ID: 1158251993

View in Genome Browser
Species Human (GRCh38)
Location 18:55499548-55499570
Sequence TACATTAGAATCAACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 1, 2: 14, 3: 56, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158251989_1158251993 17 Left 1158251989 18:55499508-55499530 CCATCTGTTTATGTAGGACAGAA 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1158251993 18:55499548-55499570 TACATTAGAATCAACTGGGGAGG 0: 1
1: 1
2: 14
3: 56
4: 248
1158251987_1158251993 24 Left 1158251987 18:55499501-55499523 CCTAGCTCCATCTGTTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1158251993 18:55499548-55499570 TACATTAGAATCAACTGGGGAGG 0: 1
1: 1
2: 14
3: 56
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158251993 Original CRISPR TACATTAGAATCAACTGGGG AGG Intronic
900335003 1:2158321-2158343 TACCCCAGAAGCAACTGGGGAGG - Intronic
900850919 1:5142379-5142401 CACGTTAGAATCACCCGGGGTGG - Intergenic
901764516 1:11491280-11491302 TGTATCAGAATCACCTGGGGAGG + Intronic
902240437 1:15084734-15084756 TACATTAACTTCTACTGGGGTGG - Intronic
903343001 1:22666246-22666268 TGCATCAGAATCACCTGGGCAGG - Intergenic
903521624 1:23955083-23955105 GACATTGGAATCAACTGGATTGG + Intergenic
904454762 1:30640906-30640928 TTCATTAGCATCATCTGGGGAGG - Intergenic
905504497 1:38466343-38466365 TACATCAGAATCACCTTGGGAGG - Intergenic
905561520 1:38930979-38931001 TGCATCAGAATCATCTGGGGAGG + Intronic
905964418 1:42080202-42080224 TGCATTGGAATCTACTGCGGAGG + Intergenic
906493737 1:46288153-46288175 TACATCAGAAACATCTGGGATGG - Intronic
907762721 1:57377475-57377497 TGCATAAGAATCATCTGAGGAGG - Intronic
908629357 1:66085210-66085232 TACATCAGAAGCACTTGGGGAGG - Intronic
908846020 1:68325122-68325144 TAAAATAAAATAAACTGGGGGGG - Intergenic
910922614 1:92365368-92365390 TACATTAGAATTACATGGGGAGG + Intronic
912262575 1:108123623-108123645 AACATTAGAACCACCTGGGCGGG - Intergenic
912485182 1:110021418-110021440 AACATTACAATAATCTGGGGAGG - Intronic
913205920 1:116538591-116538613 TACATCAGAAGCACCTGGGATGG - Intronic
914462316 1:147896880-147896902 TGCATTAGAATCACCTGGGGGGG + Intergenic
916181214 1:162085363-162085385 TTGATTAGAATTATCTGGGGAGG - Intronic
916952450 1:169794777-169794799 AACATTACATTCAAATGGGGAGG - Intronic
917292573 1:173486382-173486404 TACCTTCCAATCAACTGGGGTGG - Exonic
920248845 1:204608742-204608764 CACATCAGAATCACCTGGAGGGG - Intergenic
922168399 1:223134924-223134946 TAAATTGGAAACAGCTGGGGTGG + Intronic
1064953126 10:20876881-20876903 TACATTAGAAAAAACTGGCAGGG + Intronic
1064964788 10:21004422-21004444 TAAATAAGAATCACCTGGGCCGG + Intronic
1065176190 10:23078129-23078151 AACATTAAAATCAGCTGGTGGGG + Intergenic
1065996840 10:31067455-31067477 TACATGAGAATCAATGGGGCAGG + Intergenic
1066937685 10:41858524-41858546 GGCATTAGAATCAACTGGAATGG + Intergenic
1066939353 10:41869354-41869376 GGCATTAGAATCAACTGGAATGG + Intergenic
