic
961019487 3:123492817-123492839 ACTATAAAATAGAATCAACTTGG - Exonic
961107207 3:124252173-124252195 GCTGCACATTAGAATCACCAGGG + Intronic
961142492 3:124567077-124567099 GCTGCACATGAGAATCATCTGGG + Intronic
961184361 3:124901786-124901808 ACCGCACATTAGAAGCACCTGGG + Intergenic
961906502 3:130268539-130268561 ATTGTACACTAGAGTCACCTGGG + Intergenic
962036167 3:131654000-131654022 ACTGCACATTATAATCACCTTGG + Intronic
962037405 3:131667312-131667334 ATTATACATTAGAGTCACCTGGG - Intronic
962043503 3:131732014-131732036 ACTGTGCATTGGAATCACCTGGG - Intronic
962184028 3:133239405-133239427 GCTGTACACTAGAATCACCTCGG + Intronic
962297257 3:134202165-134202187 GCTGTACATTAGAATCATCCAGG + Intronic
962461996 3:135622747-135622769 GTTGCACATTAGAATCACCTGGG - Intergenic
962569445 3:136697519-136697541 ACCACACATTAGAATCATCTAGG - Intronic
962597495 3:136961376-136961398 AATGCACATTGGAATCACCTGGG + Intronic
962731694 3:138289612-138289634 GCTGCATATTAGAATCACCTGGG + Intronic
962804883 3:138919871-138919893 GCTGCACATTAGAAGCACCTGGG + Intergenic
962900028 3:139754033-139754055 ACTGTACATTAGAATCACCTAGG + Intergenic
963126061 3:141817896-141817918 GCTGCACATTAGAATCACCTGGG - Exonic
963486700 3:145943158-145943180 GCTGCACATTGGAATCACCTGGG - Intergenic
963751790 3:149187535-149187557 ACTGCACATTAGAATCAACTGGG - Intronic
963808389 3:149749442-149749464 ATTGCACATTAGAATTACCTGGG + Intronic
963839425 3:150090575-150090597 ACAGTGCATCAGAATCACCTGGG - Intergenic
963892071 3:150647205-150647227 GCTGTACATTAGAATCACCCTGG - Intergenic
963927033 3:150961398-150961420 GCTGCACTTTAGAATCATCTGGG - Intronic
964022560 3:152031516-152031538 ACTGTGCATAAGAGTCATCTGGG - Intergenic
964339621 3:155694348-155694370 GCTGTGCATTGGAATCACCTGGG - Intronic
964340988 3:155708104-155708126 ACTACACATTAGAATCATCTGGG + Intronic
964363478 3:155923740-155923762 GCTGTATGTTAGAATCATCTGGG + Intronic
964428093 3:156574327-156574349 TCTGCTCATTAGAATCACCTGGG + Intergenic
964433357 3:156627522-156627544 GCTGCACATTAGAATCAACTGGG + Intergenic
964544179 3:157815247-157815269 GATGCACATTAGAATCACCTGGG - Intergenic
964627233 3:158771459-158771481 ATTGCAAATTAGAATCACCTAGG + Intronic
964873696 3:161341790-161341812 GCTGTACATTAGAATCGTCTGGG - Intergenic
964903037 3:161683065-161683087 ACTGCATTTTAGAATCACCTGGG + Intergenic
964907071 3:161729804-161729826 ACTACATATTAGAATCACCTGGG + Intergenic
965346809 3:167561331-167561353 CCTGTACATTAAAACCACCTGGG + Intronic
965381460 3:167994417-167994439 AATGTGCATTAGATTCACCTGGG - Intergenic
965401815 3:168221459-168221481 ACTGTAAAAGAGAATCACCTGGG - Intergenic
965440380 3:168705801-168705823 ACTACACATTAGAATCACTTAGG + Intergenic
965508092 3:169538090-169538112 GCTGCACATTAGAATCAACTGGG - Intronic
965508371 3:169541100-169541122 AATGTGCATTAGAATAAGCTGGG + Intronic
965611342 3:170547043-170547065 GCTGCACATTAGAATCACCTGGG - Intronic
965611497 3:170548579-170548601 GCTGCACTTGAGAATCAACTGGG + Intronic
965642875 3:170849373-170849395 CCTGCACATTAGAATCTCCTGGG - Intronic
965664771 3:171081514-171081536 ACTGCACTTTATAATCACCTAGG - Intronic
965988323 3:174783874-174783896 CCTGTACATCAGTATCACCTGGG - Intronic
966125355 3:176570048-176570070 GCTGCACATTACGATCAACTGGG + Intergenic
966273953 3:178142128-178142150 ACTGAACGTTAGAATCACCCGGG + Intergenic
966281677 3:178238294-178238316 GCTATACATTAGAATCACCTGGG - Intergenic
966572581 3:181461953-181461975 ATTGCACATTAAAATCATCTGGG - Intergenic
966751076 3:183322863-183322885 TATGTACGTTAGAATCATCTGGG + Intronic
966937782 3:184725157-184725179 GCTGTACATTAGAATCACCTGGG + Intergenic
967004103 3:185367321-185367343 GCTGCACATTAGACTCAGCTGGG - Intronic
967130792 3:186469062-186469084 ATTATACATTAGAATCACCTGGG - Intergenic
967230570 3:187333975-187333997 ACTGTATATTGGGATCACCTAGG + Intergenic
967440779 3:189505846-189505868 TCTGTAAATTAGAATCACTTGGG + Intergenic
967440789 3:189505970-189505992 ACTGTACATTAGAATCACCTGGG - Intergenic
967479958 3:189961564-189961586 GCTGCACGTTAGAATCACCTGGG + Intronic
967540429 3:190660943-190660965 TGTGTGCATTAGAATCACCTGGG - Intergenic
967613569 3:191537604-191537626 GCTGCACATTAGAATCATCTGGG - Intergenic
967663645 3:192145455-192145477 ACCGTACATGGGAATCACCTAGG + Intronic
967743430 3:193028405-193028427 GCTGCACATTAGAGTCAGCTGGG + Intergenic
967883222 3:194315944-194315966 ACTTCACATTAGAATCACTTGGG + Intergenic
967935042 3:194720416-194720438 ATTGTACATTAGAATCACCTGGG - Intergenic
968298519 3:197595509-197595531 GCTGCACTTTAGAATCACCTGGG - Intergenic
968724090 4:2233043-2233065 CTTGTACATTAGAATCATCAGGG - Intronic
969010008 4:4054244-4054266 GCTGCACATCAGAATCACCTGGG + Intergenic
969067143 4:4494988-4495010 ATTGTACATTAGAATCATCCAGG - Intronic
969555874 4:7909732-7909754 ACTGTATATCAGAACCATCTGGG + Intronic
969744223 4:9057007-9057029 GCTGCACATCAGAATCACCTGGG - Intergenic
970177775 4:13356576-13356598 AGTGAGCATAAGAATCAACTAGG + Intergenic
970338110 4:15074271-15074293 CCTGTACAGTAGAATCACCTGGG - Intergenic
970702961 4:18764525-18764547 ACTGAATGTTAGAATCAACTTGG - Intergenic
970814479 4:20137918-20137940 ATTGTACATTGGAATCACCAAGG + Intergenic
971228163 4:24774255-24774277 TCTGTACTTTAGAATCATCTGGG - Intergenic
971263125 4:25075226-25075248 ACTGCACATCAGATTCACCTGGG + Intergenic
971344363 4:25798461-25798483 ACTGCACACTGGAATCACCTGGG - Intronic
971428935 4:26543369-26543391 ACTACACATTAGAGTCACCTGGG - Intergenic
971870625 4:32233002-32233024 ACTATAAATTAGAATTACCTTGG - Intergenic
971975104 4:33674050-33674072 GCTGAATATTAGAATCAAATGGG - Intergenic
972095001 4:35337545-35337567 ACTGTGCATAAGAATCAATGGGG + Intergenic
972136275 4:35898419-35898441 AATGCACATTAGAATCATCTGGG - Intergenic
972140091 4:35947564-35947586 ACTGTACCATAGAATCTATTTGG - Intergenic
972171440 4:36350405-36350427 CCTACAAATTAGAATCAACTGGG - Intergenic
972430492 4:38976792-38976814 AATGTGCGTCAGAATCAACTTGG - Intronic
972444529 4:39130631-39130653 GCTGCACATTAGAATCACCTGGG - Intergenic
972815922 4:42645469-42645491 ACTGCACATGAGAATTACCTAGG + Intronic
973170724 4:47139749-47139771 AATGTAAATATGAATCAACTGGG + Intronic
973186251 4:47332664-47332686 GCTGCATATTGGAATCAACTTGG - Intronic
973835188 4:54802625-54802647 ACTGTGCATCAGCATCACCTGGG + Intergenic
974005529 4:56552786-56552808 GCTGTACATTGGAATCACCTGGG + Intronic
