ID: 1158253758

View in Genome Browser
Species Human (GRCh38)
Location 18:55521081-55521103
Sequence TTGCTACTTACTAGGAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158253755_1158253758 -9 Left 1158253755 18:55521067-55521089 CCTATCAACCAGCATTGCTACTT 0: 1
1: 0
2: 0
3: 15
4: 191
Right 1158253758 18:55521081-55521103 TTGCTACTTACTAGGAATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158253758 Original CRISPR TTGCTACTTACTAGGAATTC TGG Intronic
908413136 1:63886458-63886480 TTGCTACTTGCCAGGGATCCGGG + Intronic
909144317 1:71910371-71910393 TTGGTACTTATTAGGTATCCAGG - Intronic
909416578 1:75413223-75413245 TTGGTACTTGCTATGATTTCAGG + Intronic
909424614 1:75508326-75508348 TTGCTACATCCTAGAAATTTTGG - Intronic
909744101 1:79071667-79071689 TTGTTATTTACTATGAAATCTGG + Intergenic
909997798 1:82302285-82302307 TTGCTAGTTAATAGGGATTTAGG - Intergenic
912878371 1:113385717-113385739 TTTATTCTTACTAGAAATTCAGG + Intergenic
915726541 1:158022085-158022107 TAGCTGCCTACTAGGAATCCAGG - Intronic
916042961 1:160977169-160977191 TTGCTATTTACTATTAATTATGG + Intergenic
918490207 1:185073666-185073688 CTGTTACTTACAAGGAATGCAGG + Intronic
918758468 1:188369191-188369213 TTGTTACTTATTAGGAGTTTAGG + Intergenic
919027411 1:192194537-192194559 TTGCTACTTATTTTGATTTCAGG - Intergenic
919475620 1:198029928-198029950 TTTCTACTTACTGTGAATTGGGG - Intergenic
919925600 1:202190313-202190335 TTGCACCTTAGTAGGAACTCAGG - Intergenic
920771395 1:208889589-208889611 TTGCAACTTACATGTAATTCTGG - Intergenic
1065830750 10:29611741-29611763 CTGCTACTTACGAGAACTTCTGG + Intronic
1067130306 10:43558245-43558267 TTCCTAGTTACTAAGACTTCAGG - Intronic
1068407354 10:56607411-56607433 TTGATTATTCCTAGGAATTCAGG - Intergenic
1068971075 10:62959059-62959081 TTGCTTCTTACTGGTAAGTCTGG - Intergenic
1072053532 10:91730034-91730056 TTATTACTTAATAGGAAGTCTGG - Intergenic
1072167472 10:92827954-92827976 ATGCTACTGACTAGGATTTGGGG - Intergenic
1073060101 10:100728900-100728922 TTCCTACTTCCAAAGAATTCTGG + Intergenic
1073834840 10:107429391-107429413 CTGCTCCTTACTTGGGATTCAGG + Intergenic
1073899340 10:108201964-108201986 TTGCTCCCTTCTAGGAAATCCGG + Intergenic
1074625496 10:115179414-115179436 TAGCTATTTTCTAGGAATTCTGG + Intronic
1075990553 10:126835087-126835109 TCCCTATTTACTAGGTATTCAGG - Intergenic
1078459641 11:11504369-11504391 TTGTTACTCACTAGAACTTCAGG - Intronic
1089479759 11:118794720-118794742 GTTCAACTTACTAGGAATTCTGG - Intergenic
1096142658 12:49255196-49255218 ATTATAATTACTAGGAATTCTGG - Intronic
1098117559 12:67196308-67196330 TTCCTACTTAGAAGGAATTTGGG + Intergenic
1100064763 12:90628733-90628755 TTGGTACATACTAGGCATTCAGG + Intergenic
1100918471 12:99455228-99455250 TGGCTACTTAGTAGGGGTTCTGG - Intronic
1108865095 13:54913488-54913510 TTGCTACATCCGAGGAATTTTGG - Intergenic
1109899704 13:68750772-68750794 TAGCTACATACTTGGAATACAGG - Intergenic