1068637772 10:59366840-59366862 TACACTAGCATTAATTGGGGAGG - Intergenic
1069234205 10:66049775-66049797 TACATTAGCATCTACTTGAGGGG + Intronic
1070216692 10:74390777-74390799 CATATTACAATCAACTGGGTTGG - Intronic
1070951637 10:80436027-80436049 CACAGTAGAATCACCTGGTGCGG + Exonic
1071267697 10:83978937-83978959 CACATTAGAATCACCTGGGAAGG + Intergenic
1071310523 10:84339302-84339324 TGCATTAGAATCCCCTGGAGAGG - Intronic
1072478902 10:95791713-95791735 TACATTAGAATCACCCGGCTGGG + Intronic
1072749140 10:97964254-97964276 TACATCAGAATCACATGGTGGGG + Intronic
1073652104 10:105372043-105372065 TGCATTGGAATCAACTTGGCAGG + Intergenic
1074168262 10:110905968-110905990 TACACTAGAATAAAGTGGGTTGG - Intronic
1075092173 10:119449990-119450012 TACGCTAGAATCAGCTGGGGAGG - Intronic
1075247061 10:120832087-120832109 TAGATAAAAGTCAACTGGGGGGG + Intergenic
1075747581 10:124738378-124738400 CACATTAGAGTCACCTGGGAAGG - Intronic
1075862782 10:125691600-125691622 AATATTGGAATCACCTGGGGAGG - Intergenic
1076912141 10:133395826-133395848 CACATTAGAATTACCTGGGGAGG + Intronic
1077425975 11:2477877-2477899 CACGTTAGAATCAACAGGGCTGG + Intronic
1078484120 11:11706056-11706078 TCCATTAGAATCCCCTGGGGAGG - Intergenic
1079008240 11:16807839-16807861 TATATCAGAATCACTTGGGGTGG - Intronic
1079505804 11:21150650-21150672 TACATTTGAATCATCTGGGGTGG + Intronic
1080321652 11:31016833-31016855 CATATTAGAATCACCTGGTGTGG - Intronic
1080421795 11:32117374-32117396 TACATCAGAATCACCTGGGGAGG - Intergenic
1081328312 11:41773485-41773507 TATATTAGAATCAACTGTCTGGG + Intergenic
1083539802 11:63504834-63504856 TGCATCAGAATCACCTGGAGGGG + Intergenic
1086307048 11:85492670-85492692 TATATTAGCATCAAATTGGGAGG + Intronic
1086526047 11:87727043-87727065 TTCACTAAAATCCACTGGGGCGG - Intergenic
1087155526 11:94898177-94898199 TAGATTACAATGAACTGGGGTGG + Intergenic
1087660531 11:100982407-100982429 TACATAAGAATCACTTGGGGAGG - Intronic
1088902294 11:114127414-114127436 TACATTGGAATTATCTGAGGGGG - Intronic
1089869321 11:121657935-121657957 TACATTACAACCACCTGGGCAGG - Intergenic
1090156418 11:124442970-124442992 TAAATTAGAATCTCCAGGGGTGG + Intergenic
1094124370 12:27007509-27007531 TCCATTACAATCATCTGGAGGGG + Intronic
1094764237 12:33573924-33573946 TACATTATAATCCACTGCTGGGG + Intergenic
1095457878 12:42408433-42408455 TGCACTAGAATCTACTGGGCTGG - Intronic
1097111103 12:56658828-56658850 TACATCAGAATCACCCGGAGAGG + Intergenic
1098192396 12:67963537-67963559 CAGCTTACAATCAACTGGGGAGG - Intergenic
1098509964 12:71300141-71300163 TGCATTGGAATCACCTAGGGTGG - Intronic
1098746997 12:74251225-74251247 TCCATCAGAATCATCTGTGGAGG - Intergenic
1099370502 12:81824266-81824288 TAAATTTGAATCAATTGAGGAGG + Intergenic
1100954320 12:99889944-99889966 CACATTGGAATCACCTGGGGAGG - Intronic
1101208074 12:102508755-102508777 TACATTGGAATCACCCGAGGAGG + Intergenic
1102559391 12:113751444-113751466 TGCATCTGAATCACCTGGGGTGG + Intergenic