974019255 4:56678338-56678360 GCTGCACATTAGACTCACCTGGG + Intronic
974030921 4:56775750-56775772 TCTTTACATTAGAAACAATTTGG - Intergenic
974067833 4:57096545-57096567 GCTGTACATCAGAATCACCTGGG - Intronic
974079377 4:57196395-57196417 GCTGTACATTAGAAACACCGGGG - Intergenic
974696541 4:65382658-65382680 GCTACACATTAGAATCAACAAGG + Intronic
974793847 4:66723113-66723135 ACCATATATTAGAATCACCTGGG - Intergenic
975114886 4:70669198-70669220 AGTGCACATCAGAATCAACTGGG - Intronic
975711448 4:77164064-77164086 GCTGCACATTACAATCACCTAGG + Intronic
975772710 4:77745786-77745808 TCTGTTCATTATAATCACCTGGG - Intronic
975957861 4:79863623-79863645 GATGCACATTAGAATCATCTAGG + Intergenic
976027440 4:80706839-80706861 AGTATACATAAGAATTAACTGGG + Intronic
976083586 4:81383962-81383984 ACTGTACACTAGAATCACTTGGG + Intergenic
976208334 4:82642715-82642737 ACTGCACATTAGAATAAATTGGG + Intronic
976209369 4:82651994-82652016 ACTGTGCATTTGAATCACCTGGG + Intronic
976325954 4:83771866-83771888 GCTGTGCATTAGAATCACTTGGG + Intergenic
976623052 4:87148778-87148800 ACTGTCCTTTAAAATCATCTTGG + Intergenic
976844308 4:89470369-89470391 AATATAAATTAGAAGCAACTGGG - Intergenic
976847500 4:89506738-89506760 AATGCACATTATAATCACCTGGG - Intergenic
977000632 4:91495839-91495861 ATTGTACATCAGAAAAAACTCGG - Intronic
977179392 4:93855527-93855549 ACCGCACATTAGAGTCACCTGGG + Intergenic
977252993 4:94709475-94709497 GCTGCACATTAGAATCACCTGGG - Intergenic
978322433 4:107512888-107512910 AGGGCACATTAGAATCAACTGGG - Intergenic
978346874 4:107779826-107779848 GCTGCACATTAAAATCATCTTGG - Intergenic
978849761 4:113320327-113320349 GCTGTGCATTAGAATCACCTAGG + Intronic
978955859 4:114612444-114612466 ACTGCACATAATAATCACCTGGG - Intronic
979022071 4:115514944-115514966 ATTGAACATTAGAATCACCTGGG - Intergenic
979186052 4:117794679-117794701 TCTGTGCATTAGAATTACCTAGG + Intergenic
979416273 4:120443334-120443356 GCTAAACATTAGAATCATCTAGG + Intergenic
979466016 4:121039512-121039534 GCTGTATATTAGAATCACCTGGG + Intronic
979583064 4:122382728-122382750 AATATACATAAGAATCATCTGGG + Intronic
980785392 4:137547633-137547655 ACTGTAGATTATAATCACCTGGG - Intergenic
980968561 4:139547237-139547259 AGTGTACATAACAATCAATTTGG - Intronic
981056718 4:140370544-140370566 TCAGTATATTAGAATCACCTGGG - Intronic
981147287 4:141339947-141339969 AGTACACATTAAAATCAACTGGG + Intergenic
981227652 4:142315511-142315533 GCTGTACATTAGAATCACCTGGG + Intronic
981353709 4:143762553-143762575 TTTGTATATTAGAATCACCTGGG - Intergenic
981398917 4:144288723-144288745 GCTGCACATTGGAATCACCTCGG + Intergenic
981911327 4:149984732-149984754 TTTGTACATTAGAATCACATGGG - Intergenic
982035263 4:151339688-151339710 ACTGTGCATGTGAATCACCTGGG - Intergenic
982080790 4:151787512-151787534 GCTGTACATTAGAATCACTTGGG + Intergenic
982105078 4:152004634-152004656 GCTGCACATTAGAATCATCTGGG - Intergenic
982296813 4:153837327-153837349 GCTGCACAATAGAATCACCTGGG + Intergenic
982541747 4:156681145-156681167 ACAGTACATAAGAATCCACTAGG - Intergenic
983567960 4:169174691-169174713 ACTGCATATTAGGATCAACTAGG + Intronic
983670567 4:170232638-170232660 AGAGTACATTAGCATTAACTTGG - Intergenic
983737181 4:171076131-171076153 GCTGCACATTAGAATCACCTGGG + Intergenic
984599360 4:181708761-181708783 GCTACACATTAGAATCACCTGGG - Intergenic
986973958 5:13373220-13373242 AATGTACATTTGAATCAACTGGG - Intergenic
987027354 5:13940632-13940654 GCTGTACATTAGAATCACCAGGG - Intronic
987358569 5:17086225-17086247 GATGTACATTAAAGTCAACTGGG - Intronic
988560711 5:32278700-32278722 CCAGTACATCAGAATCATCTGGG - Intronic
988806138 5:34742455-34742477 GCTGCACATTAGAATCACCTAGG - Intronic
989133440 5:38129976-38129998 GATGTACATTAGGATCACCTGGG + Intergenic
989247626 5:39272073-39272095 GCTGCACATTAAAATCACCTGGG + Intronic
989311979 5:40030235-40030257 CCTGCACATTAGAATCATCTAGG + Intergenic
989362092 5:40613344-40613366 GCTGAACACCAGAATCAACTGGG - Intergenic
989453675 5:41616753-41616775 GCTGCACATCAGAATCACCTGGG - Intergenic
989514325 5:42324222-42324244 ACTGTTCATTTCAAACAACTTGG - Intergenic
989545471 5:42667488-42667510 GCTGCACATTAGAATCACCTGGG + Intronic
989606332 5:43247536-43247558 ACTGCACATTAGAATTACCTGGG + Intronic
989734238 5:44683843-44683865 ATTGAACATTAGAATCACCTGGG - Intergenic
989973301 5:50551027-50551049 ACTGTAAATTACAATCTACCTGG - Intergenic
990086656 5:51987058-51987080 CCTGCACATTAGAATCACCGAGG + Intergenic
990086668 5:51987142-51987164 CCTGCACATTAGAATCACCTGGG - Intergenic
990312650 5:54554376-54554398 ATTGTACATCAGAATCATCTGGG - Intergenic
990371825 5:55127501-55127523 ACTGTGTATTAGGATCAGCTGGG + Intronic
990483105 5:56230390-56230412 GCTGTACTTAAGAATCATCTGGG - Intronic
990600105 5:57349726-57349748 AATGTGCATCAGAATCACCTAGG - Intergenic
990733349 5:58833270-58833292 GCTGTACATTCGAACCACCTAGG + Intronic
990897853 5:60718037-60718059 TCTGCACATTACAATCACCTGGG + Intergenic
990907974 5:60823853-60823875 GCTGCATATTAGAATCATCTGGG - Intronic
990938598 5:61177164-61177186 GCTGTACATTAGAATCACCTGGG + Intergenic
991022729 5:61997418-61997440 GCTACACATTAGAATCACCTGGG + Intergenic
991037246 5:62140031-62140053 ATTGTACTTTAGAATCACCTGGG - Intergenic
991430738 5:66542189-66542211 ACTGCACATTAGAATCACATGGG + Intergenic
991595957 5:68305789-68305811 GCTGAACATTAGGATCACCTGGG + Intergenic
991603630 5:68378645-68378667 ACTGCACTTTAGAATCCCCTGGG - Intergenic
991684875 5:69172557-69172579 ACAACACATTAGAAACAACTGGG - Intronic
991769543 5:70027825-70027847 GCTGCACATTAGAATCACCTGGG + Intronic
991769814 5:70029660-70029682 GCTGCACATTAGAATCACCTGGG - Intronic
991848838 5:70903243-70903265 GCTGCACATTAGAATCACCTGGG + Intronic
991849109 5:70905078-70905100 GCTGCACATTAGAATCACCTGGG - Intronic
992001693 5:72442451-72442473 GCTGTACATTAGAAGCATCTGGG - Intergenic
992179587 5:74183489-74183511 GCTGTGCATTAGAATTACCTGGG - Intergenic
992233960 5:74689168-74689190 GCTGTACATTAGAATCACTTGGG - Intronic
992263633 5:74995105-74995127 CTTGTACATTAGAATCACCTGGG - Intergenic
992649402 5:78842987-78843009 GCTGTACATTAGAATTACCTGGG + Intronic
992649427 5:78843164-78843186 AATGTACATATGAATCATCTGGG + Intronic
992661139 5:78961965-78961987 ACCATATATTAGAATCATCTGGG - Intronic
992667020 5:79020291-79020313 GCTGGACATTAGAATCATCTGGG - Intronic
992680030 5:79144220-79144242 ACTGCATGTTGGAATCAACTGGG - Intronic