1110637172 13:77779686-77779708 TTTCTAGTGACTAGGAATTCCGG + Intergenic
1113002259 13:105654951-105654973 TTGGTGCTTACAAGGATTTCTGG - Intergenic
1116487109 14:45463214-45463236 TTGCTACATACTAGGAAAAATGG + Intergenic
1118248095 14:64131394-64131416 TTGCTGCTTTATAGGAATCCTGG - Intronic
1118904055 14:70010665-70010687 TTGCTACTTACTTTGGATGCTGG + Intronic
1119103249 14:71899673-71899695 TTGAGACTTACTAAGAATTCTGG + Intergenic
1127231852 15:57005134-57005156 TTGATACTTCCTAGTATTTCTGG + Intronic
1127370428 15:58333722-58333744 TTGCTTCTTGCCAGCAATTCCGG + Intronic
1127724484 15:61735138-61735160 TTCCTACTATCTAGAAATTCTGG + Intergenic
1133686300 16:8168495-8168517 CTGCTACATGCTAGGAACTCTGG + Intergenic
1134788427 16:16965696-16965718 TTACTACTAACTAGGATTTACGG + Intergenic
1141839617 16:86566467-86566489 TTGCTACTTACAAGGTCTTTGGG + Intergenic
1146641003 17:34541445-34541467 TGGCTGCTTACAGGGAATTCAGG + Intergenic
1148418982 17:47530699-47530721 TTGCTACTTAACAGGAACTAAGG + Intronic
1149247700 17:54730608-54730630 TAGCTGCTTCCTAGAAATTCTGG - Intergenic
1157268852 18:46253708-46253730 TTGTCACTTGCTAGGAATCCTGG - Exonic
1158253758 18:55521081-55521103 TTGCTACTTACTAGGAATTCTGG + Intronic
1159833396 18:73306096-73306118 CTGGTACTAACTTGGAATTCTGG + Intergenic
1164808788 19:31139757-31139779 ATGCTCCTTACTATGAGTTCAGG + Intergenic
926560203 2:14408377-14408399 TTGCCACTAAGTAGGATTTCTGG + Intergenic
930974039 2:57432553-57432575 TTGCCATTTTCTAGGATTTCAGG + Intergenic
933279604 2:80318453-80318475 TTGCCACTTACTAGTAATTTAGG + Intronic
934114243 2:88769152-88769174 CTGCTACATAATAGGTATTCAGG - Intergenic
934635783 2:95988538-95988560 CTGCTACATAATAGGTATTCAGG + Intronic
934797866 2:97116900-97116922 CTGCTACATAATAGGTATTCAGG - Intronic
934835551 2:97586543-97586565 CTGCTACATAATAGGTATTCAGG + Intronic
935043036 2:99452912-99452934 TTGCTAGTTACTTGGATTTCAGG + Intronic
935151045 2:100436151-100436173 TTGACTCTTACTAGGAATTAGGG - Intergenic
935264858 2:101385572-101385594 TTGTTACTTGCTCAGAATTCAGG + Intronic
935575469 2:104705158-104705180 TTGTAACTTTCTAAGAATTCTGG - Intergenic
939657961 2:144851392-144851414 TTTCCATTTACGAGGAATTCAGG - Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
942031194 2:171961386-171961408 TTGCTAATTGCTAGCATTTCTGG + Intronic
942739680 2:179161033-179161055 TTCCTAGTAACTAGGAATACAGG + Intronic
943465833 2:188228076-188228098 TTGTCACTTGCTAGGAATCCTGG - Intergenic
1179188485 21:39103703-39103725 CTGCTACTGACTTGGATTTCAGG - Intergenic
951034523 3:17918497-17918519 TTGCTATTTACTATTAATTATGG + Intronic
951037036 3:17944480-17944502 TTGATATTTAGTAGGAATTGTGG + Intronic
953361253 3:42299187-42299209 TTAGTACATACTATGAATTCAGG - Intergenic
955035621 3:55264409-55264431 ATGCTACTTACTAGGAGTGATGG + Intergenic
955743172 3:62113864-62113886 TAGCTACCTACTATGAATTATGG - Intronic