1102982691 12:117254667-117254689 CACATCAGAATCACCTAGGGAGG - Intronic
1105378811 13:19867428-19867450 TAGATCAAAAACAACTGGGGTGG + Intergenic
1105473952 13:20715183-20715205 TCTATTAGAATTATCTGGGGAGG + Intronic
1105784241 13:23732764-23732786 GATATTAGAATCAACTGAGAAGG + Intronic
1106574775 13:30964302-30964324 GACATCAGAATCACCTGGGAAGG - Intronic
1107303142 13:38987151-38987173 TAGATTAGAATCACCTGAAGGGG - Intronic
1107399021 13:40050110-40050132 TGCATAAGAATCACCTGGGAGGG - Intergenic
1108091389 13:46853558-46853580 CACATTAGAATCATCTGGGGAGG - Intronic
1110112676 13:71767784-71767806 TCCATTAGAATTCACTTGGGTGG - Intronic
1110134957 13:72055348-72055370 TACATCAGACTCTAGTGGGGAGG - Intergenic
1112441653 13:99428512-99428534 CACATTGGAATCACCTGGGAGGG - Intergenic
1114842878 14:26286540-26286562 TACCTTATAAGTAACTGGGGTGG - Intergenic
1115005613 14:28480205-28480227 TGCATTAGCATCAACTGGGGTGG - Intergenic
1115370744 14:32611353-32611375 TACTTTAGAATCACCTGGGGAGG - Intronic
1115701909 14:35961845-35961867 AACATTAGAATTGCCTGGGGAGG - Intergenic
1116253565 14:42518828-42518850 TACATTAGAATAAATAGTGGAGG + Intergenic
1117045631 14:51810539-51810561 AACATTAGAATCACCTGGAAAGG + Intergenic
1117583010 14:57171874-57171896 CACATTGGAATCACCAGGGGAGG + Intergenic
1118132592 14:62983806-62983828 TACATTGTAATCACCTGGGAAGG - Intronic
1119989465 14:79179571-79179593 AACATCAGAATCATCTGGGAGGG - Intronic
1202904990 14_GL000194v1_random:65359-65381 AAGATTAGAATCAACTGTGAGGG - Intergenic
1123788352 15:23694713-23694735 CACATTAGTAATAACTGGGGGGG - Intergenic
1124142550 15:27089466-27089488 TACCCTAGAGTCACCTGGGGAGG - Intronic
1124819271 15:33028091-33028113 CATATTACAATCACCTGGGGAGG + Intronic
1124840277 15:33235101-33235123 TAAATTAGGAACCACTGGGGTGG - Intergenic
1125986829 15:44061692-44061714 TGCATTAAAATAAGCTGGGGTGG + Intronic
1128368447 15:67021820-67021842 CACAGAAGAATCAACTGGGATGG - Intergenic
1128394763 15:67213048-67213070 TCCATAAGAATCAGCTGAGGAGG - Intronic
1130116326 15:81007754-81007776 TGCATCTGAATCAACTGGGAGGG - Intronic
1130380457 15:83367752-83367774 CACATTAGAATCCCCTGGAGAGG - Intergenic
1130690911 15:86080657-86080679 CACATTAGAATCACCTGGAGAGG + Intergenic
1130953117 15:88607373-88607395 TCCATTAGAAACATCTGGGTAGG + Intergenic
1131018038 15:89074075-89074097 TACATAAGAGTCACCTGGGCCGG + Intergenic
1131451306 15:92542428-92542450 TGCATCAGAATCACCTGGAGTGG + Intergenic
1131451384 15:92543150-92543172 CACAGTAGAATTACCTGGGGAGG - Intergenic
1131861977 15:96663441-96663463 CACATTAGAATCACCTGATGAGG - Intergenic
1132938200 16:2492803-2492825 TACATTAAAATCAACTTCGGTGG + Intronic
1134365454 16:13573190-13573212 TACATTGGAATCACGTGGGGGGG - Intergenic
1135490893 16:22908371-22908393 TAATTTATAATCAAGTGGGGTGG + Intronic
1138580490 16:57937803-57937825 TGCATTGGAATCACCTGGGAAGG + Intronic
1140760013 16:78101681-78101703 TAGATTAGAATCACCTGGGAGGG - Intronic
