ID: 1158257362

View in Genome Browser
Species Human (GRCh38)
Location 18:55566974-55566996
Sequence GTAGATCTACTAGAAAAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158257359_1158257362 0 Left 1158257359 18:55566951-55566973 CCAAAAAACAGTCAGGGAAAAGG 0: 1
1: 0
2: 0
3: 39
4: 452
Right 1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG 0: 1
1: 0
2: 4
3: 20
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158257362 Original CRISPR GTAGATCTACTAGAAAAGAA TGG Intronic
901379405 1:8862940-8862962 CTTGATCTAGGAGAAAAGAAAGG + Exonic
905518243 1:38578013-38578035 GTAGATCTAGGAGAATAGAAGGG - Intergenic
908290297 1:62659031-62659053 GCAGATCTATTCTAAAAGAATGG + Intronic
908473535 1:64468234-64468256 GTATATCTACTAGAGAAGTCAGG + Intergenic
908866866 1:68557725-68557747 GTAGATGTACTAGAAAAAAAAGG - Intergenic
909393792 1:75146540-75146562 GGAGATCTACCAGAAAAGTCAGG - Intronic
909916611 1:81327292-81327314 GCAGATCTCCTAGAAGATAAAGG - Intronic
910443040 1:87272655-87272677 ATATATCTTCTAGAAAAGCAAGG + Intergenic
911109381 1:94166220-94166242 GGGCATCTACTGGAAAAGAATGG - Intronic
913354382 1:117902111-117902133 ATAGTTCTGCTAGAAAAGAGAGG - Intronic
916290421 1:163159589-163159611 GTAGCCCAACTAAAAAAGAAGGG - Intronic
917233788 1:172867521-172867543 GTACATCTACAAGAAAACCAGGG + Intergenic
918490492 1:185076237-185076259 AAAGATCTAGAAGAAAAGAAGGG - Intronic
919132421 1:193468224-193468246 GTTGGTCTACTAGTACAGAAAGG - Intergenic
923480884 1:234382333-234382355 GTAGATCTTCTAGACAAAAGTGG + Intronic
1065850851 10:29786819-29786841 GCAGAGGTACTTGAAAAGAATGG + Intergenic
1068452485 10:57210482-57210504 TTTGATCTAATGGAAAAGAAAGG + Intergenic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1071945574 10:90640219-90640241 GCAGACCTACTGTAAAAGAATGG + Intergenic
1072170148 10:92851133-92851155 ACACCTCTACTAGAAAAGAATGG + Intronic
1073131061 10:101189614-101189636 GTAGCTGGACCAGAAAAGAAGGG - Intergenic
1073198399 10:101714467-101714489 GTAAAACTACTAGAAAAAAATGG - Intergenic
1073387730 10:103141108-103141130 GAAGATCTAAAAGAAAACAAAGG - Intronic
1076102406 10:127793662-127793684 GTAGATACAGTAAAAAAGAAGGG - Intergenic
1076537901 10:131194555-131194577 GAAGCTCCACTAGAAAATAATGG - Intronic
1081686964 11:45049581-45049603 GTACATCTTGTAGAAAAGGAGGG + Intergenic
1081924966 11:46818443-46818465 GAAGATCTTCCAGAAAATAAAGG - Exonic
1082189795 11:49229132-49229154 GTAGATATATTAAAGAAGAAGGG + Intergenic
1086831383 11:91569370-91569392 ATAGTACTACTATAAAAGAATGG - Intergenic
1087076935 11:94134266-94134288 GTAGATGTGTTAGAAATGAAGGG - Intronic
1087165770 11:95000715-95000737 GTAAAACTACTAGAAGAAAACGG + Intergenic
1088880329 11:113968689-113968711 AAAGAACTTCTAGAAAAGAAGGG - Intergenic
1091117980 11:133032316-133032338 GTACATCTACCAGCACAGAACGG + Intronic
1091530112 12:1346536-1346558 GTTGTTCTCCTAGAAATGAAAGG - Intronic
1092452983 12:8620360-8620382 GTAAAACTACTAGAAGAAAATGG - Intergenic