992738482 5:79748234-79748256 GCTGTGCATTAGAATCATCTAGG - Intronic
992863073 5:80931707-80931729 ATTGTACATTACCATTAACTTGG + Intergenic
992949009 5:81838378-81838400 GCTGTACATTTGAATCACCTGGG - Intergenic
993151758 5:84171768-84171790 GTTGTACATTAGAATTATCTGGG + Intronic
993152432 5:84178202-84178224 AGTGTATATGAGAGTCAACTGGG + Intronic
993197617 5:84769071-84769093 GCTTTACATTAGAATCACATGGG + Intergenic
993648107 5:90484054-90484076 GCTGTGTATTAGAATCACCTGGG + Intronic
993692854 5:91024090-91024112 GCCGCACATTAGAATCAGCTGGG - Intronic
993694061 5:91038962-91038984 ACTCCTCATTAGAATCAACATGG - Intronic
993706965 5:91182213-91182235 ACTGTACTTTAGAATCACCCTGG + Intergenic
993710901 5:91223722-91223744 GATGCACATTAGAATCATCTAGG - Intergenic
993856802 5:93086473-93086495 GCTATACAATAGAATCACCTGGG + Intergenic
994071721 5:95610354-95610376 GCTGCACATTAGAATCACCTGGG - Intergenic
994115147 5:96053282-96053304 GCTGAACATTAGAATCCCCTGGG - Intergenic
994133915 5:96263171-96263193 TCTGCACATTAGAATCACTTGGG - Intergenic
994172201 5:96669864-96669886 GCTGTATATTGGAATCATCTGGG + Intronic
994188964 5:96846352-96846374 TCTGCACATTAGAATCAACTGGG + Intronic
994292236 5:98041433-98041455 GCTGACCATTAGAATCACCTGGG + Intergenic
994367808 5:98935267-98935289 ATGGCACATTAGAATCACCTAGG - Intergenic
994404113 5:99321728-99321750 ACTGTACATTGGAATGTAGTTGG - Intergenic
994493371 5:100477657-100477679 GCTGTACATTACAATAACCTGGG - Intergenic
994626403 5:102225662-102225684 ACTTAACTTTAGAATCACCTGGG + Intergenic
994656567 5:102601288-102601310 GTTGTACATTAGAATCACCTGGG - Intergenic
994686773 5:102965061-102965083 ACTATACAATAGACTCAATTAGG + Intronic
994689799 5:103003317-103003339 ACTGAATATTAGAATCATCTGGG + Intronic
994740178 5:103608381-103608403 AGTATGCATTAGAATCACCTAGG - Intergenic
994935152 5:106244974-106244996 ACTGTACATTTAAATTACCTTGG + Intergenic
995041518 5:107593542-107593564 GCTGCACATCAGAATCACCTAGG + Intronic
995411110 5:111858213-111858235 AGTGTGCATCAGAATCACCTGGG - Intronic
995447381 5:112260404-112260426 ACTGTACAGAAGTATCACCTGGG - Intronic
995477219 5:112560463-112560485 GCTACACATTAGAATCACCTGGG + Intergenic
995786810 5:115839642-115839664 GATACACATTAGAATCAACTAGG + Intronic
995958221 5:117806360-117806382 GCTGTACATTAAGATCATCTGGG - Intergenic
996006527 5:118427408-118427430 ATTGCACATCATAATCAACTGGG + Intergenic
996137828 5:119866903-119866925 GCCGCACATTAGAATCACCTAGG - Intergenic
996252855 5:121358780-121358802 ACTGTAGATTTGATGCAACTGGG - Intergenic
996497788 5:124181563-124181585 AGTGTTCATTAGAATACACTGGG + Intergenic
996545508 5:124674288-124674310 GCTGCACATTGGAATCAACTGGG + Intronic
996547620 5:124696897-124696919 TTTGCACATTAGAATCACCTAGG + Intronic
996688525 5:126311270-126311292 GCTGCACATTAGATTCACCTGGG - Intergenic
997551515 5:134757593-134757615 ACTGTACTTCAGAATTACCTGGG + Intergenic
997595645 5:135105559-135105581 GCTGTGCATTACAATCACCTGGG - Intronic
997893139 5:137692991-137693013 GCTGTACATTAGAAGCACCTGGG - Intronic
998016944 5:138739913-138739935 GCTGCACATTAGAATCACCCAGG + Intronic
998104219 5:139457948-139457970 AAGGTACATTAGACTCAGCTAGG + Intronic
998347917 5:141480760-141480782 TCTGCACATTAGGATCAAGTGGG - Intronic
998352344 5:141509665-141509687 ACTGTACAGAAGAAGAAACTGGG - Intronic
998393221 5:141801192-141801214 ACAGTACATTGGAATCATCTGGG + Intergenic
998518945 5:142782504-142782526 GCTGCACATTAGAATCACCTGGG - Intronic
998863434 5:146469694-146469716 ATAGAACATTAGAATCAACCTGG + Exonic
998919084 5:147047979-147048001 ACTGTACATAAGATTCACTTGGG + Intronic
999376911 5:151093197-151093219 ACTGCACATTTAAATCACCTGGG + Intronic
999445421 5:151634901-151634923 ACTGTACTTTAAAAAGAACTAGG - Intergenic
999545853 5:152627668-152627690 AATGCACATAAAAATCAACTTGG - Intergenic
999604437 5:153298691-153298713 AGTGTGCATAAGAATCATCTAGG - Intergenic
999656562 5:153816307-153816329 CTTGCACATTAGAATAAACTAGG + Intergenic
999830038 5:155309952-155309974 AGTGAACATTAAAATCACCTGGG - Intergenic
1000140205 5:158396050-158396072 ACTGCACATTTGAATCACCTAGG - Intergenic
1000165717 5:158646697-158646719 GCTGTACTTTAGAATCAATGAGG + Intergenic
1000371623 5:160542047-160542069 AGTGTATGTTAGAATCACCTTGG - Intergenic
1000465315 5:161568670-161568692 ACTGTACAGCAGAATCACCTAGG - Intronic
1000665153 5:163985699-163985721 ACTGTCCATTATAAAAAACTTGG - Intergenic
1000998969 5:167987294-167987316 AATGTACACTAGAATCAGCTAGG + Intronic
1001055580 5:168447051-168447073 GCTGCACATTAGAATCACCCAGG - Intronic
1001066259 5:168537220-168537242 GCTGTACCTTAGAATCACGTGGG - Intergenic
1001089073 5:168723748-168723770 GCTGCACATTAGAATCACCTGGG + Intronic
1001161676 5:169322647-169322669 ACTATACACTAGAATCACTTAGG + Intergenic
1001165575 5:169362560-169362582 GCTGCACATTGGAATCACCTGGG + Intergenic
1001327248 5:170738044-170738066 GCTGCACATCAGAATCACCTGGG + Intergenic
1001421922 5:171594027-171594049 GCTGTGCATCAGAATCACCTGGG - Intergenic
1001740378 5:174048239-174048261 ACTGCATATTAGAATCACCTGGG + Intronic
1002965425 6:1961355-1961377 TCTGTACATAAAAATCAACTGGG - Intronic
1002995084 6:2275263-2275285 ACTGCACATTAGAATCACCTTGG + Intergenic
1002995257 6:2277069-2277091 ACTATGCATTAGAATCACCTGGG - Intergenic
1003044415 6:2720050-2720072 TCTGTGTATTAGAATCACCTGGG - Intronic
1003046068 6:2733900-2733922 ACTGTAGATAAGAATCACCTGGG - Intronic
1003211863 6:4075956-4075978 TCTCTACATGAGAATCACCTGGG + Intronic
1003238044 6:4316333-4316355 GCTGCACATCAGAATCACCTGGG + Intergenic
1003295774 6:4826095-4826117 TCTGTAAAATAGAATCGACTAGG + Intronic
1003316323 6:5015455-5015477 GCTGCACATTAAAATCACCTGGG + Intergenic
1003422192 6:5968594-5968616 ATTGCACATTAGAATCACCTGGG + Intergenic
1003818378 6:9867086-9867108 ACAGAACATTAGAATTACCTGGG - Intronic
1004478869 6:16000014-16000036 GCTGCACATTAGAATCACCTGGG + Intergenic
1004569853 6:16834651-16834673 GCTGTACCTTAGAATCACCTGGG - Intergenic
1004602902 6:17167634-17167656 ATTGCATATTAGAATCATCTGGG + Intergenic
1004705968 6:18124035-18124057 GCTGTACATTATAATCACCTGGG - Intergenic
1004850479 6:19693511-19693533 ATTGTACATTAGAATCACCTGGG - Intergenic
1004861595 6:19808785-19808807 ACTGCCCATTATAATCACCTAGG - Intergenic
1004896717 6:20155293-20155315 AGTGTGCATCAAAATCAACTGGG - Intronic
1004990015 6:21126334-21126356 ATGGCACATTAGAATCAGCTGGG + Intronic
