ID: 1158251992 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:55499545-55499567 |
| Sequence | CTGTACATTAGAATCAACTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2079 | |||
| Summary | {0: 2, 1: 24, 2: 156, 3: 539, 4: 1358} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1158251987_1158251992 | 21 | Left | 1158251987 | 18:55499501-55499523 | CCTAGCTCCATCTGTTTATGTAG | 0: 1 1: 0 2: 0 3: 9 4: 172 |
||
| Right | 1158251992 | 18:55499545-55499567 | CTGTACATTAGAATCAACTGGGG | 0: 2 1: 24 2: 156 3: 539 4: 1358 |
||||
| 1158251989_1158251992 | 14 | Left | 1158251989 | 18:55499508-55499530 | CCATCTGTTTATGTAGGACAGAA | 0: 1 1: 0 2: 1 3: 14 4: 191 |
||
| Right | 1158251992 | 18:55499545-55499567 | CTGTACATTAGAATCAACTGGGG | 0: 2 1: 24 2: 156 3: 539 4: 1358 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1158251992 | Original CRISPR | CTGTACATTAGAATCAACTG GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||