1092656452 12:10689942-10689964 GTAGGTCTAGAAGAAAATAAGGG + Intergenic
1092935017 12:13353062-13353084 GTAGTTCTACTAGCAAGGACCGG - Intergenic
1093418284 12:18945763-18945785 ATAAATCTATGAGAAAAGAAGGG - Intergenic
1095532407 12:43203802-43203824 AAAGTTCTACTAGAAAAGATAGG + Intergenic
1096209308 12:49750981-49751003 TTAAATCTACCAGAAAAGGAGGG - Intronic
1103453636 12:121047786-121047808 GCAGAGAAACTAGAAAAGAAGGG + Intergenic
1103473004 12:121196919-121196941 CCAGATCTGTTAGAAAAGAAGGG + Intergenic
1103473242 12:121198942-121198964 ACAGATCTGTTAGAAAAGAAGGG - Intergenic
1104363548 12:128155891-128155913 GTAGATCTCCCACAAAACAAAGG + Intergenic
1104875100 12:132028348-132028370 GTACATCCACGAGACAAGAAGGG - Intronic
1106239379 13:27898110-27898132 GCAGATCTACCTTAAAAGAATGG - Intergenic
1108032480 13:46249215-46249237 GTAAAGCCACTAGAAAAAAAGGG + Intronic
1109319428 13:60791658-60791680 GGAAATATACCAGAAAAGAAAGG - Intergenic
1110054491 13:70948920-70948942 TTAAAACTACTAAAAAAGAATGG + Intergenic
1110399205 13:75070076-75070098 GTAGATATTCCAGAAAAGTAGGG - Intergenic
1111343287 13:86915567-86915589 CTACATGTACTAGAAAATAATGG - Intergenic
1111473236 13:88713619-88713641 GTAGATATACTAAAGAACAAAGG + Intergenic
1111919000 13:94391017-94391039 GCAGGTCTACTAAGAAAGAATGG + Intronic
1112712428 13:102145298-102145320 TAAGTTCTACTAGAAAAGGAGGG + Intronic
1113306128 13:109080664-109080686 GTAGATCATCAATAAAAGAATGG - Intronic
1115907449 14:38215676-38215698 TGATATCAACTAGAAAAGAAGGG + Intergenic
1116593190 14:46806834-46806856 TTAGATATTCTAGAAAAGGAGGG + Intergenic
1118081450 14:62366326-62366348 GTACATCCACTTGTAAAGAAAGG - Intergenic
1120939951 14:89938229-89938251 CTAGATTTAGTAGAAAGGAAGGG + Intronic
1122225789 14:100278076-100278098 GTAGATTTTCTTTAAAAGAATGG + Exonic
1123111577 14:105870696-105870718 GTGTATATACTACAAAAGAAAGG - Intergenic
1124920550 15:34022138-34022160 GCAGTTCAGCTAGAAAAGAAGGG - Intronic
1125454848 15:39846761-39846783 GCAGACCTACTCTAAAAGAAAGG + Intronic
1126553675 15:49962583-49962605 ATAGATCTAATAGAAAATAAGGG + Intronic
1127201005 15:56650784-56650806 GTAGATATACAAGAAAACAGAGG + Intronic
1128005613 15:64237566-64237588 GAAGATATACTAGAAAAAATGGG - Intronic
1128040970 15:64572965-64572987 GTAGTTCGGCTAGAAAAGCATGG + Intronic
1128596398 15:68955525-68955547 GAAGATCTACACTAAAAGAATGG - Intronic
1129535300 15:76309618-76309640 GTAGAGCTAACAGAAAAAAATGG - Intronic
1133654089 16:7842857-7842879 GTAGATTTGTTAGAAAAAAATGG - Intergenic
1138474613 16:57263440-57263462 GTAGCTCTACAAGATAGGAATGG - Intronic
1140174548 16:72643672-72643694 GTAGTTCTACTACAAAAGGTAGG - Intergenic
1140323681 16:73978886-73978908 GTAGATTTACAAAAAAGGAAAGG - Intergenic
1141010591 16:80394074-80394096 TTAAATCTAGAAGAAAAGAAAGG + Intergenic
1142335655 16:89488448-89488470 GTAGTTAAACTAGAAAAAAAGGG - Intronic
1143318299 17:6049765-6049787 GTAGATGTAGCAGAAAATAAGGG + Intronic