956408929 3:68958423-68958445 TTGCAACTAACAAGGACTTCAGG - Intergenic
964477926 3:157113149-157113171 GTGGTACTTTCTAGGAATTTAGG + Intergenic
964818649 3:160745258-160745280 TTGCTATTTACTAGCAATGTTGG + Intergenic
965492548 3:169357167-169357189 TTGCTCTTTATTAGGAATCCTGG + Intronic
966031601 3:175355599-175355621 TTGCTACTTACTTTGAAATTAGG + Intronic
969208440 4:5666655-5666677 TGGCTACTTTCTAGGTTTTCTGG + Intronic
972994019 4:44857167-44857189 TTTCAAATTATTAGGAATTCTGG - Intergenic
975234783 4:71980244-71980266 TTGCAACTTAAGAGAAATTCTGG + Intergenic
976773304 4:88678826-88678848 ATGCTACTTATTAGGAATTTTGG - Intronic
977866424 4:102033800-102033822 TTGCTACTTATTTGGGATACAGG - Intronic
978403671 4:108357591-108357613 TCGCTACTTACTAGCAAAACTGG + Intergenic
979655016 4:123182006-123182028 TTGCTACTTACTAGACTCTCTGG + Intronic
983814248 4:172103261-172103283 TAGCTACTTCCTAAAAATTCTGG - Intronic
986148162 5:5099572-5099594 TTTTCACTTACTAGAAATTCAGG + Intergenic
986685546 5:10272731-10272753 TTGCCACTTAATATGCATTCAGG + Intergenic
987698620 5:21365695-21365717 TTGCAACTTATTAAGAAGTCAGG - Intergenic
988754033 5:34225833-34225855 TTGCAACTTATTAAGAAGTCAGG + Intergenic
991741812 5:69686678-69686700 TTGCAACTTATTAAGAAGTCAGG + Intergenic
991755880 5:69868530-69868552 TTGCAACTTATTAAGAAGTCAGG - Intergenic
991793386 5:70266417-70266439 TTGCAACTTATTAAGAAGTCAGG + Intergenic
991821198 5:70561983-70562005 TTGCAACTTATTAAGAAGTCAGG + Intergenic
991835208 5:70743678-70743700 TTGCAACTTATTAAGAAGTCAGG - Intergenic
991885763 5:71265952-71265974 TTGCAACTTATTAAGAAGTCAGG + Intergenic
992386416 5:76289001-76289023 TTCCTACTAACTGGGAATACAGG + Intronic
992667540 5:79025828-79025850 TGGCCACTTACTAGGTAATCTGG + Intronic
993321141 5:86468551-86468573 CTGCTACCTGCAAGGAATTCTGG - Intergenic
994711300 5:103267938-103267960 TTTCTACTTACGTGGCATTCTGG - Intronic
995485055 5:112631914-112631936 TTACTAAATACTAGGAATTCTGG + Intergenic
995942796 5:117605265-117605287 TAGGTACTTTCTAGGAATTGAGG + Intergenic
996147380 5:119992507-119992529 TAGCTATTTACTATGAATACTGG + Intergenic
997107970 5:131043458-131043480 TAGCTGCATCCTAGGAATTCTGG - Intergenic
998967378 5:147555239-147555261 TTGCTACATACAAGTAATTGCGG + Intergenic
999492401 5:152064098-152064120 TTTCTACTAACTAGGTATTGTGG - Intergenic
999832395 5:155333002-155333024 TAGCTGCCTACTAGAAATTCAGG - Intergenic
1001160534 5:169308672-169308694 TTGCAACTTACCTGGAATTGTGG + Intergenic
1005552214 6:26932674-26932696 TTGCAACTTATTAAGAAGTCAGG + Intergenic
1007838044 6:44691534-44691556 TTGCTACTTACTACTGATTTAGG + Intergenic
1010123447 6:72406311-72406333 AAGCCACTTACTATGAATTCAGG - Intergenic
1010979827 6:82359246-82359268 TGGCCACTTACTAGGTAATCTGG + Intergenic
1011288338 6:85749075-85749097 TTCCCACTCACTAGGAATTTTGG + Intergenic
