ID: 1158256352

View in Genome Browser
Species Human (GRCh38)
Location 18:55553568-55553590
Sequence ATACATAAACACAGGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 290}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158256352_1158256357 0 Left 1158256352 18:55553568-55553590 CCCAACTCCCTGTGTTTATGTAT 0: 1
1: 0
2: 1
3: 14
4: 290
Right 1158256357 18:55553591-55553613 TTACTCTCTGTCTTTAGTTTGGG 0: 1
1: 0
2: 1
3: 36
4: 448
1158256352_1158256358 3 Left 1158256352 18:55553568-55553590 CCCAACTCCCTGTGTTTATGTAT 0: 1
1: 0
2: 1
3: 14
4: 290
Right 1158256358 18:55553594-55553616 CTCTCTGTCTTTAGTTTGGGTGG 0: 1
1: 0
2: 0
3: 33
4: 249
1158256352_1158256356 -1 Left 1158256352 18:55553568-55553590 CCCAACTCCCTGTGTTTATGTAT 0: 1
1: 0
2: 1
3: 14
4: 290
Right 1158256356 18:55553590-55553612 TTTACTCTCTGTCTTTAGTTTGG 0: 1
1: 0
2: 0
3: 29
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158256352 Original CRISPR ATACATAAACACAGGGAGTT GGG (reversed) Intronic
900075692 1:815274-815296 ACACACAAACACAGGAAGTACGG + Intergenic
900732279 1:4270009-4270031 ATACATAAACAAAGGGGTTTCGG + Intergenic
901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG + Intergenic
904434672 1:30486620-30486642 ATACAGTAACACTGGGGGTTAGG - Intergenic
905155064 1:35970716-35970738 ATAAATAAACAAAGGGAGGGAGG - Intronic
907196851 1:52694067-52694089 ACACATGGACACAGGGAGTGTGG + Intronic
907761017 1:57359976-57359998 ATACATAATCACAGTTAGATAGG + Intronic
907855829 1:58302582-58302604 ATACATGAACACAGGAAGCCTGG - Intronic
909267067 1:73573869-73573891 ATGCATAAACACCAGGAGATAGG + Intergenic
909302173 1:74027332-74027354 ATTCAAAGACACTGGGAGTTAGG - Intronic
909346427 1:74593043-74593065 ATACATGAACAAATGGAATTGGG - Intronic
909697245 1:78481568-78481590 AGACAAAAACACAGGGAGAAGGG + Intronic
910640345 1:89454084-89454106 ACACATACACACACAGAGTTTGG - Intergenic
912057193 1:105617594-105617616 ATACATAAATATACAGAGTTAGG - Intergenic
912080287 1:105927783-105927805 ATACACAATCACAGGGTGATGGG + Intergenic
912308233 1:108593175-108593197 ATACATAAATAAAAGGAGTTTGG + Intronic
912327299 1:108779662-108779684 ACATTTAAACACAGGGAATTTGG + Intronic
915256254 1:154632373-154632395 AGAAATAAACACAGAGATTTGGG + Intergenic
915342218 1:155182902-155182924 AAAAAAAAAAACAGGGAGTTGGG - Intronic
917044828 1:170847907-170847929 ATACATAAATACAGTTAGATAGG - Intergenic
919469076 1:197956684-197956706 ATACAGCCACACTGGGAGTTAGG - Intergenic
920270800 1:204762333-204762355 ATAAATAAACACAGTGTGTGGGG + Intergenic
920500718 1:206483323-206483345 ATACATCTCCACAGGGAGTCAGG - Intronic
922172069 1:223164019-223164041 ATACATACACACAGTGAGAGTGG + Intergenic
922259163 1:223920747-223920769 ATTCAAAAACTCAGGGTGTTCGG + Intergenic
922271535 1:224040151-224040173 ACACACAAACACAGGAAGTACGG + Intergenic