1144275061 17:13658663-13658685 CTAGAGCCACTAGAAAATAAGGG + Intergenic
1144388311 17:14770545-14770567 GTAGATCAACAGGTAAAGAAAGG - Intergenic
1145887360 17:28391836-28391858 GTAAATCTACTAGATATGTATGG - Intronic
1146102870 17:30002730-30002752 GTAGATCTGCTGTAAAAGAATGG - Intronic
1146422711 17:32703638-32703660 ATATATCTACCAAAAAAGAAAGG + Intronic
1146967078 17:37041303-37041325 GCAGCACTACTTGAAAAGAAAGG - Intronic
1156032729 18:32731691-32731713 GTAGATCTCATAGAACAGGATGG - Intronic
1156396441 18:36704074-36704096 GAAGAAGTAATAGAAAAGAAGGG - Intronic
1157984115 18:52418030-52418052 GAAGATCTAAAAGAAAACAATGG + Intronic
1158257362 18:55566974-55566996 GTAGATCTACTAGAAAAGAATGG + Intronic
1158922342 18:62207035-62207057 GTAAATATACTAAAAATGAATGG - Intronic
1159476710 18:68930095-68930117 GAAGATCTACAAGGAAACAAAGG + Intronic
1159979342 18:74757645-74757667 GTACATCAACTAGAAATAAAAGG - Intronic
1160038887 18:75326004-75326026 GCAGACCTACTCAAAAAGAATGG + Intergenic
1168541547 19:57215907-57215929 GTATAGCTGCTTGAAAAGAATGG + Exonic
1168698955 19:58423935-58423957 GTAAAACTACTAGAAAAACAAGG + Intergenic
926821342 2:16854844-16854866 GTAGACAGACTGGAAAAGAAGGG - Intergenic
927674834 2:25097777-25097799 GTAAATCCCCTAGAAACGAAGGG + Intronic
930946385 2:57081853-57081875 GTAGACCTACCATAAAATAATGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932873790 2:75429907-75429929 ATAAAACTTCTAGAAAAGAAAGG - Intergenic
935504738 2:103886368-103886390 CTAGATTTTCAAGAAAAGAAAGG + Intergenic
935963709 2:108451605-108451627 GTACATATACTAAAAAAAAAAGG - Intronic
936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG + Intergenic
940616272 2:156052685-156052707 GCATATATACTAGTAAAGAATGG - Intergenic
940701955 2:157056490-157056512 GTTCATCTACTATAAAAAAAGGG + Intergenic
941958008 2:171224050-171224072 ATAAAACTACTAGAAAAAAATGG - Intronic
942462342 2:176177210-176177232 GTAGCTGGAGTAGAAAAGAAGGG - Intergenic
942684132 2:178512913-178512935 GAATATATACTAGAAAAGAATGG - Exonic
942982891 2:182103646-182103668 GTAAATCTGATAGAAAAGCAGGG + Intronic
944630557 2:201619469-201619491 GTAAATCTTCTAGAAAGAAATGG - Intergenic
945282751 2:208051291-208051313 GTAGTTATACTGAAAAAGAAGGG + Intergenic
946300037 2:218817443-218817465 GTAGATCTACTACACAGGAGGGG - Intergenic
947133191 2:226951070-226951092 GTAAACCTACTAGAAGAAAATGG - Intronic
947522675 2:230860572-230860594 GGGGATTTACTGGAAAAGAATGG + Intergenic
1170045318 20:12079274-12079296 GTAGATATAAGAGAAAAAAATGG - Intergenic
1173928633 20:46799825-46799847 GCAGATCAAGTAGAGAAGAAGGG + Intergenic
1175405741 20:58725494-58725516 GTAGACCTACTCTAAAAGAAAGG + Intergenic
1177268707 21:18817644-18817666 GTACATCTTTTAGAAAAAAATGG + Intergenic
1177994903 21:28084940-28084962 GTAGATCCTGTATAAAAGAATGG - Intergenic
1180573887 22:16754532-16754554 GCAGATCAACAAGGAAAGAAAGG - Intergenic
1183795438 22:40113331-40113353 GTAGATCTGCTAGAAACAGATGG - Intronic