1140999830 16:80297844-80297866 TGCATCAGAATCACCTGGGAAGG - Intergenic
1141342083 16:83212731-83212753 TGCGTGAGAATCACCTGGGGAGG + Intronic
1141843340 16:86589272-86589294 TACACTAGAATCATTTGGGAAGG - Intergenic
1142842176 17:2641572-2641594 TACAAAAGCATCAACTGAGGGGG - Intronic
1144009759 17:11135798-11135820 TGCATTGGAATCACCTGGAGGGG - Intergenic
1144369140 17:14573491-14573513 CATATTAGAATCACCTGGAGAGG - Intergenic
1146357147 17:32143436-32143458 TGAATTAGAATTATCTGGGGAGG + Intronic
1147286252 17:39404464-39404486 TACATCAGGAGCAGCTGGGGAGG - Intronic
1148255694 17:46129882-46129904 TACATTAGAATCATCTAGGGAGG + Intronic
1149636636 17:58176250-58176272 TACATCAGAATCAACCGAGAGGG + Intergenic
1151642191 17:75404529-75404551 TACATTAGAAAAAAAGGGGGGGG + Intronic
1156138224 18:34070960-34070982 TACATTAAAATAAAATGGTGTGG + Intronic
1158169526 18:54581490-54581512 TGCATTAGAATCAGCTGTGAAGG - Intergenic
1158251993 18:55499548-55499570 TACATTAGAATCAACTGGGGAGG + Intronic
1158382286 18:56945764-56945786 TTCATAAGAATCACCGGGGGAGG - Intronic
1158490265 18:57903508-57903530 CACATTAGAATCTCCTGGAGTGG - Intergenic
1159292117 18:66436336-66436358 TACATTAGAATCACCTGAAGAGG + Intergenic
1159896872 18:74005597-74005619 TGCATCATATTCAACTGGGGTGG - Intergenic
1162339231 19:10081974-10081996 TTCATTTGACTCAACTGGAGTGG + Intergenic
1164466413 19:28490938-28490960 TGTATTAGAATCACCTGGGAAGG + Intergenic
1166272912 19:41728392-41728414 CACATTAGTAGCATCTGGGGAGG - Intronic
1166339478 19:42129132-42129154 CACATTAGAATCACCAGGAGGGG - Intronic
1167805234 19:51778452-51778474 TTCATCAGAGTCAATTGGGGAGG + Intronic
928818337 2:35325894-35325916 TACATTAAAAGTAACTGGGAGGG - Intergenic
929267844 2:39939046-39939068 TGCATAAGAATCATCTGGAGGGG + Intergenic
929751960 2:44724499-44724521 TATATTAGAATCACCTGAGAAGG - Intronic
930541575 2:52713185-52713207 TAAGTTTGAATCTACTGGGGAGG - Intergenic
931988610 2:67766392-67766414 CACATTTGAATCACCTGGGTGGG + Intergenic
932132392 2:69199732-69199754 CCCATTAGAATCACCTGGGGAGG - Intronic
935289651 2:101599276-101599298 TAAATCAGTATCAAATGGGGGGG + Intergenic
936616981 2:114057789-114057811 CATATTAGAATCACCTGGGGAGG + Intergenic
936847109 2:116850347-116850369 CACATTAGAAGCACCTAGGGAGG - Intergenic
940442332 2:153732430-153732452 CATATGAGAATCAACTGTGGTGG - Intergenic
940890915 2:159034430-159034452 CACATTAAAATCAACTGGTCGGG + Intronic
940982398 2:160018339-160018361 TACTGTAGAATAAACTGTGGTGG + Intronic
941072319 2:160968975-160968997 TGCATCAGAATCACTTGGGGGGG + Intergenic
942059775 2:172217500-172217522 TGCATCAGAATCAACTGGGAGGG - Intergenic
942792815 2:179780057-179780079 CCCATTAGAATCACCTGGGAAGG - Intronic
943320764 2:186439554-186439576 CACATTGTAATCACCTGGGGAGG - Intergenic
943759313 2:191591291-191591313 TGCATCAGAATCACCTGGAGGGG - Intergenic
944508216 2:200437399-200437421 TCCAACAGAATCACCTGGGGAGG + Intronic
944830905 2:203533846-203533868 TACATGAAAAACATCTGGGGAGG + Intronic