922710287 1:227824258-227824280 ACACATGGACACAGGGAGTGGGG - Intronic
1064361001 10:14664166-14664188 AAACATGAACACAGAGAGCTAGG - Intronic
1065306275 10:24372106-24372128 TTACAAAAACACCGGGGGTTTGG + Intronic
1066736146 10:38482117-38482139 ATTCAAAAACTCAGGGTGTTCGG - Intergenic
1068062693 10:52088932-52088954 TTACATAAACAAAGGGTGTATGG + Intronic
1068588507 10:58828236-58828258 ATACCTAAGCACAGGGATATTGG - Intronic
1068912994 10:62398767-62398789 ATACATACATACAGGCATTTGGG - Intronic
1070180896 10:74012739-74012761 AAACAAAAACCCAGTGAGTTTGG - Intronic
1070334420 10:75441417-75441439 ATACATAATAACATGGTGTTGGG - Intronic
1072366062 10:94711172-94711194 AGACATGAAGACAGAGAGTTTGG - Intronic
1074728639 10:116343643-116343665 TTACATGAACACAGTGAGCTTGG - Intronic
1075618878 10:123911121-123911143 ATTCATAGATACTGGGAGTTAGG + Intronic
1076021703 10:127078892-127078914 ATACTTAAAGACAGCGTGTTGGG + Intronic
1078475911 11:11629802-11629824 ATACCTAGACACAGTGGGTTTGG - Intergenic
1079256700 11:18837323-18837345 AGAAACAAACACAGGGAGTGGGG + Intergenic
1079456606 11:20641974-20641996 ATAAATAAACACTGGGACTTAGG + Intronic
1080234265 11:30050836-30050858 ATTCTGAAACACAGAGAGTTGGG - Intergenic
1080595532 11:33771186-33771208 AGTCATAAACAAAGGGACTTGGG + Intronic
1081008693 11:37781089-37781111 ATAAAGAAAAACAGGGAGTGTGG + Intergenic
1081327083 11:41758021-41758043 ATAAAGAAAAACAGGGAGGTTGG - Intergenic
1088096634 11:106108204-106108226 ATGCAGAAACACAGGGAGAGGGG - Intergenic
1088705805 11:112463674-112463696 ATACAAAATTACAGGGAGATAGG - Intergenic
1088762492 11:112945593-112945615 ATACATAAATCCAGAGAGCTAGG - Intergenic
1088842559 11:113639149-113639171 ATTCACAAACAGAGGGAATTTGG + Intergenic
1089126477 11:116180027-116180049 ATACAGTGACACTGGGAGTTAGG - Intergenic
1090602139 11:128383996-128384018 ATAGATAAACCCATGCAGTTAGG + Intergenic
1091479002 12:807384-807406 GTACATAAAAACAAAGAGTTAGG - Intronic
1091616950 12:2056890-2056912 ATACATACACACATGGAATAAGG + Intronic
1093886187 12:24464166-24464188 ATACATAAACACACATACTTAGG - Intergenic
1094126639 12:27030824-27030846 ATCCAGAAACAAAGAGAGTTTGG - Intronic
1094276440 12:28681435-28681457 ATGCATAAACACAGGCAAATGGG + Intergenic
1096814094 12:54190832-54190854 ATACATAGACACACAGAGATGGG - Intergenic
1098442610 12:70534398-70534420 ATACATAAGCATGGGGAATTTGG - Intronic
1098445369 12:70560967-70560989 AAACAGAAACACAGGCATTTTGG + Intronic
1099231819 12:80035453-80035475 ATACCATCACACAGGGAGTTAGG + Intergenic
1099333405 12:81321817-81321839 ATTCAGAAACACAGGAATTTTGG + Intronic
1100004085 12:89873354-89873376 TTACATAAACTCAGGCACTTTGG - Intergenic
1101558256 12:105831118-105831140 ATACAGACACACTGGGGGTTAGG - Intergenic
1102442016 12:112970730-112970752 AGACACAGACAGAGGGAGTTGGG + Exonic