949138037 3:594891-594913 TTAGATCAGCTAGAATAGAAAGG - Intergenic
949351467 3:3127904-3127926 GCAGATAAACTAGGAAAGAAAGG + Intronic
949707766 3:6838609-6838631 GCAGATTTATTAGAAAAGACAGG - Intronic
949914578 3:8949613-8949635 GTAGATCCAGCAGAAAAGCAGGG + Intronic
951874846 3:27411855-27411877 TCAGTTCTCCTAGAAAAGAATGG + Intronic
952897928 3:38091092-38091114 GTAAAACTACTAGAAGAAAATGG + Intronic
953149044 3:40307700-40307722 GTACATCTACTAAGAAAGAAAGG + Intergenic
954506483 3:51080763-51080785 GTAAATCTACTTGAGAAAAATGG + Intronic
954668192 3:52271460-52271482 GTACATCTACTTGGGAAGAAAGG + Intronic
955137238 3:56231840-56231862 ATAGATCCCCTAGATAAGAAAGG + Intronic
955640867 3:61082557-61082579 GTATATCTAGTAGAAGTGAAAGG + Intronic
955727125 3:61944962-61944984 GTGGCTCTGCTGGAAAAGAACGG + Intronic
956305812 3:67823988-67824010 GCAGACCTACTCTAAAAGAATGG - Intergenic
956492059 3:69783370-69783392 GTTGAACAAATAGAAAAGAAAGG + Intronic
957869993 3:86079358-86079380 GTATATATTCTATAAAAGAAGGG - Intergenic
958833145 3:99114110-99114132 GGAGATCTTTTAGAAAATAAAGG + Intergenic
958875616 3:99613374-99613396 ATAGATATACAAGAAAAGAATGG + Intergenic
959245486 3:103862665-103862687 AGAGATCTAGGAGAAAAGAATGG + Intergenic
960437290 3:117643197-117643219 GTAGATCTACCCTAAAATAATGG - Intergenic
960984607 3:123267732-123267754 GCAGATCTACCATAAAAGAATGG - Intronic
962108780 3:132420193-132420215 CTGGGTCTACTAGAAAAGACTGG + Intronic
963691068 3:148503707-148503729 GAAAATCTACTAAAAAAAAAAGG - Intergenic
963713075 3:148769823-148769845 GCAGACCTACTTGAAAAGAATGG + Intergenic
964825427 3:160821776-160821798 AAAGTTCTACTAGAAAATAATGG - Intronic
964830257 3:160876634-160876656 ATTGATTTACTAGAAAACAATGG + Intronic
965093797 3:164195886-164195908 GAAGATCTATTAAAAAAAAAAGG + Intergenic
965410411 3:168323245-168323267 GTAGCTGTAATAGAATAGAAAGG + Intergenic
966839281 3:184075697-184075719 TTAGAGATACTAGACAAGAAAGG + Intergenic
967968105 3:194978423-194978445 ATAGATCACCTACAAAAGAATGG + Intergenic
970726294 4:19049096-19049118 GTAAATGTACTAGAAGTGAATGG + Intergenic
971529567 4:27669176-27669198 GTAGAACTAATGGATAAGAAGGG + Intergenic
971894618 4:32576175-32576197 ATAAAGCTACTAGAAAAAAATGG + Intergenic
971959265 4:33464038-33464060 GTAGCTCTACTATAAGAAAATGG + Intergenic
973046565 4:45541324-45541346 GGAGGTCTAGAAGAAAAGAATGG + Intergenic
973794683 4:54412486-54412508 GCAGACCTACTATAAAATAATGG - Intergenic
974651085 4:64755039-64755061 AGAGACCTACTAGAAAAGAATGG + Intergenic
976697545 4:87934219-87934241 GTGGATATCCTAGAAAAAAATGG - Intergenic
977129941 4:93223182-93223204 CTAGATAGACTACAAAAGAATGG - Intronic
977147907 4:93469133-93469155 GAAGATTTATCAGAAAAGAATGG - Intronic
977279074 4:95016599-95016621 GTAGAGATAAGAGAAAAGAATGG + Intronic
977874104 4:102129170-102129192 GGAGACCTAGGAGAAAAGAATGG + Intergenic
978671645 4:111254937-111254959 TTAGATCTGGTAGGAAAGAAAGG - Intergenic
978720739 4:111905928-111905950 GTAAATCTAGTAGAAAACATTGG + Intergenic
