ID: 1158251992

View in Genome Browser
Species Human (GRCh38)
Location 18:55499545-55499567
Sequence CTGTACATTAGAATCAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2079
Summary {0: 2, 1: 24, 2: 156, 3: 539, 4: 1358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158251987_1158251992 21 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251992 18:55499545-55499567 CTGTACATTAGAATCAACTGGGG 0: 2
1: 24
2: 156
3: 539
4: 1358
1158251989_1158251992 14 Left 1158251989 18:55499508-55499530 CCATCTGTTTATGTAGGACAGAA 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1158251992 18:55499545-55499567 CTGTACATTAGAATCAACTGGGG 0: 2
1: 24
2: 156
3: 539
4: 1358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158251992 Original CRISPR CTGTACATTAGAATCAACTG GGG Intronic
Too many off-targets to display for this crispr