944887353 2:204077019-204077041 CACATTACAATCAACTAGGGTGG - Intergenic
946596318 2:221309664-221309686 TACATTGGAATCACCTGGAAAGG - Intergenic
947160118 2:227206371-227206393 CACATTAGAATCACCTGAGGGGG - Intronic
948049680 2:234970315-234970337 TGCATCAGAATCAACTGTGAAGG + Intronic
948510572 2:238461552-238461574 CATATTAGAATCCACTGGGAGGG - Intergenic
1168734538 20:119178-119200 TACATTAAAAACTAGTGGGGAGG - Intergenic
1170599078 20:17827413-17827435 CACATTATAATCACCTGGGCAGG + Intergenic
1171182311 20:23099747-23099769 TACATGGGAATCACCTGGGGTGG + Intergenic
1171915473 20:31059194-31059216 TACAATAGAATGAAATGGAGTGG + Intergenic
1171919378 20:31086072-31086094 TACAATAGAATCAAATGGGAGGG + Intergenic
1171927879 20:31204231-31204253 TACAATAGAATCAAATGGGAGGG + Intergenic
1172108828 20:32533406-32533428 TGCATCAGAATCATCTGGGGGGG - Intronic
1172459330 20:35104153-35104175 TGCATTAGAATCACCTGGAGGGG + Intergenic
1173246169 20:41339341-41339363 TACATTACAACCAACTGGAGAGG + Intergenic
1173329036 20:42058963-42058985 CACACTAGAATCACCTGGGGAGG + Intergenic
1173340206 20:42146467-42146489 CACATTAGAATCACCTGGGCAGG + Intronic
1174771877 20:53307796-53307818 CACATTAGAATCACCTCTGGGGG - Intronic
1174852096 20:54005661-54005683 CACACTGGAATCACCTGGGGAGG - Intronic
1175503711 20:59467649-59467671 CTCATTAGAATCCCCTGGGGAGG - Intergenic
1176525839 21:7917535-7917557 TACATTGGAATCAAATGGAATGG - Intergenic
1176624352 21:9080118-9080140 AAGATTAGAATCAACTGTGAGGG - Intergenic
1177575652 21:22951564-22951586 TATATTAAAATTATCTGGGGAGG - Intergenic
1178100762 21:29266296-29266318 CTCATTAGAATCCCCTGGGGAGG - Intronic
1178346521 21:31833307-31833329 TGCATCAGAATCACCTGGAGGGG + Intergenic
1178812823 21:35899052-35899074 TAAATTAGAATCAACTATTGTGG + Intronic
1179093643 21:38291778-38291800 TGCTTTAGAATCACCTGGAGGGG - Intronic
1180015900 21:45083657-45083679 TACATTTGATTCAACTGTGGAGG + Intronic
1182625386 22:31642089-31642111 TATACCAGAATCAACTGAGGTGG + Intronic
1182869571 22:33634241-33634263 TGCATCAGAATCACCTGGAGGGG + Intronic
949723498 3:7017628-7017650 TACATTATTATCACCTGGGAAGG + Intronic
952717010 3:36490017-36490039 TGCATCAGAATCACCTGGAGGGG - Intronic
954204620 3:49049202-49049224 GACATTAAAATCACCTGGGAAGG - Intronic
954889936 3:53917028-53917050 TACTTAAGAATTAACTGAGGAGG - Intergenic
955550623 3:60081148-60081170 CCCATTAGAATCACCTGAGGGGG + Intronic
956938992 3:74135677-74135699 CATATTAGAATCACCTGGGGAGG + Intergenic
957273215 3:78057718-78057740 TAGATTAGAATAAAATGGGTTGG + Intergenic
957857516 3:85896872-85896894 TAGATTAGAATCACCTCAGGTGG + Intronic
958577499 3:95971561-95971583 TACAGTAGAATCCACTGTGAAGG - Intergenic
961709833 3:128819635-128819657 CACATTAGAATCACCTGGAGGGG - Intergenic
962042996 3:131726702-131726724 TGCATCCTAATCAACTGGGGGGG + Intronic
963000801 3:140679955-140679977 CACATTAGAATCACCTGAAGCGG - Intronic