1102574310 12:113846388-113846410 ATACTGAAGCACAGGGGGTTAGG - Intronic
1104890372 12:132136576-132136598 ACACACACACACAGTGAGTTTGG + Exonic
1106798579 13:33232858-33232880 ATACAGGAAAACAGGGAATTAGG - Intronic
1107271620 13:38625253-38625275 ACACAGAAACACAAGGAGTGAGG - Intergenic
1107854117 13:44597834-44597856 ATATATAAAGACAGAAAGTTTGG - Intergenic
1108846278 13:54681044-54681066 AAATATAAACCCAGGGAGTAAGG + Intergenic
1109682278 13:65768589-65768611 ATACATAGACAGAGGGAGAGGGG + Intergenic
1109838653 13:67893062-67893084 ACACATAGACACAGGGAGGGGGG + Intergenic
1110557299 13:76874814-76874836 ATACAGTAACATTGGGAGTTAGG + Intergenic
1110887468 13:80657022-80657044 AAACATAAACACAGTAAGGTAGG + Intergenic
1111161790 13:84404597-84404619 ATACATTAACATTGGGAGTTAGG - Intergenic
1112342372 13:98563306-98563328 AGAGATAAACACAGGCAGTTGGG + Intronic
1112424678 13:99287036-99287058 ATACATAAATACAGAGAGAATGG + Intronic
1113139480 13:107131057-107131079 ATTCTGAAATACAGGGAGTTAGG + Intergenic
1113635854 13:111918676-111918698 ATACACAAATACATGGAGATAGG + Intergenic
1114629574 14:24150527-24150549 CAACAGAAATACAGGGAGTTGGG - Intronic
1114817081 14:25971757-25971779 ATGCAAAAACACAGGGAAATAGG + Intergenic
1115108758 14:29794706-29794728 ATACATATACATAGGGAGCACGG - Intronic
1115518855 14:34212818-34212840 ATTCATAAACCCTGGGAGCTGGG + Intronic
1116180579 14:41527182-41527204 ACACATGGACACAGGGAGGTGGG + Intergenic
1118074392 14:62282503-62282525 ATACAGTAACAAAAGGAGTTAGG - Intergenic
1118179782 14:63480744-63480766 ATACATAAAAAAATGGAGTCTGG - Intronic
1118364256 14:65080902-65080924 ATACATGAAACCAGGGAATTAGG + Intronic
1118732047 14:68675216-68675238 AGTAACAAACACAGGGAGTTGGG + Intronic
1119086546 14:71744389-71744411 TTACATAAAGATAGGGAGTAAGG - Intergenic
1120602997 14:86536020-86536042 ATACATAAAAAGAGGGTATTAGG - Intergenic
1120735010 14:88042808-88042830 GTACATGGAAACAGGGAGTTTGG - Intergenic
1121750399 14:96349701-96349723 ATACAGAAACACAGGGAAGCAGG + Intronic
1122091292 14:99342701-99342723 ATACAAAATCACAGCTAGTTAGG - Intergenic
1124035737 15:26052321-26052343 ATAAGAAAACACAGTGAGTTAGG - Intergenic
1124475090 15:30026237-30026259 TTACCGAAACACCGGGAGTTTGG + Intergenic
1124513647 15:30348317-30348339 ATAAATAAATACAGGGGCTTTGG - Intergenic
1124729274 15:32182448-32182470 ATAAATAAATACAGGGGCTTTGG + Intergenic
1125461226 15:39908659-39908681 AGATATAGACACAGGGAGTAGGG - Intronic
1126409556 15:48357977-48357999 ATAGATAAACAGAGGAATTTGGG + Intergenic
1127068922 15:55268978-55269000 AGACATGAACACAGGGAGGATGG + Intronic
1127379158 15:58414604-58414626 ACACATAAACACACGGTCTTAGG + Intronic
1130478519 15:84341185-84341207 ACACATGGACACAGGGAGTGGGG - Intergenic
1130493251 15:84446946-84446968 ACACATGGACACAGGGAGTGGGG + Intergenic
1130623143 15:85484980-85485002 ATACTCAAACTCAGGGTGTTTGG + Intronic