980256485 4:130386647-130386669 GTAAATGCTCTAGAAAAGAAAGG + Intergenic
980547317 4:134283903-134283925 GTAAATCAGCTAGAAAACAATGG - Intergenic
980899356 4:138889827-138889849 AAAGACCTACTGGAAAAGAAGGG - Intergenic
984296883 4:177863504-177863526 GTAATTCTATAAGAAAAGAAAGG - Intronic
988204918 5:28121948-28121970 TGTGGTCTACTAGAAAAGAAAGG + Intergenic
988663080 5:33294850-33294872 ATAGATCTACTAAAAAAGAATGG + Intergenic
988720082 5:33869105-33869127 AGAGATCTAGGAGAAAAGAATGG + Intronic
989815270 5:45729112-45729134 TTAGATCCACTAGAGAAGTAAGG + Intergenic
990171550 5:53056095-53056117 GCAGCTCTACTAGAAAAGGCTGG + Exonic
990856865 5:60278093-60278115 GGAGATCTGCTGTAAAAGAATGG - Intronic
991234926 5:64382735-64382757 GTAGATCTTTGAGAAAAGACAGG + Intergenic
991499651 5:67264302-67264324 GCAGAGCAAGTAGAAAAGAAAGG - Intergenic
992840985 5:80694637-80694659 GCAGAGCTACTCTAAAAGAATGG - Intronic
993736503 5:91482939-91482961 GCAGTTCTACTAGAAAGGACAGG - Intergenic
994030941 5:95142003-95142025 GAAGAGCTACTACAAATGAAAGG + Intronic
994619248 5:102143568-102143590 GTAGATATATTAGTAAATAAAGG + Intergenic
995865971 5:116691372-116691394 GTATATATACTAAAATAGAATGG - Intergenic
995912514 5:117204516-117204538 GTTGTTCTACCAGAAAGGAAAGG - Intergenic
998623544 5:143820798-143820820 GAGGATCTAATAAAAAAGAAAGG - Intergenic
1003437770 6:6109597-6109619 GTACATCAATCAGAAAAGAAAGG - Intergenic
1005130883 6:22506525-22506547 GTACCTCTATTAGGAAAGAACGG - Intergenic
1005338247 6:24818815-24818837 GTAGATCTAGGAGAACATAAGGG - Intronic
1007135570 6:39518197-39518219 CTAGATGTACTAGAAAAGCATGG + Intronic
1008307415 6:49920106-49920128 GAATATTTATTAGAAAAGAAAGG + Intergenic
1009605328 6:65859654-65859676 ATAGCTCTTCAAGAAAAGAAAGG + Intergenic
1009961142 6:70522809-70522831 GTAGATCTGATAAAAAAGGAGGG - Intronic
1009986807 6:70790508-70790530 GTAGATCTTCCATAAAAAAAAGG - Intronic
1011372704 6:86655109-86655131 GTAGAGCTACCAGAAAAGAATGG + Intergenic
1011800356 6:91006084-91006106 GTAGATTAACCAGAGAAGAATGG + Intergenic
1012106895 6:95173503-95173525 ATAGAACTAATACAAAAGAAAGG + Intergenic
1012611054 6:101221218-101221240 AAAGGTCTACTAGGAAAGAAAGG - Intergenic
1012737387 6:102967223-102967245 GTAGACCTAGAAGAAAGGAAAGG + Intergenic
1014578997 6:123111061-123111083 GTAGAATTACTAGAAAAGAAGGG + Intergenic
1014990729 6:128072718-128072740 GTAGAAAAACTAGACAAGAAAGG - Intronic
1018128774 6:160707785-160707807 GTAGTTTTATTTGAAAAGAAAGG + Exonic
1018607607 6:165614483-165614505 GTAGATGTTCTAGAAGAGGAGGG - Intronic
1020218608 7:6216018-6216040 GTAGACCTACCCTAAAAGAATGG + Intronic
1022569789 7:31441104-31441126 TTACATGTACTAGAGAAGAAGGG + Intergenic
1024137717 7:46427662-46427684 GCAGATCTACCATAAAGGAAAGG + Intergenic
1024217846 7:47263062-47263084 GTACACCTGCTAGAAAAGACAGG + Intergenic
1028095868 7:86759763-86759785 GTAGATCTACTAAAAATGATTGG + Intronic
1028356892 7:89921280-89921302 GTAAATCTTCTAAAAATGAAAGG + Intergenic