1005014149 6:21361466-21361488 GCTGTACATTAGAATCACCTGGG - Intergenic
1005149670 6:22734372-22734394 TCTGCACATTAGAATCCTCTGGG + Intergenic
1005337074 6:24807982-24808004 ACTTTATATTAGAATCACCTGGG + Intronic
1005357341 6:24997213-24997235 ACTGTATATTAGAATCACCTGGG - Intronic
1005487657 6:26316565-26316587 ACTGTACATTCTTCTCAACTAGG + Intergenic
1005581513 6:27239572-27239594 TATGTACATTACAATCAATTTGG + Intergenic
1005911726 6:30316137-30316159 GCTGCACATTAGAATTAGCTGGG - Intergenic
1006367895 6:33626314-33626336 GCTGTACCTGAGAATCACCTGGG + Intronic
1006893353 6:37448831-37448853 CCTGCACAGTAGAATCATCTGGG + Intronic
1006972578 6:38062019-38062041 TCTGCACATTAGAATCCACTGGG + Intronic
1007102170 6:39256728-39256750 TCAGCACATTAGAATCCACTGGG + Intergenic
1007144589 6:39615603-39615625 GCTGCACACTAGAATCACCTGGG - Intronic
1007687946 6:43678343-43678365 GCTGCACATTAGAATCACCTGGG - Intronic
1007713160 6:43837636-43837658 GCTGCCCATTAGAATCACCTGGG - Intergenic
1007715508 6:43853391-43853413 AGTGCACAGAAGAATCAACTGGG + Intergenic
1007832768 6:44651449-44651471 GCTGCACAGTAGAATCACCTGGG + Intergenic
1007926697 6:45655471-45655493 ACTGCACATTAAAATCACCTGGG - Intronic
1008000922 6:46358768-46358790 GCTGTACTTTAGAATCACCTGGG + Intronic
1008128202 6:47691807-47691829 AATGTACATTAGAATCACCCGGG - Intronic
1008174477 6:48250550-48250572 ACTACACATTAGAATCACCTGGG + Intergenic
1008179251 6:48307840-48307862 ACTTTATATTAGAATCACTTGGG - Intergenic
1008335571 6:50300685-50300707 ACTGTACATTAGAATTGCCTGGG + Intergenic
1008371032 6:50730808-50730830 ACTATACATCAGAATCACCTGGG - Intronic
1008853399 6:56052081-56052103 GCTGTACATTAGAAGCACCTAGG - Intergenic
1008872136 6:56284965-56284987 GCTGCACATTTGAATCACCTGGG - Intronic
1008872718 6:56290909-56290931 GCTGCACATTTGAATCACCTGGG - Intronic
1008877706 6:56347487-56347509 GCTGCACATTAGAATCACCTAGG + Intronic
1008980113 6:57473517-57473539 ACTGCATATTAGATTCAACAAGG - Intronic
1009168217 6:60366456-60366478 ACTGCATATTAGATTCAACAAGG - Intergenic
1009796119 6:68470356-68470378 CCTGTACATTAGAATATAGTGGG + Intergenic
1010258508 6:73788804-73788826 AATGTGCATAAGAATCACCTGGG + Intronic
1010309010 6:74360553-74360575 ACTGATAATCAGAATCAACTGGG - Intergenic
1010480804 6:76351224-76351246 TCTTTACATTAAAATCCACTTGG + Intergenic
1010720917 6:79282507-79282529 AGGGTACATTAGAATCATCTGGG + Intergenic
1010871781 6:81051367-81051389 ACTGCACATTTGAATCACCTGGG - Intergenic
1010903777 6:81460251-81460273 GCTGATCATTAGAATCACCTGGG + Intergenic
1011013308 6:82726435-82726457 TCTGTATATTAGAATCACCTGGG - Intergenic
1011163470 6:84419199-84419221 ACTGTACATTAGGATCACCTGGG + Intergenic
1011163484 6:84419322-84419344 ACTGTGCATTGGAATCACCTGGG - Intergenic
1011229068 6:85139513-85139535 ACTGTGCATAAAAATCATCTGGG - Intergenic
1011329630 6:86189158-86189180 GCTATGCATTAGAATCACCTGGG - Intergenic
1011347436 6:86387423-86387445 ACAGCACATTTGAATCACCTGGG + Intergenic
1011401343 6:86965537-86965559 ACTGCACATTAGAACCACCTGGG - Intronic
1011510208 6:88092509-88092531 ACTGTAATTTAGAGTCATCTAGG - Intergenic
1011663110 6:89610994-89611016 GGTGCACATTAGAATCACCTGGG - Intronic
1011695812 6:89911647-89911669 GCTGCAAATTAGAATCACCTGGG - Intergenic
1011959038 6:93063614-93063636 ACTGTAAATCATAATCGACTAGG - Intergenic
1012324199 6:97894421-97894443 AGTGTACATTAGTCTTAACTTGG + Intergenic
1012397361 6:98814151-98814173 GCTGCACATTAGAATAACCTTGG + Intergenic
1012506763 6:99955670-99955692 GCTGCATATTAGAATCATCTGGG - Intronic
1012662568 6:101920917-101920939 ATTCCACATTAAAATCAACTGGG + Intronic
1012784672 6:103608391-103608413 ACTGCACATTAGAATCATCTGGG - Intergenic
1013024448 6:106256449-106256471 GCTATATATTAGAATCATCTGGG - Intronic
1013097771 6:106961466-106961488 GCTGCACTTTAGAATCATCTAGG + Intergenic
1013165263 6:107584275-107584297 GCTGCATATTAGAATCATCTGGG - Intronic
1013282889 6:108655506-108655528 ATTGCACATTAGAATAATCTGGG + Intronic
1013461351 6:110378009-110378031 ACTGTGCATTAGAATCACCTGGG - Intergenic
1013760960 6:113516985-113517007 ACTGTACATTAGAATCACCTAGG + Intergenic
1013783011 6:113749276-113749298 ACTATACATGAGAATCACCTGGG - Intergenic
1013970267 6:116009394-116009416 AATGTACATTAGATTCAGCTGGG - Intronic
1014000623 6:116362172-116362194 ACTGTATATTGGAATCACTTAGG - Intronic
1014559657 6:122874663-122874685 ACTGTACCTTAGAATCACCTTGG - Intergenic
1014610510 6:123539048-123539070 TCTGTACATGAGAATTATCTGGG + Intronic
1014695864 6:124621042-124621064 GCTGCACATTGGAATCACCTGGG + Intronic
1014777754 6:125529928-125529950 ACAGTACATTAGAATCATCTTGG - Intergenic
1014868106 6:126556782-126556804 GCTGCACATTGGAATCACCTGGG - Intergenic
1014973828 6:127853452-127853474 GCTGCACATTAGAATCACTTAGG - Intronic
1015033571 6:128625744-128625766 ACAGTGCATTGGAATCACCTGGG + Intergenic
1015118804 6:129678610-129678632 CCTGCACATTAGAATCACCTGGG + Intronic
1015143921 6:129964678-129964700 ACTGTACATATGAATCATCTGGG - Intergenic
1015164456 6:130187884-130187906 GGTGCACAGTAGAATCAACTAGG + Intronic
1015173332 6:130278987-130279009 AATGAACCTTAGAATCAAGTTGG + Intronic
1015630661 6:135228920-135228942 ACTGCACTTCAGAATCACCTGGG - Intergenic
1015859357 6:137659356-137659378 GCTGCAAATTAGAATCACCTGGG + Intergenic
1015955551 6:138594526-138594548 GCTGTACATCAGAATCACCTAGG + Intronic
1016035975 6:139383606-139383628 TTTGTACATAAAAATCAACTGGG - Intergenic
1016066935 6:139693308-139693330 TCTGTTCATGAGAATCACCTGGG - Intergenic
1016193227 6:141296936-141296958 AATAAACATTAGAATCCACTTGG + Intergenic
1016462574 6:144292523-144292545 GCTGTACAGATGAATCAACTGGG + Intronic
1016582847 6:145648709-145648731 AATGTACATTAGAATCATTTGGG - Intronic
1016608405 6:145961227-145961249 ACTGCACATTAGAATCACCAGGG + Intronic
1016696531 6:147002719-147002741 GCTGCACATTAGAATCATCTGGG + Intergenic
1016873281 6:148839755-148839777 ACTGTACCATAGCATCATCTGGG - Intronic
1016927739 6:149369250-149369272 ACCACACATTAGAATCACCTTGG + Intronic
1017191678 6:151660988-151661010 ACTTCACATTAGAATCAGCTGGG - Intronic
1017275997 6:152569200-152569222 ATTGTGCATAAGAATCACCTGGG - Intronic
1017401249 6:154066117-154066139 ATTATACATTATAATCAACTGGG - Intronic
1017477772 6:154815364-154815386 GTTGCACATTAGAATCACCTAGG + Intronic
1017487148 6:154913912-154913934 TCTGCATATTAGAATCACCTGGG + Intronic
1017648838 6:156562935-156562957 ACTGTGCATCTGAATCCACTGGG - Intergenic