963334113 3:143952780-143952802 CACATTATAATCACCTGGGGAGG - Intergenic
965611341 3:170547039-170547061 CACATTAGAATCACCTGGGAAGG - Intronic
966814466 3:183878611-183878633 CACATGAGAATCACCTGGGGAGG - Intronic
968298517 3:197595505-197595527 CACTTTAGAATCACCTGGGGAGG - Intergenic
971386784 4:26148026-26148048 TACACTAGAATCATCTGAGTGGG - Intergenic
971582579 4:28361515-28361537 TACATTAGAATTATATGGTGAGG + Intergenic
973400937 4:49637210-49637232 GACATTGGAATCAACTGGAATGG + Intergenic
973401290 4:49639387-49639409 TGCAATGGAATCAACTGGAGTGG + Intergenic
979383907 4:120041498-120041520 TAATTTGGAATTAACTGGGGTGG + Intergenic
979755138 4:124330983-124331005 TGCATCAGAATCACCTGGAGGGG - Intergenic
980925913 4:139137401-139137423 TATATTAGAATGAACTTGGAGGG - Intronic
981703902 4:147639559-147639581 CAAATTAAAATCACCTGGGGAGG + Intronic
981920591 4:150080115-150080137 CACATTAGAATCACCTGGGGGGG - Intronic
981967061 4:150616780-150616802 TACATTATAAACATTTGGGGGGG + Intronic
983074375 4:163307361-163307383 CACATTAGAATAAATTGAGGAGG + Intergenic
984739631 4:183148417-183148439 TACATTATATTAAAATGGGGAGG - Intronic
985244955 4:187971137-187971159 CACCTTCCAATCAACTGGGGTGG - Intergenic
985828935 5:2213612-2213634 CACATTAGAAGCACCTGAGGAGG - Intergenic
986722754 5:10571784-10571806 TACATTAGAATCATCTGGAAAGG + Intronic
987448238 5:18048484-18048506 CACATCAGAATCAAGTGGGGAGG + Intergenic
988725808 5:33925402-33925424 TACAACAGAACCAAATGGGGAGG + Intergenic
989606333 5:43247540-43247562 CACATTAGAATTACCTGGGAAGG + Intronic
990483104 5:56230386-56230408 TACTTAAGAATCATCTGGGCCGG - Intronic
992116691 5:73545175-73545197 TACATTAGAATCAACTGAGAAGG + Intergenic
993151760 5:84171772-84171794 TACATTAGAATTATCTGGGGAGG + Intronic
995815221 5:116159651-116159673 TACATGATAATGAACTGTGGAGG + Intronic
996823824 5:127659299-127659321 ATCATCAGAATCAACTGGGGAGG + Intergenic
997739698 5:136242838-136242860 CACATCAGAGTCACCTGGGGAGG - Intronic
997868699 5:137488073-137488095 TACATCAGAATCACCTGGATTGG + Intronic
998758009 5:145401965-145401987 TAACTTAGAAGCAACGGGGGTGG - Intergenic
1000184915 5:158850022-158850044 TACATGAGTATCAACTGGGAAGG + Intronic
1000421946 5:161047909-161047931 CACATAAAAATCAGCTGGGGAGG - Intergenic
1000957501 5:167560209-167560231 TACACAAGAGTCACCTGGGGTGG - Intronic
1003046254 6:2735739-2735761 AAAATTAGAATCAACTGTGGTGG + Intronic
1004020188 6:11770224-11770246 TACATTAGAATCTCTGGGGGTGG - Intronic
1007018902 6:38498794-38498816 TGCCTCAGTATCAACTGGGGTGG - Intronic
1008137029 6:47788790-47788812 TATATTAGGATAACCTGGGGGGG + Intronic
1009027483 6:58017143-58017165 TTCATTAGAATCACCTGGAGAGG - Intergenic
1009203015 6:60768619-60768641 TTCATTAGAATCACCTGGAGAGG - Intergenic
1011013306 6:82726431-82726453 TATATTAGAATCACCTGGGGAGG - Intergenic
1011660520 6:89590362-89590384 CACATTAGAGTCACCTGGGGAGG + Intronic
1012185521 6:96210398-96210420 CACATTAGAACCATCTGGAGAGG + Exonic