1012910895 6:105116604-105116626 TGGCTAGTTACTAAAAATTCAGG + Intronic
1013044342 6:106469555-106469577 TTAATACTTAGTAGGTATTCAGG + Intergenic
1014669779 6:124287601-124287623 TTGATTCTTTCTATGAATTCTGG - Intronic
1016925443 6:149341728-149341750 TTGCTAGTTACTGGAAATGCAGG + Intronic
1017730223 6:157309231-157309253 TTACAACTTAGTAGGATTTCTGG + Intronic
1018401258 6:163422848-163422870 TTGCTACTGACCAGGAGATCAGG - Intronic
1020649658 7:10858620-10858642 TTGGTTCATACTAGGAATTCTGG - Intergenic
1022519637 7:30997868-30997890 TTGCTCCTCACTAGGAAAGCAGG + Intergenic
1022983711 7:35628773-35628795 TTTCCACTTACTAAGAATTCTGG + Intergenic
1028224891 7:88238768-88238790 TTGCTACTATTTAGGATTTCTGG - Intergenic
1030536738 7:110776716-110776738 TTGGTACTTTCTAGAAATTGAGG - Intronic
1031581031 7:123475320-123475342 TTCCTTCCTCCTAGGAATTCTGG + Intronic
1033300145 7:140177634-140177656 TTGCTGCTCGCTGGGAATTCGGG - Intergenic
1033570378 7:142622290-142622312 TTTCTGCTTCCTAAGAATTCTGG - Intergenic
1035736716 8:1893220-1893242 ATGATACTTCCTATGAATTCAGG - Intronic
1036175624 8:6535448-6535470 TTGCTACTTTTTAGCTATTCAGG + Intronic
1037648589 8:20816289-20816311 TTCCTTCTGACTAGGAATTCTGG - Intergenic
1039791435 8:40878980-40879002 TTGCTACTGACTAGCACTTGGGG + Intronic
1041765898 8:61417981-61418003 TTGCAACTTATTAGGATTTAGGG - Intronic
1043254382 8:78115370-78115392 GTGCTACATGCAAGGAATTCAGG + Intergenic
1046515827 8:115259066-115259088 TGGTTAATTATTAGGAATTCCGG + Intergenic
1046928589 8:119820912-119820934 ATGCTAATTAAAAGGAATTCTGG - Intronic
1047409114 8:124609740-124609762 TTGCTAGATACTGAGAATTCAGG - Intronic
1047851383 8:128861192-128861214 TTGGTAGTTACTTGGAATTCAGG - Intergenic
1050870210 9:10558407-10558429 TTGCTAAACACTAGGGATTCAGG - Intronic
1056050157 9:82759918-82759940 TTGCTACTGATGAAGAATTCAGG + Intergenic
1057076219 9:92139490-92139512 TTGCACCTTAGTAGGAACTCAGG - Intergenic
1057153085 9:92812124-92812146 TTGCTACATAACAGGTATTCAGG - Intergenic
1058460697 9:105179649-105179671 TTGCTATTTACTATTAATTAAGG + Intergenic
1058963421 9:110013852-110013874 TTGATTCTTACTAGAAATGCTGG + Intronic
1060365560 9:123008974-123008996 TAGCTACTTACTATTAATTAAGG - Intronic
1186421872 X:9433043-9433065 TGGCTACTTGCTTGGACTTCTGG - Intergenic
1188188251 X:27143423-27143445 TTGCTGCTTTCTAGTAATTATGG + Intergenic
1188863975 X:35291601-35291623 TTGCTAATTAATAGCAACTCTGG + Intergenic
1192470312 X:71392817-71392839 TGCCTACTTAAAAGGAATTCAGG + Intronic
1199538583 X:148931870-148931892 TTGCTACTTACATGTAATTGGGG + Intronic
1202274622 Y:23102908-23102930 ATTTTACTTCCTAGGAATTCAGG + Intergenic
1202291405 Y:23317778-23317800 ATTTTACTTCCTAGGAATTCAGG - Intergenic
1202427614 Y:24736644-24736666 ATTTTACTTCCTAGGAATTCAGG + Intergenic
1202443177 Y:24933450-24933472 ATTTTACTTCCTAGGAATTCAGG - Intergenic
1202584953 Y:26412890-26412912 CTGCTACATAATAGGTATTCAGG - Intergenic