1133030133 16:3006777-3006799 CAACATAAAAACAGGGAGATTGG - Intergenic
1134215689 16:12315489-12315511 ATACATTCACACTGGGGGTTAGG - Intronic
1138193690 16:55036585-55036607 CTCCACAAAGACAGGGAGTTTGG + Intergenic
1139364397 16:66425085-66425107 ATACATAGACACACAGAGATTGG + Intergenic
1141314635 16:82950284-82950306 AGACATAGACACAGGGAGACTGG - Intronic
1149236595 17:54598231-54598253 ACACAGAAACAGAGGGGGTTGGG + Intergenic
1150963742 17:69943546-69943568 ACACATACACACAGGGAGACTGG + Intergenic
1151361422 17:73591471-73591493 AAACACAAACACAGGATGTTCGG + Intronic
1152420084 17:80187984-80188006 ATACATCAAGAAAGGGAATTTGG - Intronic
1153388159 18:4523112-4523134 ATCCATCACCACAGGGAGGTGGG + Intergenic
1155393955 18:25366871-25366893 ACACATACACACAGAGAGATTGG + Intergenic
1155757637 18:29521230-29521252 ATATATAGACACAGGGAAATTGG + Intergenic
1156196919 18:34784837-34784859 ATGCATATACACACAGAGTTGGG - Intronic
1156620924 18:38850616-38850638 AGACATAAAGACAAGAAGTTAGG - Intergenic
1156804331 18:41159094-41159116 AAACATAAACACAAGGCCTTAGG + Intergenic
1156970093 18:43144007-43144029 ACACATAGACACCAGGAGTTGGG - Intergenic
1157887285 18:51381064-51381086 ATGCCTAAACACAGAGAGTATGG + Intergenic
1157933642 18:51850545-51850567 ATACATAAACACCAGGAGGCAGG - Intergenic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158256352 18:55553568-55553590 ATACATAAACACAGGGAGTTGGG - Intronic
1158399246 18:57105986-57106008 ATACAGTCACACTGGGAGTTAGG + Intergenic
1158598146 18:58834440-58834462 ATACATTCACATTGGGAGTTAGG - Intergenic
1160138213 18:76293395-76293417 ATAAATAAAGACAGGAATTTTGG - Intergenic
1163474109 19:17515143-17515165 ATAGATTAACACAGGGACCTTGG + Intronic
1165984554 19:39756708-39756730 ATACAAAAAAACAGAGAATTAGG - Intergenic
1166604931 19:44132950-44132972 ATACAGAAATACAGGCAGGTAGG - Exonic
1167761105 19:51449881-51449903 AGACATAGATACTGGGAGTTAGG + Intergenic
925702264 2:6650629-6650651 ATTCATTAACACAGAGGGTTAGG + Intergenic
926310938 2:11675840-11675862 ATACAGTCACACTGGGAGTTTGG - Intergenic
926326262 2:11786802-11786824 ATACGTTCACACAGGGAGTAGGG - Intronic
928223883 2:29430835-29430857 GTCCAAAAACACAGGGTGTTAGG - Intronic
929949682 2:46397493-46397515 AAAAAGAAACACAGGGAGGTTGG + Intergenic
930334624 2:50029405-50029427 ATACAAACTCACTGGGAGTTAGG - Intronic
931569178 2:63650248-63650270 AGTCATAAACTCAGGGAGTGGGG - Intronic
931848140 2:66225675-66225697 ACACATAGACAGTGGGAGTTGGG - Intergenic
932196622 2:69789531-69789553 AGACACACACACAGTGAGTTTGG + Intronic
932979205 2:76643193-76643215 ATACATATAAACAGTGAGGTTGG - Intergenic
933219165 2:79668920-79668942 ATAAATAATCACATGCAGTTTGG + Intronic
933509196 2:83218489-83218511 ATTAATAAAAACAGGTAGTTTGG - Intergenic
934064340 2:88326369-88326391 ATACAGCTACACTGGGAGTTAGG - Intergenic