1012784670 6:103608387-103608409 CACATTAGAATCATCTGGGGTGG - Intergenic
1013433745 6:110080626-110080648 TAGGTTAGAATCACCAGGGGTGG - Intergenic
1014112762 6:117638138-117638160 CACATTAAATTCATCTGGGGAGG - Intergenic
1014919082 6:127191332-127191354 CACATCAAAATAAACTGGGGGGG + Intronic
1017570142 6:155735386-155735408 TGCATGAGAAGGAACTGGGGTGG + Intergenic
1017731491 6:157321162-157321184 TACAAAAGAATTAACTGGGCGGG - Intronic
1021591753 7:22271157-22271179 CACATTAGAATCATTTGGAGAGG + Intronic
1021628255 7:22616125-22616147 CACATTGGAATCTCCTGGGGAGG - Intronic
1022149616 7:27587852-27587874 GACATTTTAATCAACTGAGGAGG + Intronic
1022648104 7:32250387-32250409 CGCATCAGAATCACCTGGGGAGG + Intronic
1022792429 7:33702335-33702357 TTCATTGGAATCACCTGTGGAGG + Intergenic
1022903764 7:34835828-34835850 CACAGTAGAATCGCCTGGGGAGG + Intronic
1023187236 7:37545002-37545024 TAAATTAGAATCAAATGTTGAGG + Intergenic
1023292164 7:38679839-38679861 TACATTAAAATAAGCTGGGATGG - Intergenic
1024765838 7:52658350-52658372 TACATTACAATTTTCTGGGGAGG - Intergenic
1027130759 7:75589238-75589260 CACATTAGACCCAACTGGAGAGG + Intronic
1027949016 7:84788767-84788789 AACATTAGAATCACCTGAGGAGG + Intergenic
1028770397 7:94613876-94613898 TACATTAGAAAGAAGTTGGGTGG - Intronic
1029932039 7:104382501-104382523 CACATTGGACTCACCTGGGGAGG + Intronic
1030124182 7:106138981-106139003 CACATTAGAATCACCTGAGGGGG + Intergenic
1030523220 7:110623528-110623550 AACATTAGAATCACCTTGAGAGG - Intergenic
1031546701 7:123059511-123059533 TAAATTAGAGTCACCTGGGAAGG - Intergenic
1034183332 7:149155539-149155561 TATATTAGAATCATCTATGGAGG - Intronic
1034217250 7:149417711-149417733 TACCTTAGAATCACCTAGGGAGG + Intergenic
1034745087 7:153516973-153516995 TAGATTAGAATCACCTGAGCAGG + Intergenic
1035126699 7:156613090-156613112 TGCTTTAGAATCATCTTGGGTGG - Intergenic
1035418854 7:158710469-158710491 TGCATTAGGATCACTTGGGGAGG - Intergenic
1035488849 7:159254240-159254262 TACATCGGGATCACCTGGGGAGG - Intergenic
1036385287 8:8274075-8274097 TACAGGAGAAACAACTGGGCAGG + Intergenic
1038048306 8:23785976-23785998 TACATCAGAGTCATCTGAGGAGG - Intergenic
1038602834 8:28964730-28964752 TATCATAGAATCTACTGGGGTGG - Intronic
1039997015 8:42542238-42542260 TACAGGAGAAGAAACTGGGGTGG - Intronic
1041490979 8:58432798-58432820 TCCATCAGAATCATTTGGGGAGG + Intronic
1042224832 8:66507329-66507351 TGCATTAGAATCACGTGGGGCGG - Intronic
1042441908 8:68838610-68838632 TACATCAGAATCACCTGGGTTGG - Intergenic
1043018965 8:74976661-74976683 TACATTAAAAAAAACTTGGGGGG + Intergenic
1044710198 8:95049826-95049848 TACATTCCAATGAAGTGGGGAGG - Intronic
1045558589 8:103238926-103238948 CACATTGGAATCACCTGAGGAGG + Intergenic
1045959354 8:107948996-107949018 CATATTAGAAACACCTGGGGAGG + Intronic
1046109855 8:109709526-109709548 TACAGTTGAATCATCTGGAGTGG - Intergenic
1046376366 8:113386726-113386748 TACATCAGAATAAACTGCAGTGG + Intronic
1048002433 8:130389992-130390014 TGCATCAGAATCACCTGTGGTGG + Intronic