1017878967 6:158546632-158546654 ACTGTACACTAGAATCCCTTAGG + Intronic
1018293603 6:162319204-162319226 GCTGTACATTAGAATTGTCTAGG + Intronic
1020812184 7:12861991-12862013 TCTGCACAGTAGAATCACCTAGG + Intergenic
1020823115 7:12995078-12995100 ACTGTATATTAGAGTCACTTTGG - Intergenic
1020957143 7:14754231-14754253 AGTGTACCTCAGAATCAACCGGG - Intronic
1020971871 7:14953823-14953845 GCTGTGCAGTAGAGTCAACTGGG - Intronic
1020998241 7:15292329-15292351 GCTGCACATTAGAATCACCAAGG - Intronic
1021067921 7:16199181-16199203 GTTGTACATTACAATCACCTGGG + Intronic
1021077668 7:16324636-16324658 ATTGTACATTACCATCAACAAGG + Intronic
1021162766 7:17297510-17297532 TATGTACATTTGAATCACCTGGG + Intergenic
1021256447 7:18398064-18398086 AATTTACTTTAGAATAAACTTGG - Intronic
1021362764 7:19736567-19736589 ACTGTACACTAGAATCACCTGGG - Intronic
1021408348 7:20300129-20300151 GCTGCATATTAGAATCAGCTGGG + Intergenic
1021521781 7:21545891-21545913 GCTGAACATTAGGATCACCTGGG + Intronic
1021521797 7:21546006-21546028 ACTGTACATTAGAATCACCTGGG - Intronic
1021563160 7:21988891-21988913 GCTGAACATTAGAATCACCTGGG + Intergenic
1021614189 7:22486156-22486178 ACTGTACAATGAAATCACCTGGG - Intronic
1021619281 7:22535552-22535574 AGTGTGTATTAGAATCACCTGGG + Intronic
1021628257 7:22616129-22616151 ACTGCACATTGGAATCTCCTGGG - Intronic
1021631469 7:22651701-22651723 GTTGCACATTAGAATCACCTGGG + Intergenic
1021767683 7:23965987-23966009 GCTGCACATGAGAATCACCTGGG - Intergenic
1021799313 7:24287938-24287960 GCTGCACATTAGAATCACCTGGG - Intronic
1021808641 7:24381194-24381216 ACTGCACGTTGGAATCACCTGGG + Intergenic
1021816363 7:24451205-24451227 GCTGTACATTAGACCCACCTGGG + Intergenic
1021857375 7:24870595-24870617 ACTGTACATGAGAAACACTTTGG + Intronic
1021886909 7:25148207-25148229 GCTGCACATTAGAATCACCAGGG - Intronic
1021900731 7:25282603-25282625 GCTGCACGTTAGAATCACCTGGG + Intergenic
1021903383 7:25310015-25310037 ATTGCACATTGGAATCATCTGGG - Intergenic
1022061908 7:26805438-26805460 TCTGTCCTTTAGAATCAAATGGG - Intronic
1022115700 7:27258651-27258673 ACTGTACATCAGGATCACCTGGG - Intergenic
1022300800 7:29100403-29100425 CCTGCACATTAGAACCACCTGGG - Intronic
1022568461 7:31427454-31427476 GCTGCACATTAGAATCAACAAGG + Intergenic
1022616790 7:31940035-31940057 GCTGCACATTAGAATCACCGGGG + Intronic
1022759380 7:33331061-33331083 ACAGTACATTATGATCAAGTGGG + Intronic
1022873683 7:34506089-34506111 TTTGCACATTAGAATCATCTTGG + Intergenic
1022978693 7:35581855-35581877 GCTGAACATTACAATCACCTGGG - Intergenic
1023131619 7:37008979-37009001 GCTGTACGTCAGAATCACCTGGG - Intronic
1023596435 7:41834009-41834031 TCTGAACATCAGAATCACCTTGG - Intergenic
1023954687 7:44874906-44874928 ACTGTAGGCTAGAATCACCTTGG + Intergenic
1024868718 7:53935786-53935808 GCTGTACATTGGAATCATGTGGG - Intergenic
1024894829 7:54245890-54245912 GCTGCACATTGGAATCATCTGGG - Intergenic
1024920456 7:54548523-54548545 AGTGTACATTAGAATCACCTGGG - Intronic
1024938774 7:54740537-54740559 TCTGCACATTAGAATCACCTGGG + Intergenic
1025031704 7:55562106-55562128 GCTGTACATTAGAATGAGGTAGG - Intronic
1025103859 7:56155022-56155044 GCTGGACATTAGAATCATCTTGG + Intergenic
1026068542 7:67097232-67097254 TCTGCACATTGGAATCACCTTGG - Intronic
1026173501 7:67975067-67975089 ATTGCATATTAGAATCATCTGGG - Intergenic
1026316896 7:69234947-69234969 GCTGGACATTAGAATCATCTTGG - Intergenic
1026504045 7:70967278-70967300 ACTGTGCATCAGAATCACCTAGG + Intergenic
1026504167 7:70968130-70968152 TCTGTGCATCAGAATCACCTGGG - Intergenic
1026598532 7:71754146-71754168 GCTGCACATTTGAATCATCTGGG - Intergenic
1026606385 7:71819502-71819524 ACTGTACACTTGAATAAAATAGG - Intronic
1026708370 7:72715080-72715102 TCTGCACATTGGAATCACCTTGG + Intronic
1027124044 7:75543310-75543332 ACTTTACATGAGAATCAGTTGGG + Intronic
1027361024 7:77410037-77410059 GCTGTACATTAGAATCACCCAGG - Intronic
1027586010 7:80059430-80059452 GCTATACATTAGAATTACCTTGG + Intergenic
1027680106 7:81209462-81209484 GCTGTACATTGGAATCACCTAGG - Intergenic
1027880496 7:83829316-83829338 GCTGTACATTGGAATCACCCAGG + Intergenic
1028229979 7:88295504-88295526 GCTGTACATTTGAATCACCTGGG - Intronic
1028347490 7:89800091-89800113 GCTGCACATTGGAATCACCTGGG - Intergenic
1028371980 7:90102038-90102060 AGTGTGTATTAGAATCACCTGGG - Intergenic
1028576135 7:92353216-92353238 ACTGTTCATTAGCATCTCCTGGG - Intronic
1028718505 7:94002580-94002602 ACTGTACATTAGAATCCCTTGGG - Intronic
1029069105 7:97880797-97880819 GCTGCACATCAGAATCACCTGGG + Intergenic
1029255970 7:99269838-99269860 GCTATACATTAGACTCATCTGGG + Intergenic
1029315346 7:99707382-99707404 GCTGTACATTGGAATCACCAGGG - Intronic
1029321066 7:99760389-99760411 GCTGTACATTGGAATCACCAGGG - Intronic
1029860810 7:103569813-103569835 ACTGTACATCTGAATGAACCAGG + Intronic
1029949518 7:104568244-104568266 ATTGCACATCAGAATCACCTTGG - Intronic
1029982784 7:104894940-104894962 AGTGTACATGAGAATCACCTGGG + Intronic
1030097645 7:105915045-105915067 ACAGTAAAGTAGAGTCAACTAGG - Intronic
1030110111 7:106019787-106019809 GCTGCATATTAGAATCAGCTAGG + Intronic
1030317103 7:108127153-108127175 ACTGCACATTAAAATCACCAGGG + Intronic
1030318742 7:108142802-108142824 GCTGCATATTAGAATCATCTGGG + Intergenic
1030332193 7:108282979-108283001 GCTGCATATTAGAATCATCTAGG - Intronic
1030356740 7:108551838-108551860 ACTGTGCATTAAAATCACGTGGG - Intronic
1030363771 7:108623697-108623719 ACTGTACATTAGAAATACCTGGG - Intergenic
1030396850 7:108996525-108996547 GCTGCACATTAGAATCACTTGGG + Intergenic
1030638749 7:111979994-111980016 ATTGCCCATTAGAATCACCTGGG - Intronic
1030690155 7:112524134-112524156 GCTGTACAACAGAATCACCTGGG + Intergenic
1030861636 7:114638770-114638792 TCTGCATATTAGAATCACCTGGG - Intronic
1030895709 7:115057488-115057510 AGGGCACATTAGAATCATCTGGG - Intergenic
1030900679 7:115119558-115119580 ATTTTTCATTAGAATCACCTGGG + Intergenic
1030980213 7:116177394-116177416 ACAGTACTTTAGAATCCTCTGGG - Intergenic
1031149345 7:118035199-118035221 GCTGTTCATTGGAATCACCTGGG + Intergenic
1031427427 7:121622828-121622850 ACTATACTTAAGAATCATCTGGG - Intergenic
1031531358 7:122880599-122880621 ACTGTACACTGAAATCAATTGGG + Intronic
1031563036 7:123261085-123261107 GCTGCACATTAGAATCACCTAGG - Intergenic
1031793123 7:126135346-126135368 CCTGTACATTAGAATCACCTGGG - Intergenic
1031903678 7:127438045-127438067 GCTGCACATGAGAATCATCTGGG + Intergenic