935014200 2:99164478-99164500 ACTCATAAACAGAGGGAGCTGGG - Intronic
936505478 2:113102386-113102408 ATACAGCCACACTGGGAGTTAGG + Intergenic
937525137 2:122759273-122759295 ATACAGCCACACTGGGAGTTAGG + Intergenic
939090873 2:137778956-137778978 AAACAGAAACAAAGAGAGTTTGG - Intergenic
939431943 2:142120812-142120834 ATAGGCAAACACAGGGTGTTAGG + Intronic
940127989 2:150348696-150348718 ATACACACACACACGGAGTGGGG + Intergenic
941513827 2:166446828-166446850 ACACATGGACACAGGGAGGTGGG + Intronic
941604073 2:167574932-167574954 GTACATAAGCACAGGATGTTAGG - Intergenic
942034872 2:172001011-172001033 AAACAAAAACCCAGTGAGTTAGG + Intronic
942114893 2:172718786-172718808 ATAAATAAAGACAGGGACTCTGG - Intergenic
942992893 2:182223015-182223037 ATACAGACACACTGAGAGTTAGG - Intronic
943504246 2:188733236-188733258 ATACATATACACACACAGTTGGG - Intergenic
944891403 2:204120760-204120782 GTACAAAAACCCAGGGTGTTTGG - Intergenic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
946797338 2:223369802-223369824 AAAGATAAACACAGGGATTATGG - Intergenic
1169205115 20:3735179-3735201 ATTGATAAAAGCAGGGAGTTGGG - Intronic
1169809836 20:9598145-9598167 AAACATGGACACAGGGAGATAGG - Intronic
1170274693 20:14571859-14571881 ATACATAAAGACAAGGTATTAGG - Intronic
1174847050 20:53952545-53952567 TTACATAGACACTGGGAGTAAGG - Intronic
1174911167 20:54608969-54608991 ATGAAGAAACAGAGGGAGTTTGG - Intronic
1175256617 20:57651911-57651933 ATATTTATACACAGGGAGGTGGG + Exonic
1175336479 20:58199442-58199464 ACACATAAAAACAGGATGTTGGG + Intergenic
1176232595 20:64039745-64039767 ATACATTAACACAGAGTGTGGGG - Intronic
1177072740 21:16531167-16531189 ATACTTAAAAACAGAGACTTAGG - Intergenic
1177728339 21:24995790-24995812 ACACACAGACACAGTGAGTTCGG - Intergenic
1177827911 21:26104435-26104457 ATACATAAGCACAAAGAATTTGG + Intronic
1178716703 21:34971105-34971127 ATACATAATCCCAGGCATTTTGG - Intronic
1178855570 21:36247425-36247447 ATATATAAACACAGGAACTAGGG - Intronic
1179432075 21:41328703-41328725 ATAAATTAAAACAGGGAGTGGGG + Intronic
1181147805 22:20861071-20861093 ATACATGAACAGAGAGAGGTGGG - Intronic
1181147859 22:20861409-20861431 ACAGTTAAACACAGGGAGGTGGG - Intronic
1182609379 22:31534061-31534083 ATACACAAAGAGAGGGAGATGGG - Intronic
1185022770 22:48389747-48389769 ATACAGACACATTGGGAGTTGGG - Intergenic
949357650 3:3198815-3198837 ATACAGAGCCACAGGGGGTTGGG + Intergenic
949631616 3:5934337-5934359 AGACACAAACACAGAGAGATAGG - Intergenic
951217423 3:20038932-20038954 ATATATAAACATTGGGAGGTGGG - Intergenic
955873646 3:63466867-63466889 ATACAGACACACTGGGGGTTGGG + Intronic
957515117 3:81240279-81240301 ATACACAACTAGAGGGAGTTAGG + Intergenic
957796176 3:85010830-85010852 AGACATAAACAGAGTGATTTGGG - Intronic
958587769 3:96113343-96113365 ATATATAAAAACAGAGACTTGGG - Intergenic
959396092 3:105840278-105840300 ATACATAAACAGAGTGAGAAAGG + Intronic