1028810010 7:95075327-95075349 TTAGATCTACTAAAAATGTAGGG + Intronic
1029291098 7:99503006-99503028 GTAAATATATTAGAAAAGAATGG + Intronic
1029848336 7:103436833-103436855 GTAAATCTACTAAAAGAAAATGG + Intronic
1029866702 7:103639181-103639203 GTAGTTTTACTAGAAAACACAGG + Intronic
1031965248 7:128023212-128023234 GCAGAGCTAGGAGAAAAGAAAGG - Intronic
1036615018 8:10381275-10381297 GTGGATCAAAGAGAAAAGAAAGG - Intronic
1037012881 8:13866568-13866590 GTAGATCTTTAAGAAAAGGAAGG - Intergenic
1038692781 8:29778288-29778310 TTTGATCAATTAGAAAAGAAAGG + Intergenic
1038803041 8:30766382-30766404 GCAGACCAACTAGGAAAGAAGGG + Exonic
1041415557 8:57604070-57604092 GTACATGTACTAGGAAAGAATGG + Intergenic
1043935186 8:86134288-86134310 GCAGACCTACTCTAAAAGAATGG + Intronic
1044039977 8:87355305-87355327 GAAGATGTCCCAGAAAAGAAGGG - Intronic
1044082412 8:87901826-87901848 ATAGATGGACTAGAAAAGAAAGG + Intergenic
1044847278 8:96394554-96394576 GAAGATCAAAGAGAAAAGAATGG + Intergenic
1045792728 8:106003940-106003962 GTAGATTTAAATGAAAAGAAAGG + Intergenic
1046933461 8:119864182-119864204 GTATTTATATTAGAAAAGAAAGG - Intergenic
1047913650 8:129558503-129558525 TGAGATCAAGTAGAAAAGAATGG + Intergenic
1052164007 9:25299826-25299848 GTAGATCTGCTTGAAATAAATGG - Intergenic
1052558032 9:30045427-30045449 CTAAAACTACTAGAAAAAAAGGG - Intergenic
1053287763 9:36860932-36860954 GTAAATCTCCTAGAAAAAAATGG - Intronic
1058114922 9:101074301-101074323 ATAGATCTAATAGATAAGCATGG + Intronic
1203619276 Un_KI270749v1:105458-105480 TTAGACCAACTAGAATAGAAGGG + Intergenic
1186314942 X:8359078-8359100 GTAGTTCTATTAGAAAACACTGG - Intergenic
1186658723 X:11645765-11645787 GAAGACCTACTAGAAAAGGATGG + Intronic
1186820456 X:13282678-13282700 TTAGATTTTCTGGAAAAGAAGGG - Intergenic
1190707798 X:53045022-53045044 TTAGATGTTCTAGAAAAGGAGGG - Intergenic
1190971531 X:55354011-55354033 ATAGATCTAGTTGAAAGGAACGG + Intergenic
1192971151 X:76232218-76232240 GTAGATTTAAAATAAAAGAATGG + Intergenic
1193062202 X:77218996-77219018 GTAGAGCTACCCTAAAAGAAGGG + Intergenic
1193148267 X:78099920-78099942 GGAGTTCTATTAGTAAAGAAAGG + Intronic
1193587434 X:83342660-83342682 GAACATCTACTAGACAAGAATGG - Intergenic
1194973525 X:100370119-100370141 GAAATTCTACTGGAAAAGAAAGG + Intronic
1196577393 X:117335305-117335327 GGACATCTACTAGAAAAGCTAGG + Intergenic
1197800106 X:130339581-130339603 GTAGAAGGACTAGAAAAGGAAGG - Intergenic
1198339719 X:135702059-135702081 ATAGATTTATAAGAAAAGAATGG - Intergenic
1198491948 X:137150537-137150559 GCAGATCTACCTTAAAAGAATGG - Intergenic
1199217115 X:145272773-145272795 ATTCATCTCCTAGAAAAGAAAGG + Intergenic
1199413740 X:147555788-147555810 GGAGATCTAGTTGAAATGAAAGG + Intergenic
1199571484 X:149271184-149271206 TTAGATGTAGAAGAAAAGAAAGG - Intergenic
1200340923 X:155394861-155394883 GCAGATTTACAAGAAAAAAAAGG + Intergenic
1202096395 Y:21252656-21252678 GTAAATAAACTAGAAATGAAAGG - Intergenic