1032073457 7:128824290-128824312 ACCGTGCATACGAATCAACTGGG - Intergenic
1032128230 7:129210067-129210089 GGTGCTCATTAGAATCAACTGGG - Intronic
1032215525 7:129954097-129954119 ACTGTGCATAAGAATCACCTGGG - Intergenic
1032545837 7:132741655-132741677 GCTGTACATTAGAATCACTAGGG + Intergenic
1032797989 7:135292868-135292890 AATGTGCATAAGAATCATCTGGG + Intergenic
1033360621 7:140636591-140636613 GCTGTACCTTAAAATCATCTGGG + Intronic
1033407325 7:141082772-141082794 ACTGCACATGACAATGAACTTGG - Intronic
1033467291 7:141606123-141606145 ACTACACATTATAATCACCTGGG - Intronic
1033861527 7:145633952-145633974 TCTACACATTAGAATCAACTAGG - Intergenic
1034486340 7:151366417-151366439 GCTGTACACTAGAATCAGCTGGG + Intronic
1035126407 7:156611072-156611094 GCTGTACATTGGAATCACCTGGG - Intergenic
1036884812 8:12544195-12544217 GCTGCACATCAGAATCACCTGGG + Intergenic
1037340394 8:17838698-17838720 AGTGTGCATCAGAATCACCTGGG + Intergenic
1038077443 8:24092017-24092039 ACTGCACATTAGAATCACCAGGG - Intergenic
1038329040 8:26593252-26593274 ACTGCACATTAGAATCCCCTGGG + Intronic
1038635956 8:29287303-29287325 GCTGCACATTAAAATCACCTCGG - Intergenic
1039019724 8:33191583-33191605 GCTTCACATTAGAATCACCTGGG + Intergenic
1039039984 8:33398267-33398289 ACTGTACAGTACAATTAACATGG + Intronic
1039227582 8:35404890-35404912 AATGTACATAAGAATCACATGGG - Intronic
1039254319 8:35702421-35702443 GCTGCATATTAGAATCACCTGGG - Intronic
1039569874 8:38578224-38578246 GCTGCACATTGGAATCACCTGGG - Intergenic
1040618769 8:49065868-49065890 TCTGACCATTAAAATCAACTCGG - Intronic
1040979696 8:53233844-53233866 GCTGCACATTGGAATCACCTGGG - Intronic
1041081609 8:54219864-54219886 GCTGCCCATTAGAATCACCTAGG - Intergenic
1041395268 8:57383867-57383889 GCAGTACATTAGAGTCTACTAGG - Intergenic
1041406838 8:57508951-57508973 GCTTCACTTTAGAATCAACTAGG - Intergenic
1041593959 8:59624260-59624282 ACTGCACGTTACAATCACCTGGG - Intergenic
1042042680 8:64609897-64609919 GCTGCACATTAGAATCACCTAGG + Intronic
1042510895 8:69609750-69609772 ACTGCACGTTAGAATCATATGGG + Intronic
1042511604 8:69618062-69618084 ACTGCACATTAGAATCATCTGGG + Intronic
1042536875 8:69867966-69867988 GATGTACAATAGAGTCAACTGGG - Intergenic
1042691481 8:71504628-71504650 AGCGTACATCAGAATCACCTGGG + Intronic
1042714983 8:71762775-71762797 ACTATACATTAAAATCACCTGGG - Intergenic
1042715005 8:71762960-71762982 GCTGAACGTTAGAATCACCTGGG - Intergenic
1042860682 8:73310100-73310122 TTGGTACATTAGAATCACCTGGG - Intronic
1043079218 8:75744604-75744626 ACTCTTCATGAGAATCAGCTGGG + Intergenic
1043247139 8:78018585-78018607 GCTGTACATTAGAATCACCTAGG + Intergenic
1043329852 8:79102106-79102128 CCTGTCCATCACAATCAACTAGG - Intergenic
1043351432 8:79365617-79365639 GCTACCCATTAGAATCAACTAGG + Intergenic
1043389795 8:79781440-79781462 GCTGCATATTAGAATCACCTGGG - Intergenic
1043423546 8:80125034-80125056 CTTGTACATTAGAATCATCAGGG - Intronic
1043571052 8:81602670-81602692 GCTGTACGTTAGAACCACCTGGG - Intergenic
1043590380 8:81825387-81825409 GCTGCACATTAGAATCACCCAGG + Intronic
1043749538 8:83918204-83918226 TCTGTACATTAGAATCAGCCGGG - Intergenic
1043915024 8:85912383-85912405 CCTGTATATTTGAATCATCTGGG - Intergenic
1043991842 8:86765114-86765136 ACTGCACATTGGAATCACCTAGG - Intergenic
1044065642 8:87696610-87696632 ACAATGCATTAGAATCAACTGGG + Intergenic
1044076642 8:87830727-87830749 ACTGCACATCAGAATCAGCTGGG + Intergenic
1044165816 8:88982550-88982572 ACTGCAGACTAGAATCATCTGGG - Intergenic
1044319825 8:90790086-90790108 CCTGTACATTGGAATCACCTGGG - Intronic
1044683485 8:94805002-94805024 AATGCACATTACAATCACCTGGG - Intergenic
1044912963 8:97081452-97081474 ACTGTACTTTAAAATCACCTGGG + Intronic
1045261191 8:100575887-100575909 GCTGCACATTGGAATCACCTGGG - Intronic
1045354587 8:101374382-101374404 ACTGCATATTAGAATCATCCTGG + Intergenic
1045559491 8:103247279-103247301 GCTGCACATTAGAATAATCTGGG + Intergenic
1045825942 8:106398262-106398284 GCTGTACATCAGAGTCACCTGGG + Intronic
1045895769 8:107214764-107214786 CATGCACATTAGAATCACCTTGG + Intergenic
1045982695 8:108210198-108210220 ACAACACATTAGAATCAAATGGG - Intronic
1046334549 8:112767926-112767948 GCTGTACATTAGAATACCCTAGG + Intronic
1046487412 8:114904975-114904997 ACTGTAATTTAGAATATACTTGG + Intergenic
1046598945 8:116295598-116295620 GCTGCGCATTAGAATCATCTAGG + Intergenic
1046719303 8:117600945-117600967 ACAGTCCTTTGGAATCAACTTGG - Intergenic
1046768678 8:118097538-118097560 ACTGTACAGTAGACTCTCCTGGG - Intronic
1046820050 8:118624082-118624104 GCTGAACATTAGAATCACCTGGG + Intergenic
1047023137 8:120798175-120798197 ATTGTAGATTAGAACCACCTGGG + Intronic
1047072616 8:121363106-121363128 ACAGTACTTAAGAATCAAGTTGG + Intergenic
1047159715 8:122364332-122364354 ACTGTGCATTAAAATCACTTGGG + Intergenic
1047193914 8:122704265-122704287 AATGTGCATTTGAATCACCTAGG - Intergenic
1047229099 8:122980790-122980812 ACTGAACATACGAATCATCTGGG - Intergenic
1047245697 8:123142130-123142152 GCTGCATATTAGAATCACCTGGG - Intronic
1047326310 8:123839586-123839608 GCTGTTCATTAGAATCACCTGGG - Intergenic
1047338804 8:123960329-123960351 GCTGTACACTAGGATCATCTGGG + Intronic
1047424548 8:124733506-124733528 GCTGTACATTGGAATCCCCTTGG - Intergenic
1047506078 8:125481596-125481618 ACTGCACATTTGAATCACCTGGG - Intergenic
1047507272 8:125489689-125489711 TTTGCACATTAGAATCACCTGGG - Intergenic
1047662295 8:127050545-127050567 ACTGTACATGAGAAAGAGCTGGG + Intergenic
1047696586 8:127409453-127409475 GCTTCACATTAGAATCACCTGGG + Intergenic
1047723041 8:127659897-127659919 GCTGCACATGAGAATCATCTGGG + Intergenic
1047773047 8:128045966-128045988 ACTGCATAATAGAATCACCTGGG - Intergenic
1048285496 8:133138062-133138084 ACCGTTCATTGGAATCACCTGGG + Intergenic
1048753005 8:137700602-137700624 GCTGTTCATTAGGATCACCTGGG - Intergenic
1049911715 9:275443-275465 ACTGGACATTAAAATTATCTAGG + Intronic
1049927551 9:424225-424247 GCTGCACATTAGAATCACCTGGG + Intronic
1050071487 9:1819339-1819361 CCTGTGCATCAGAATCACCTGGG + Intergenic
1050072030 9:1825237-1825259 GTTGCACATTAGAATCACCTGGG + Intergenic
1050072048 9:1825351-1825373 GCTGCATATTAGAATCACCTGGG - Intergenic
1050286868 9:4112492-4112514 ACTGCTCATTAGAATCACCTTGG + Intronic
1050375422 9:4967596-4967618 TCTGCACACTGGAATCAACTCGG + Intergenic
1050571724 9:6947733-6947755 GCTGTGCTTTAGAATCATCTAGG + Intronic