959429945 3:106241004-106241026 TTATATAAACACAGAGAATTAGG + Intergenic
960569471 3:119171419-119171441 ATGAACATACACAGGGAGTTGGG + Intronic
961334832 3:126167351-126167373 ATACTTCAACACAGAAAGTTAGG - Intronic
962360126 3:134733605-134733627 AGACACAGACACAGGGAGTGGGG + Intronic
962625817 3:137224831-137224853 ATTCATAGACACTGGGGGTTAGG + Intergenic
963524526 3:146400773-146400795 ATATATACACACACGGAGCTAGG - Intronic
965441676 3:168722406-168722428 ATACATCACCACATGGAGCTAGG + Intergenic
966159208 3:176950291-176950313 AAACATAAACACATGAATTTGGG + Intergenic
967275551 3:187770720-187770742 ATACTTACCCGCAGGGAGTTAGG + Intergenic
970243806 4:14037363-14037385 ATAAATAAATATAGGGAGCTGGG + Intergenic
970564734 4:17320705-17320727 AAACAAAAGAACAGGGAGTTTGG - Intergenic
971131312 4:23813977-23813999 ATTTATAAACATAGGTAGTTTGG + Exonic
971305931 4:25481573-25481595 ATACAACTACACTGGGAGTTAGG + Intergenic
972525180 4:39903028-39903050 ATTCCTAAACACAGGGTGCTAGG + Intronic
973252599 4:48075876-48075898 AAATATAATCACAGGGAATTTGG - Intronic
974405141 4:61457814-61457836 ATACAAAAACACAAGGCCTTCGG - Intronic
974430072 4:61785113-61785135 ATAAATAAATAAAGGGGGTTAGG + Intronic
974543091 4:63265080-63265102 ATACTTAAAAATGGGGAGTTAGG + Intergenic
976542150 4:86290604-86290626 ATACATAAACACAGGGTTTTGGG + Intronic
977381289 4:96277648-96277670 ATACATAAACATGGGGAATATGG - Intergenic
978164633 4:105592121-105592143 ATACATAGACACAGTGGGCTAGG - Intronic
978606094 4:110481418-110481440 ATCCATAGTCACAGAGAGTTGGG - Intronic
979098077 4:116576028-116576050 ATACTTTCACACTGGGAGTTAGG - Intergenic
979218061 4:118189946-118189968 TTACATAAACCTAGGAAGTTGGG - Intronic
979262499 4:118665075-118665097 ATTCAAAAACTCAGGAAGTTCGG - Intergenic
979965661 4:127073913-127073935 ATACTAAACCAAAGGGAGTTGGG - Intergenic
980738874 4:136925563-136925585 ATACACACACACAGTGATTTTGG - Intergenic
982970023 4:161973520-161973542 ATACATAAATACAGTTATTTAGG - Intronic
983329833 4:166311397-166311419 AGCCATAAACACAAGGTGTTTGG - Intergenic
985036288 4:185843080-185843102 ATGCAATAACACAGGGAGTGTGG + Intronic
985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG + Intergenic
985953698 5:3244060-3244082 AAACAAAAAGAAAGGGAGTTGGG - Intergenic
986434889 5:7719787-7719809 ATACAGCCACACTGGGAGTTAGG + Intronic
987389100 5:17359257-17359279 ATACATGAACACAGGGGTGTGGG + Intergenic
987736171 5:21846367-21846389 ATGCAGACACACAGGGAGTGAGG - Intronic
987754959 5:22088559-22088581 ATGCAACAACACTGGGAGTTGGG - Intronic
987867635 5:23566433-23566455 AAACATATACACAATGAGTTTGG - Intergenic
988446322 5:31289929-31289951 GCAAATAAACACAGGGATTTTGG - Intronic
989167275 5:38444351-38444373 ATACAAAATTACAGGGAGATAGG + Intronic
989433253 5:41380195-41380217 AAACAAAGACACAGGGACTTGGG - Intronic