1048516407 8:135115667-135115689 CGCATTGGAATCACCTGGGGAGG + Intergenic
1048538082 8:135316283-135316305 TACATTAGAATTGCCTGGGTTGG + Intergenic
1049121039 8:140738096-140738118 TACATTAGAAACTACTTTGGAGG - Intronic
1051093174 9:13434114-13434136 CACACTAGAATCACCTGGGGAGG - Intergenic
1051227999 9:14922757-14922779 CACATCAGAATCACATGGGGTGG + Intergenic
1051683330 9:19631033-19631055 TACAAAAGAATGAACTAGGGAGG - Intronic
1052372968 9:27686780-27686802 TACATTAGAATCCCTGGGGGTGG + Intergenic
1054875510 9:70092237-70092259 ACTATTAGAATCACCTGGGGAGG + Intronic
1054925276 9:70582750-70582772 TACAGTAGAATCTACTGTGATGG - Intronic
1055620622 9:78121453-78121475 TATATTCGAATCACCTGGGGTGG + Intergenic
1056384331 9:86082803-86082825 TACATATGAATCACCTGGGGAGG - Intronic
1056970631 9:91198860-91198882 TGCATTAGAATCAGCTGGGGAGG + Intergenic
1057766676 9:97925956-97925978 TACATTAGACTCACCTGGGAAGG - Intergenic
1059159392 9:112019649-112019671 CACATGAGAATTACCTGGGGAGG + Intergenic
1059407679 9:114111962-114111984 TGCATTAGAGTCACCTGGAGTGG - Intergenic
1059424187 9:114210609-114210631 TCCATTAGAAGCCCCTGGGGTGG + Intronic
1059785138 9:117573907-117573929 AACATTGGAATCACATGGGGAGG + Intergenic
1060363203 9:122980998-122981020 TATATCAGAATCATCTGTGGAGG + Intronic
1203747530 Un_GL000218v1:50549-50571 AAGATTAGAATCAACTGTGAGGG - Intergenic
1186157248 X:6738405-6738427 CACCTTAGAACCACCTGGGGAGG + Intergenic
1186539205 X:10383033-10383055 TACCTGAGAAACAAATGGGGTGG - Intergenic
1186779578 X:12899444-12899466 TACATCAGGATCATCTGGGTGGG - Intergenic
1186970184 X:14833644-14833666 TACATTAGAATCACCTGGGGAGG + Intergenic
1186990141 X:15058094-15058116 CACATTAGAATCCCCTGGGGAGG - Intergenic
1187579706 X:20594610-20594632 TCCATCAGAAACACCTGGGGAGG + Intergenic
1187935333 X:24330476-24330498 CACTTTGGAACCAACTGGGGAGG - Intergenic
1188177633 X:27011957-27011979 TACATTTGAATCATCAGGGTTGG - Intergenic
1188460980 X:30426866-30426888 TACATTAGAATCACCTGGAGGGG - Intergenic
1188538701 X:31225627-31225649 AACATCAGAATCACCTGGAGTGG + Intronic
1188609182 X:32075027-32075049 GACATTTGAATCGACTGGAGAGG + Intronic
1189012800 X:37063335-37063357 TACTTCAGGATCTACTGGGGTGG - Intergenic
1189097379 X:38154894-38154916 AAAATTAGAATCCTCTGGGGTGG - Intronic
1189241786 X:39530554-39530576 TACATTATACTGACCTGGGGAGG - Intergenic
1189488855 X:41454109-41454131 TACATCAGAATCTTCAGGGGTGG - Intronic
1193126410 X:77875157-77875179 TAAATTAGTATCAACTTGGCGGG - Intronic
1194726332 X:97401717-97401739 TACATCAGAATCACCTAGGGAGG - Intronic
1196055263 X:111348622-111348644 TTCATCAGAAAGAACTGGGGTGG + Intronic
1197276939 X:124490271-124490293 TACATGAGATCAAACTGGGGAGG + Intronic
1200230810 X:154443072-154443094 TAAATTAGAATAAATTAGGGGGG - Exonic
1201160860 Y:11165533-11165555 AAGATTAGAATCAACTGTGAGGG - Intergenic
1201212810 Y:11696026-11696048 TAGAATAGAATGAACTGGAGAGG + Intergenic