1050585705 9:7109324-7109346 ACAGTACTATATAATCAACTAGG + Intergenic
1050614006 9:7382772-7382794 GCTGTACATTGGAATCACCTGGG + Intergenic
1050648036 9:7743261-7743283 ACTGTGCCTTAGAATCAGCTGGG + Intergenic
1050682083 9:8123518-8123540 ATTGCACATTAGAATTACCTGGG + Intergenic
1050725739 9:8646028-8646050 ACTGGACATTAGAATCACCTGGG + Intronic
1050766961 9:9146458-9146480 AGTGTACATAAGAATAACCTGGG - Intronic
1051157358 9:14164892-14164914 GCTGTACATTTGAATCACTTGGG - Intronic
1051173214 9:14340491-14340513 ACTGCACATTAGAATCATCTGGG - Intronic
1051244962 9:15100825-15100847 ACTGTGCCTCAGAATCAGCTGGG + Intergenic
1051556048 9:18383873-18383895 ACTGTACATATGAATCACCTGGG + Intergenic
1051600048 9:18863480-18863502 AATGTACATGGGAATCATCTTGG + Intronic
1051655318 9:19375526-19375548 AATGTACATGTGAATCACCTAGG - Intergenic
1051750257 9:20334101-20334123 ACTGCATATTAGAATAATCTGGG + Intergenic
1051766400 9:20529075-20529097 ACTGAACATTAAAATCATCTTGG + Intronic
1052297355 9:26911779-26911801 ACTGTACATTTGAACAAAATAGG - Intronic
1053257806 9:36633445-36633467 ACTGCACATGAGAAACACCTGGG - Intronic
1053540605 9:38969983-38970005 GCTGCACATTAGAATGAAGTGGG - Intergenic
1053674580 9:40411329-40411351 GCTGCACATTAGAGTCACCTTGG + Intergenic
1053804948 9:41792139-41792161 GCTGCACATTAGAATGAAGTGGG - Intergenic
1053924372 9:43037693-43037715 GCTGCACATTAGAGTCACCTTGG + Intergenic
1054140337 9:61523319-61523341 GCTGCACATTAGAATGAAGTGGG + Intergenic
1054385686 9:64551393-64551415 GCTGCACATTAGAGTCACCTTGG + Intergenic
1054625538 9:67393940-67393962 GCTGCACATTAGAATGAAGTGGG + Intergenic
1054721382 9:68607442-68607464 GAGGTACATTAGAATCACCTGGG + Intergenic
1054762959 9:69019720-69019742 GCTGTGCATTAGAATCACCTGGG - Intergenic
1054866435 9:70007012-70007034 ACTGCACTTTACAATCACCTGGG - Intergenic
1054907918 9:70426851-70426873 ACTGTGCATAAGAATCACCTGGG + Intergenic
1054931766 9:70642515-70642537 GCTGCACATTAGAATCACCTGGG + Intronic
1055051470 9:71985600-71985622 GCTGCACATTAAAATCATCTGGG + Intronic
1055143783 9:72908075-72908097 GCTGTTCATTAGAATCATCTCGG - Intronic
1055222879 9:73959228-73959250 GATGCACATTAGAATCACCTGGG - Intergenic
1055501651 9:76907375-76907397 ACTGCACATTAGAATCACTTGGG - Intergenic
1055612628 9:78038620-78038642 GCTGCACATTAGCATCACCTGGG + Intergenic
1055760249 9:79599336-79599358 CCTGCACATTAGATTCACCTGGG + Intronic
1055816953 9:80218065-80218087 GCTGGACATTGGAATCATCTGGG + Intergenic
1055938347 9:81624275-81624297 ACTCTACTTTAAAATGAACTAGG + Intronic
1056028060 9:82521501-82521523 ACATCACATTAGAATCACCTAGG + Intergenic
1056202446 9:84289592-84289614 TCTGCACGTTAGAATCACCTGGG - Intronic
1056225502 9:84491057-84491079 ACTGTACTTTAGAATCACCTGGG - Intergenic
1056905558 9:90644684-90644706 CCTGCACATTAGAATCAGCAGGG + Intergenic
1056987611 9:91377997-91378019 GCTGTACATTGGAATCATCTGGG - Intergenic
1057491482 9:95523280-95523302 GCTGTTCATCAGAATCACCTGGG + Intergenic
1057903950 9:98970067-98970089 GCTGCACAGTAGAATCACCTGGG - Intronic
1058018587 9:100066089-100066111 AGTGTGCATAGGAATCAACTGGG - Intronic
1058179935 9:101785020-101785042 ACCGTACATTAGCATTACCTGGG + Intergenic
1058389081 9:104473746-104473768 AGTGTACATAAGAATCACCTGGG - Intergenic
1058389096 9:104473931-104473953 ACTGCACATTAGAATCACCTGGG - Intergenic
1058473165 9:105302318-105302340 GCTGTACATTGGAATTAGCTGGG + Intronic
1058883610 9:109306289-109306311 ACTGCACCTCAGAATCACCTGGG + Intronic
1059079278 9:111231475-111231497 ACTGTACTTTGTAATCACCTGGG + Intergenic
1059082181 9:111261772-111261794 CCTGGCCATTAGAATCACCTGGG - Intergenic
1059154032 9:111974205-111974227 ACTGCACATTAGAATTATCTAGG - Intergenic
1059159401 9:112019765-112019787 AGTGCACATTATAATCACCTGGG - Intergenic
1059609925 9:115881660-115881682 GCTGCACATTAGAATCTCCTGGG + Intergenic
1059785136 9:117573903-117573925 ACTGAACATTGGAATCACATGGG + Intergenic
1059793725 9:117668139-117668161 ACTACATATTAGAATCACCTGGG + Intergenic
1059864876 9:118503346-118503368 ACTGTGTATTAGAATCACCTGGG - Intergenic
1059948223 9:119434952-119434974 GCTGTCCATTAGAATCACCTGGG - Intergenic
1059967708 9:119632159-119632181 ACTGTGCATTAGAATTACCTGGG + Intergenic
1059967841 9:119633430-119633452 GTTGCACATTAGAATCACCTGGG - Intergenic
1060326865 9:122625241-122625263 ACTGTGCGTTAGAATCACCTGGG - Intergenic
1062078534 9:134605805-134605827 ACTCTAGCTTAGAATCCACTGGG - Intergenic
1186263077 X:7801894-7801916 GCTGCACATTAGAATAACCTGGG - Intergenic
1186277075 X:7950859-7950881 ACTATACATTAGAATCATCTTGG - Intergenic
1186556002 X:10559460-10559482 ATTTTAGATTAAAATCAACTGGG + Intronic
1186634856 X:11391931-11391953 GCTGCACATTAGAATCAAACAGG - Intronic
1186739483 X:12502128-12502150 GCTGTTCATTAGAATTACCTGGG - Intronic
1186811868 X:13198248-13198270 CCTGTACATTACAATCGCCTGGG + Intergenic
1186859313 X:13655772-13655794 GCTGCACATTAGAATCCTCTGGG - Intronic
1186874163 X:13800753-13800775 ACTGTGCATTAGAATTGCCTGGG + Intronic
1186892037 X:13968459-13968481 ACTACACATTAGAATCCCCTGGG + Intergenic
1186956811 X:14691558-14691580 CCTGCACATTAGAATCGCCTGGG + Intronic
1186970182 X:14833640-14833662 GCTGTACATTAGAATCACCTGGG + Intergenic
1186990143 X:15058098-15058120 GCTGCACATTAGAATCCCCTGGG - Intergenic
1187205086 X:17174470-17174492 GCTGCACATTAGAATCACCTGGG - Intergenic
1187224634 X:17363514-17363536 GCTGTACATTAGAAACACCTGGG + Intergenic
1187254634 X:17630831-17630853 ACTGCACCTCAGAATCACCTGGG + Intronic
1187377692 X:18770977-18770999 ACTGCACATTAGAATCACCTGGG - Intronic
1187407415 X:19016315-19016337 ACTGTACATTAGAAATACCTGGG - Intronic
1187407770 X:19019395-19019417 GCTGCACATTAGAATCACCTGGG - Intronic
1187431481 X:19229100-19229122 GCTGCACATTAGAATCTCCTGGG - Intergenic
1187439076 X:19301434-19301456 GCTGAACATTAAAATCACCTGGG + Intergenic
1187441641 X:19326170-19326192 GCTTTACATTAGAATCACCTGGG - Intergenic
1187455244 X:19435848-19435870 GCTGCATATTAGAATCACCTGGG + Intronic
1187487167 X:19715565-19715587 GCTGCACATTAGAATCACATGGG - Intronic
1187718825 X:22130906-22130928 ACTGCACATTAGAATTACCTGGG + Intronic
1187720439 X:22145209-22145231 GCTGTACATTAGAATCACCTGGG + Intronic
1187753574 X:22495073-22495095 GCTGCATATTAGAATCACCTGGG + Intergenic
1187799976 X:23050768-23050790 GTTGCACATTAGAATCATCTGGG + Intergenic
1187809776 X:23162826-23162848 GATGGACATTAGAATCAACTGGG + Intergenic