991577516 5:68120522-68120544 ATAAATAAACAAAAGGAGATGGG - Intergenic
992659653 5:78945768-78945790 ATAAATAAAGACAGGGAGGTTGG - Intronic
992779021 5:80111490-80111512 AGACAAAAACACAGGGGCTTAGG + Intergenic
993301012 5:86210167-86210189 TAATAAAAACACAGGGAGTTTGG + Intergenic
993964130 5:94339700-94339722 ATACATCAACTCAGTCAGTTTGG + Intronic
995945688 5:117642882-117642904 ATGCATAGATACAGGGAGTTTGG + Intergenic
996491440 5:124102642-124102664 ATACATAAACAAATGGAGTGTGG + Intergenic
996683562 5:126255362-126255384 ACACATACACACAGGGAGGGAGG - Intergenic
996776081 5:127134240-127134262 ACACATAAACACAAGAAATTTGG - Intergenic
997046383 5:130323957-130323979 ATCCATAAACACAGGCTGTTCGG - Intergenic
997111651 5:131081607-131081629 GCACATAAGCACAAGGAGTTTGG + Intergenic
1000024818 5:157349079-157349101 ATACATAAAGTGAGGGAATTTGG - Intronic
1001063726 5:168517971-168517993 ATATATAATCACAGAGAGTGTGG - Exonic
1002119828 5:176994108-176994130 ACACATAAACACTGGGAGGCTGG + Intronic
1002300733 5:178256057-178256079 ATACATAAAGAAAGGAATTTAGG + Intronic
1003718116 6:8669810-8669832 ACACATAAACACAATTAGTTGGG - Intergenic
1004932947 6:20479398-20479420 ACAAATAAACACAGAGTGTTTGG + Intronic
1005234487 6:23744052-23744074 ATACCATAACACTGGGAGTTAGG - Intergenic
1006106310 6:31719027-31719049 ATACAGAGACACAGGGAGAGAGG + Exonic
1008295343 6:49769079-49769101 ACACACACACACAGGCAGTTGGG + Intergenic
1008934402 6:56974513-56974535 ATACATAAACACATTAAGTGTGG - Intronic
1009321569 6:62296697-62296719 ATACTCAAACACAGGTGGTTGGG + Intergenic
1011377789 6:86708361-86708383 ATACATAATTACAGGTAGATAGG - Intergenic
1012365209 6:98430477-98430499 ATATAGAAGAACAGGGAGTTAGG + Intergenic
1013448230 6:110252488-110252510 ATACAGTCACACTGGGAGTTAGG + Intronic
1013942786 6:115685045-115685067 ACACATGAACACAGGGAACTTGG - Intergenic
1015344347 6:132138341-132138363 AGACTTAAACATAGGGAATTAGG + Intergenic
1015890968 6:137969561-137969583 ATACAGACAGACAGGGAGGTGGG + Intergenic
1016167217 6:140961569-140961591 ATATATAATCACATGTAGTTGGG + Intergenic
1022305801 7:29145821-29145843 ATACAGAAACAAAAGGACTTTGG - Intronic
1023324555 7:39039005-39039027 ATATATAAATACATGGATTTAGG + Intronic
1024516518 7:50263876-50263898 AGACATAATCACAGGCAGTTAGG + Intergenic
1024616900 7:51123300-51123322 ATACATAAACTCAAGAAGTCTGG - Intronic
1024746063 7:52407810-52407832 ATACAGCCACACAGGGAGTTAGG + Intergenic
1024774383 7:52765463-52765485 ATACAATCACACTGGGAGTTAGG - Intergenic
1026576025 7:71572240-71572262 ATATATAATCCCAGGGACTTCGG + Intronic
1026933260 7:74236982-74237004 ATAAACAAACACAGTGATTTAGG + Intronic
1027507593 7:79037127-79037149 TTACATAAACGAAGGGAGTGAGG - Intronic
1028342667 7:89741484-89741506 AGACTTAAATACAGGCAGTTTGG - Intergenic
1028476633 7:91260957-91260979 ACACAGACACACAGGCAGTTAGG - Intergenic