1187935335 X:24330480-24330502 ACTGCACTTTGGAACCAACTGGG - Intergenic
1187985732 X:24808536-24808558 ACTGTACAGTGGAATCACCTGGG - Intronic
1187991158 X:24874634-24874656 GCTGCACATTAGAATCACTTGGG + Intronic
1188012910 X:25076342-25076364 GCTATACATTAGAATCACCTGGG + Intergenic
1188054027 X:25521178-25521200 GCTGCACATTAAAATCACCTGGG + Intergenic
1188160983 X:26802144-26802166 GCTGCACATTAGAATCACTTGGG - Intergenic
1188254442 X:27943142-27943164 AAAGTGCATTAGAATCACCTGGG - Intergenic
1188387393 X:29577916-29577938 GCTGTACATTAGAATCACCTGGG + Intronic
1188485438 X:30676518-30676540 GATGCACATTAGAATCACCTGGG + Intronic
1188620590 X:32218139-32218161 GTTGCACATAAGAATCAACTGGG + Intronic
1188656312 X:32701064-32701086 AATGTACATATGAATCACCTGGG + Intronic
1189128147 X:38469916-38469938 AATGTACATTAGAATCACCTGGG + Intronic
1189141376 X:38610487-38610509 ACTGCGCATTAGAATCACCTGGG + Intronic
1189149618 X:38691866-38691888 CCTGAACATTCTAATCAACTGGG - Intergenic
1189150262 X:38699472-38699494 GCTGTACTTTGGAATCACCTGGG + Intergenic
1189236905 X:39494312-39494334 CCTGCACATTGGAATCACCTGGG - Intergenic
1189841613 X:45084977-45084999 GCTGTATATTAGAATCCTCTGGG - Intronic
1190390957 X:49931116-49931138 TTTGCACATTAGAATCACCTGGG - Intronic
1190407430 X:50101772-50101794 GCTGTACATCAGAATCATCTGGG + Intergenic
1190484345 X:50910067-50910089 GCTGTAGATTGGAATCATCTGGG - Intergenic
1190845857 X:54189974-54189996 ACTGTATATTAGAATCACCTTGG - Intergenic
1191025815 X:55912025-55912047 ACTGCACATTAGAATTACCTAGG - Intergenic
1191675800 X:63791144-63791166 GTTGCACATTAGAATCATCTGGG - Intergenic
1191677779 X:63809781-63809803 GCTGTACATGAGAATCAGCTGGG + Intergenic
1191744106 X:64466898-64466920 AGTGTACATTGGAAACATCTGGG + Intergenic
1191755486 X:64587993-64588015 ACTGCACATTAGAATCACCTGGG + Intergenic
1191858071 X:65643633-65643655 GCTGCACATTAGAATCACTTGGG - Intronic
1192162168 X:68796617-68796639 ACTCCACATTGGAATCATCTGGG + Intergenic
1192182739 X:68926621-68926643 GCTTCACATTAGAATCACCTGGG - Intergenic
1192237768 X:69306694-69306716 GCTGCACACTAGAATCACCTGGG - Intergenic
1193124164 X:77853655-77853677 ACTGTACATTAGAAGAACCATGG - Intronic
1193148000 X:78097312-78097334 ATTGTGCATTAGATTCACCTGGG + Intronic
1194371651 X:93080602-93080624 GCTGCAGATTATAATCAACTGGG + Intergenic
1194548269 X:95265385-95265407 GCTGCACATTAAAATCATCTGGG - Intergenic
1194704986 X:97164266-97164288 ACTGTAGATCAGAGTCATCTGGG + Intronic
1194716179 X:97289533-97289555 AATACACATTAGAATCATCTGGG + Intronic
1194726334 X:97401721-97401743 AGTGTACATCAGAATCACCTAGG - Intronic
1194946542 X:100074921-100074943 ACTGCACATTAAAATCACCTAGG - Intergenic
1195039312 X:100999766-100999788 ACTGCAAATTAGAATCACCTTGG + Intergenic
1195308980 X:103611627-103611649 ACTGTACATCAGAATCACCTGGG - Intronic
1195537435 X:106024729-106024751 GCTGCACCTTAGAATCACCTAGG + Intergenic
1195659032 X:107360497-107360519 ACTGGACATCAGAATCACGTGGG - Intergenic
1195762631 X:108263347-108263369 ACTGTACATTGGTATCCCCTTGG - Intronic
1195770458 X:108345829-108345851 ACTGCACATTAGAATCACTTGGG + Intronic
1195835514 X:109110853-109110875 CTTGTATATTAGAATCATCTGGG - Intergenic
1195965624 X:110427651-110427673 ACTGTATATTAGAAGCACCTGGG - Intronic
1196041956 X:111214427-111214449 TCTGAACATTAGAATCACTTGGG - Intronic
1196062299 X:111423491-111423513 GCTGTACTTTAGAATCACCAGGG - Intergenic
1196129936 X:112144579-112144601 ACTGCACATTGGAATCACCTAGG + Intergenic
1196129948 X:112144698-112144720 AATTCACATTAGAATCACCTGGG - Intergenic
1196198976 X:112864117-112864139 ACTGCACATTAAAATCAACTGGG + Intergenic
1196420893 X:115520119-115520141 TGTGTACATCAGAATCACCTGGG - Intergenic
1196634217 X:117982256-117982278 ACTTTACAATAAAAACAACTGGG + Intronic
1196747250 X:119082105-119082127 GCTACACATTAGAATCACCTAGG + Intronic
1196787119 X:119430614-119430636 GCTGCACATCAGAATCAGCTGGG + Intronic
1196919095 X:120567460-120567482 ACTGTACAATAGAATGACCTAGG + Intronic
1196938552 X:120753263-120753285 CCAGTACATTAGAGTCACCTGGG - Intergenic
1196938680 X:120754374-120754396 ACTATACATTAGAATCATCTGGG - Intergenic
1197183006 X:123556721-123556743 GCTGTACATTGGAATTATCTGGG - Intergenic
1197257766 X:124282430-124282452 ACTGCACGTTAAAATCACCTGGG - Intronic
1197331365 X:125157057-125157079 GTTGCACATTAGAATCACCTGGG + Intergenic
1197379267 X:125719374-125719396 ACTGTCCAGTAAAATCAACTGGG - Intergenic
1197454946 X:126667566-126667588 ATTGTATATCAGAATCACCTGGG + Intergenic
1197676017 X:129331052-129331074 ACTGCACATTAGAATCAGCTGGG - Intergenic
1197712200 X:129679358-129679380 GCTGCACATTAAAATTAACTTGG + Intergenic
1197978063 X:132186387-132186409 GCTGCACATTAAAATCATCTGGG - Intergenic
1198110489 X:133498565-133498587 GCTGTATATTAGAATCACCTGGG + Intergenic
1198110512 X:133498685-133498707 ACTGCACATTAGAATCACCTGGG - Intergenic
1198208816 X:134496845-134496867 ATTGCACATCAGAATCACCTGGG - Intronic
1198552695 X:137761245-137761267 ACTGTGCATATGAATCACCTGGG + Intergenic
1198567514 X:137919753-137919775 CATGTACATTACAATCAAATGGG - Intergenic
1198651268 X:138866158-138866180 GCTGCACATCAGAATCACCTGGG + Intronic
1198786607 X:140295729-140295751 GCTGTAAATTGGGATCAACTGGG + Intergenic
1198847138 X:140924391-140924413 GCTGCACATTGGAATCACCTAGG - Intergenic
1198992090 X:142526385-142526407 ACAATACATTTGAATCACCTGGG + Intergenic
1199034866 X:143038083-143038105 ACTTCACATCAGAATCAACTGGG - Intergenic
1199047593 X:143194514-143194536 GCTGCACATTAGAATTATCTAGG - Intergenic
1199151801 X:144495957-144495979 GCTGTATATTAGAATCACCTGGG + Intergenic
1199161002 X:144611710-144611732 GCTGTACATTAGAAGCATGTGGG - Intergenic
1199429239 X:147740328-147740350 AATGCACATTAGAATCACCTGGG + Intergenic
1199458233 X:148053446-148053468 GCTGCACAACAGAATCAACTGGG + Intergenic
1199470727 X:148192632-148192654 GCTGCACATTAGAATCACCTGGG - Intergenic
1199472641 X:148211815-148211837 ACTGCACATTTGAAACACCTGGG + Intergenic
1199861592 X:151805651-151805673 GCTGTACATTAGAGTCATCAGGG + Intergenic
1199984385 X:152940121-152940143 GCTGTACTTGAGAATCACCTAGG + Intronic
1200679441 Y:6192493-6192515 GCTGCAGATTATAATCAACTGGG + Intergenic
1201485157 Y:14486254-14486276 TCTGTTCATTTGAATCAACCAGG + Intergenic
1202304646 Y:23455580-23455602 GCTGTACAGCAGAATCACCTGGG + Intergenic
1202566164 Y:26215011-26215033 GCTGTACAGCAGAATCACCTGGG - Intergenic