1029876190 7:103755008-103755030 ATAGATGAACTCAGGGATTTTGG + Intronic
1033272898 7:139948430-139948452 ATACAGCTACACTGGGAGTTGGG + Intronic
1034017841 7:147606713-147606735 AGACATAAACATAGGTTGTTAGG + Intronic
1034266709 7:149784631-149784653 AGTCATCAGCACAGGGAGTTGGG - Intergenic
1034397085 7:150835334-150835356 ATACATAATTACAGCTAGTTAGG + Intronic
1037152340 8:15652855-15652877 CTAAATGAAGACAGGGAGTTGGG + Intronic
1038318130 8:26504792-26504814 ATACAAAAACACATGAAATTAGG + Exonic
1038373850 8:27018289-27018311 ATACAGTCACACTGGGAGTTAGG + Intergenic
1038536588 8:28357807-28357829 ATAGACAAACACAGAGAGGTGGG + Intronic
1040518635 8:48155103-48155125 AAACAGAAACACAAGGAGTTAGG + Intergenic
1041811682 8:61918194-61918216 TTGGATAAACACAGGGACTTAGG + Intergenic
1042359850 8:67870070-67870092 ATACATCAACCCTGGGGGTTGGG + Intergenic
1042511611 8:69618136-69618158 TTAATTAAACACAGGAAGTTAGG - Intronic
1043217749 8:77616770-77616792 ATACATACACACAAAGTGTTAGG - Intergenic
1044435081 8:92152099-92152121 AGAAATAAACACAAGGATTTTGG - Intergenic
1045613894 8:103883437-103883459 ACACAGAAACATAGGGTGTTGGG + Intronic
1046872475 8:119218780-119218802 ATAGATAAACATAATGAGTTAGG - Intronic
1046987389 8:120403440-120403462 ATACATGGACACATGGGGTTGGG + Intronic
1047040474 8:120989201-120989223 ACACATAAACAGAGGGATTATGG + Intergenic
1047144899 8:122187268-122187290 ATAGATAAAACCAGTGAGTTGGG + Intergenic
1050080559 9:1911359-1911381 AAACTGAAACACAGGAAGTTTGG + Intergenic
1050672282 9:8011015-8011037 ATACAGACAGACAGGGAGGTGGG - Intergenic
1050783938 9:9375064-9375086 ACACATACACACACAGAGTTTGG - Intronic
1051932167 9:22399261-22399283 ATACATGAACAAAGGCATTTTGG - Intergenic
1052461289 9:28767042-28767064 ATACATAAAAACAGATAGTATGG + Intergenic
1053348126 9:37393103-37393125 ATAAATACACAGAGGGACTTGGG - Intergenic
1053407375 9:37889069-37889091 CCACATAAACAAAGGGTGTTTGG + Intronic
1054733256 9:68722899-68722921 ATACAAAAACACAGATAGATGGG - Intronic
1054909001 9:70436774-70436796 ATAAATAAACACATGGGATTGGG - Intergenic
1054923137 9:70561734-70561756 ATCCATGAACAAAGGGAGTTGGG + Intronic
1058458087 9:105156981-105157003 ATACATAAAAATAAGAAGTTTGG + Intergenic
1062293897 9:135813454-135813476 ATATTTAAACACAGTGAGTAGGG - Intronic
1186164966 X:6817879-6817901 AAACAAAAAAACAGGGACTTGGG - Intergenic
1187232230 X:17434191-17434213 ACACCTAGTCACAGGGAGTTTGG + Intronic
1187746864 X:22418779-22418801 ACACACACACACAGAGAGTTGGG + Intergenic
1188249621 X:27876552-27876574 ATACATCAGCACAGGGAAATTGG + Intergenic
1188612567 X:32118269-32118291 ATCCAGAAACACAGGGTTTTGGG - Intronic
1189553480 X:42117290-42117312 ATATATATCCACAGGGGGTTGGG - Intergenic
1198910365 X:141606913-141606935 CCACAGAAACACAGGTAGTTGGG + Intronic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic