ID: 1158258831

View in Genome Browser
Species Human (GRCh38)
Location 18:55586555-55586577
Sequence TAACTAGGAGGTAAGATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158258829_1158258831 -9 Left 1158258829 18:55586541-55586563 CCTAGGAAAAGATGTAACTAGGA 0: 1
1: 1
2: 0
3: 14
4: 268
Right 1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 181
1158258826_1158258831 10 Left 1158258826 18:55586522-55586544 CCATACTAGTTTTAAGAATCCTA 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158258831 Original CRISPR TAACTAGGAGGTAAGATGTA AGG Intronic
907219098 1:52892224-52892246 TAACTAGGATTAAAGATGTTTGG + Intronic
907761593 1:57367142-57367164 TAACTAGGATTACAGATGTATGG - Intronic
908091588 1:60691381-60691403 TTACTAGGAGTGAATATGTATGG - Intergenic
911201741 1:95051312-95051334 TTACTGGCAGATAAGATGTAGGG - Intronic
911572193 1:99531370-99531392 TTATTAGAAGGTAAGAGGTAGGG - Intergenic
911962342 1:104321357-104321379 TAAGTAGGAGCTAAGCTATAAGG + Intergenic
912684097 1:111748564-111748586 TAGATAGGAGGTGAGATTTATGG - Intronic
917379929 1:174394691-174394713 TAATTAGGTGGTAAGACCTAGGG - Intronic
917474980 1:175361759-175361781 TAACTAGGAGGTTTGGTCTAGGG + Intronic
919031303 1:192246441-192246463 AAACTTGGAGGTAATTTGTATGG + Intergenic
920162807 1:204012492-204012514 AAACAAGGAGGTGAGATGTAAGG + Intergenic
922185596 1:223271537-223271559 CAACTAGGGAGTAAGAAGTAGGG + Intronic
923832720 1:237575567-237575589 TAATTATGTGGTAAGATGGATGG - Intronic
1063069972 10:2651529-2651551 TAAGTGGGAGCTAAGCTGTAAGG - Intergenic
1063333303 10:5184215-5184237 TAACTATGAGGTCAGGTCTAGGG - Intergenic
1065681882 10:28244186-28244208 TCACTAGCAGATAGGATGTAAGG - Intronic
1069361407 10:67646708-67646730 GTATTAGGAGGCAAGATGTAAGG + Intronic
1071049318 10:81427501-81427523 GAAGAAGGAGGTAAGATGTTAGG - Intergenic
1071087215 10:81876864-81876886 TAACTAGGAGGAAATATGAAGGG + Intronic
1072556577 10:96520017-96520039 AATCTTGCAGGTAAGATGTAGGG - Exonic
1077825682 11:5806171-5806193 TAAGGAGGAGGTAAGATTTTAGG + Intronic
1079098034 11:17523406-17523428 TCACAAGGAGGTGAGATGTGGGG - Exonic
1079525742 11:21385530-21385552 ATACTAGGAGGTAGGATGGAGGG - Intronic
1079640931 11:22804576-22804598 TATCAAGAAGGTCAGATGTAAGG + Intronic
1079721445 11:23818928-23818950 TCTCTATGAGGTAAGATGTGAGG + Intergenic
1082223220 11:49667954-49667976 GAACTATGAGGTAAGAACTAAGG - Intergenic
1082965899 11:58965915-58965937 TCACTGGGAGGTAAAATATAGGG + Intronic
1086919574 11:92571172-92571194 GAATTAGGAGGAAAGAGGTAAGG + Intronic
1087426373 11:97992152-97992174 AAACTAGAAGGTAAAATGTGGGG + Intergenic
1087878354 11:103386086-103386108 TAACTACGAGTTCAGAAGTAAGG - Intronic
1090322202 11:125856989-125857011 AAAGTAAGAAGTAAGATGTAAGG + Intergenic
1091155245 11:133366068-133366090 TAACTAAAAGGTAAAATGAAAGG - Intronic
1091968816 12:4768754-4768776 GACCTAAGAGGTAAGATGGATGG - Intronic
1093616319 12:21229976-21229998 TAAGTATGAAGTTAGATGTAGGG + Intronic
1093707051 12:22286061-22286083 TAACTAAGAGCTATGATATATGG - Intronic
1095201524 12:39390093-39390115 TATATAGGAGGTTAGGTGTATGG - Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097591931 12:61585253-61585275 ATACCAGGAGGTAGGATGTAGGG + Intergenic
1104543702 12:129691847-129691869 TAACTAGGATTTAAGATAGATGG + Intronic
1104554729 12:129789275-129789297 TAAGTAGGAGCTAAGCTGTGAGG - Intronic
1106217284 13:27714435-27714457 AAAGTAGGAGATAAGGTGTAAGG + Intergenic
1107157472 13:37186214-37186236 TAAGTTGGGGGTAAGATTTAAGG + Intergenic
1107701355 13:43051482-43051504 TAACTAGGAGCTAAGGTATGAGG - Intronic
1109100862 13:58181923-58181945 TAACAAGGAGTTAGGAGGTAGGG - Intergenic
1109576810 13:64270337-64270359 GAAGTAGGAGGTAAGCTATAGGG + Intergenic
1111355582 13:87097390-87097412 AAACTAGGAGGTAACAGATATGG - Intergenic
1112687291 13:101844825-101844847 TAACTAGGAGCAAAGAGTTATGG + Intronic
1112749318 13:102566072-102566094 TTACTAGGAGCTAGGATGGAAGG + Intergenic
1115491121 14:33959174-33959196 TAACTATAAGGTAAAATGTCAGG - Intronic
1116336004 14:43657422-43657444 TAACTGGGAGCTAAGGTGTGGGG + Intergenic
1116674265 14:47885254-47885276 TAAGTGGGAGCTAAGATATAAGG - Intergenic
1116899494 14:50348257-50348279 GAACTAGGAGCTAAGGAGTATGG + Intronic
1118759495 14:68871238-68871260 TTACCAGGAGGTAAGATTAATGG + Intergenic
1124098991 15:26675725-26675747 TTACTAGGAGGTAACATCAAGGG + Intronic
1124891844 15:33740925-33740947 TAAGTAAGAGGTAAGAAGCATGG + Intronic
1125620587 15:41058107-41058129 TAAGTAGGAGGTAGAATGTTAGG - Intronic
1127210578 15:56770628-56770650 TAGCCAGAAGGTAAGATGAAAGG - Intronic
1128376698 15:67081613-67081635 TGGCCAGGAGGAAAGATGTAAGG - Intronic
1130223257 15:82039141-82039163 TAACTATGAGATAAAATGTACGG - Intergenic
1130744718 15:86638793-86638815 AAACTATGAGATAATATGTATGG - Intronic
1133965127 16:10525572-10525594 TAAGCAGAAGATAAGATGTATGG + Intergenic
1134513895 16:14871183-14871205 TAAAAAGGAGGTAAGGAGTAAGG - Intronic
1134701536 16:16269683-16269705 TAAAAAGGAGGTAAGGAGTAAGG - Intronic
1134970294 16:18524968-18524990 TAAAAAGGAGGTAAGGAGTAAGG + Intronic
1138238688 16:55408441-55408463 CAAAGAGGAGGTAAGATGTAGGG - Intronic
1138263846 16:55645240-55645262 GAACTAGGAGGTAGGGTGCAGGG - Intergenic
1139553636 16:67691611-67691633 TACAGAGGAGGGAAGATGTAGGG - Intronic
1139928160 16:70503570-70503592 TAAGTAGGAGTTAAGATGTGAGG - Intronic
1141343404 16:83224048-83224070 TAATTAGGAGCTAAGTTGTGAGG - Intronic
1142903570 17:3027842-3027864 GATCAAGGAGGTAAAATGTACGG + Intronic
1145400131 17:22525002-22525024 TAACTAGGGGGTTAGGTATAGGG - Intergenic
1148523005 17:48299954-48299976 CATGTAGGAGGTAAGATGAAAGG + Intronic
1149275928 17:55036503-55036525 TAACAAGGTTGTAAGATATAAGG - Intronic
1155999800 18:32372003-32372025 TAAATGAGAGGTAAGAGGTAAGG + Intronic
1156659119 18:39325917-39325939 CAACTAGGGGGCAAGAAGTATGG + Intergenic
1158258831 18:55586555-55586577 TAACTAGGAGGTAAGATGTAAGG + Intronic
1160064031 18:75558264-75558286 CAACTAGAAGGTTAGATGTGTGG + Intergenic
1165156707 19:33793114-33793136 TAACTAGGAGGGAAGATTGGGGG + Intergenic
1165238650 19:34445330-34445352 TAAATAGGAGGTAAAATGAGAGG + Intronic
927189228 2:20505549-20505571 TAAAAAGTAGGAAAGATGTATGG - Intergenic
928846456 2:35679329-35679351 TAACTAGGAGATAGGATGTGAGG + Intergenic
930351646 2:50263757-50263779 GAACTAGGTGTTAAGATGGAAGG - Intronic
932108060 2:68967058-68967080 TAAAGAGGAGGGAAGATATAAGG + Intergenic
932800381 2:74737153-74737175 TAACTAGGAGGTAAACAATAGGG - Intergenic
933096586 2:78190789-78190811 TAACTTGGAGGTGAAAGGTAGGG - Intergenic
933105369 2:78317874-78317896 GAATTAGGAGGTAAGAAGAAGGG + Intergenic
933608926 2:84414194-84414216 AAAATAGGAGGTGACATGTAAGG - Intergenic
936504519 2:113094772-113094794 TAAGTGGGAGCTAAGCTGTAAGG - Intergenic
937420580 2:121751603-121751625 TAACTATGATGTTAGCTGTAGGG - Intronic
939631797 2:144534498-144534520 TAAGTGGGAGCTAAGGTGTAAGG - Intergenic
942831118 2:180238243-180238265 TAACAAGGAGGTTAAATATACGG - Intergenic
945660397 2:212678580-212678602 TAAAAAGGAAGTTAGATGTAGGG - Intergenic
946461422 2:219872238-219872260 CAACTGGGAGGCAAGATGTGTGG - Intergenic
946784649 2:223229987-223230009 TAACTAAGAAGTAAATTGTAAGG - Intergenic
946800881 2:223414901-223414923 GAACTAGGAGTTAAGATTAAAGG + Intergenic
947574921 2:231265526-231265548 TAAGTAGGAGCTAAGATATGAGG + Intronic
947996579 2:234533126-234533148 TAAGTGGGAGCTAAGATATAAGG + Intergenic
948181217 2:235982424-235982446 TAGCTAGGAGGTCAGAAGGAAGG + Intronic
1169624869 20:7554275-7554297 TAAGTGGGAGCTAAGATGTGAGG - Intergenic
1177605533 21:23372924-23372946 TAAGTCAGAGGTAAAATGTATGG - Intergenic
1177837548 21:26201335-26201357 TAACAATGTGGTAAGATGGATGG - Intergenic
1178047644 21:28713190-28713212 TATTTAGGAGGTAAAATGGATGG - Intergenic
1180213600 21:46311246-46311268 TAACTAGGAGGTAAAATAATTGG - Intronic
1181908246 22:26216911-26216933 TAACCAGGAGGGAAGTGGTAGGG + Intronic
950237861 3:11339369-11339391 TGACTTGAAGTTAAGATGTATGG - Intronic
950909102 3:16569244-16569266 TAAGTGGGAGCTAAGCTGTAAGG - Intergenic
952745242 3:36770871-36770893 AAACTGAGAGGTAACATGTAAGG - Intergenic
955839648 3:63097847-63097869 TAAGTGGGAGGTAAGCTATAAGG - Intergenic
957512307 3:81204760-81204782 TAACTAGGAAGTGAGAGGAAAGG + Intergenic
958061045 3:88481521-88481543 TGGGTAGGAGTTAAGATGTAGGG - Intergenic
958100012 3:88997560-88997582 TAACTAGGAGGCCAGCTATATGG + Intergenic
960709920 3:120517927-120517949 TAAATAGAAGTTAACATGTATGG - Intergenic
963412119 3:144942035-144942057 GAATTAGGAGGTAAGATATTTGG - Intergenic
964553221 3:157908392-157908414 GAAATAGGAGGTAGGATGTAGGG - Intergenic
966531889 3:180989988-180990010 AAACGAGGTGCTAAGATGTAGGG - Intergenic
967466881 3:189817017-189817039 TAACAAGGTGGCAAGTTGTAGGG - Intronic
971065130 4:23022946-23022968 GAACTAGGAGGAAATATGTTTGG - Intergenic
971525856 4:27617848-27617870 TAACTGGGAGGTAAAATGAATGG + Intergenic
973012824 4:45097551-45097573 TAGTTAGGAGGTAAGATGAATGG + Intergenic
974191963 4:58517085-58517107 TAACTAGTAAGTAAGATTTGAGG + Intergenic
974461080 4:62188712-62188734 TACTCAGGAGGTAAGATGTTGGG + Intergenic
975944584 4:79689980-79690002 TAAGTGGGAGTTAAGCTGTAAGG - Intergenic
977770020 4:100846975-100846997 TAACTAGGAGTTTCCATGTAGGG - Intronic
979035560 4:115712170-115712192 ACTCTAGTAGGTAAGATGTATGG - Intergenic
979190264 4:117848549-117848571 TAAATGGGAGCTAAGATGTGAGG + Intergenic
979643459 4:123037478-123037500 TATCTAGGAGGTAAAATATGTGG + Intronic
982119045 4:152122295-152122317 TAAATATGATGTTAGATGTAGGG + Intergenic
983662544 4:170144371-170144393 TAAGTAGGAGCTAAGCTGTGAGG - Intergenic
983701442 4:170600112-170600134 TAGCCAGGAGGCAAGATGTAAGG - Intergenic
984262472 4:177458576-177458598 TAACTGGGAGGGAAAGTGTAAGG + Intergenic
984365536 4:178794468-178794490 TATTTAGGTGTTAAGATGTAAGG - Intergenic
985814490 5:2116485-2116507 TAATTAGGAGTTGAGATGTCAGG + Intergenic
986776066 5:11014876-11014898 TAATTAGGAGGTAAGAGATAAGG - Intronic
987764619 5:22209113-22209135 TAACTAGAAGTTAGGTTGTATGG - Intronic
991651851 5:68863664-68863686 TAATCAGGAAGTAAGATATATGG - Intergenic
991899358 5:71442263-71442285 TAACTAGAAGTTAGGTTGTATGG - Intergenic
992167398 5:74068233-74068255 CAAATAGGAAGTAAGGTGTAAGG - Intergenic
992932487 5:81663468-81663490 TAACTAGCACATAAAATGTAAGG - Intronic
993205732 5:84875869-84875891 TAATTAGGAGGAAGGATTTAAGG - Intergenic
993277069 5:85873633-85873655 TAAGTAGGAAGCTAGATGTAAGG - Intergenic
994807154 5:104463487-104463509 TATCTAGGAGCTACAATGTATGG + Intergenic
995435115 5:112127183-112127205 TAAATGGGAGGTAGGATGAAAGG - Intergenic
996377411 5:122827083-122827105 TAACTAAGAGGAAAGATTTTGGG - Intronic
996756261 5:126938510-126938532 AAGCTAGGAGTTAACATGTAGGG + Intronic
997218880 5:132140701-132140723 TAAGTAGGAGCTAAGCTATAAGG + Intergenic
999482888 5:151965244-151965266 TAACTAAGAGAAAAGATGCAGGG - Intergenic
1000032548 5:157416898-157416920 TAAGTAGGAGCTAAGCTGTCAGG - Intronic
1000117242 5:158165367-158165389 TAAGTAGGAGGTAAAATATGAGG - Intergenic
1004432987 6:15563141-15563163 TGAGTAGGAGGTAAGATGGGAGG - Intronic
1005134844 6:22556236-22556258 TAACCAGGAAGAAAGATGAAAGG + Intergenic
1006702055 6:35983258-35983280 TAATTAAGAGGCAAGAAGTATGG + Intronic
1007840365 6:44711290-44711312 TAACTAGGATGTATGGAGTATGG - Intergenic
1007840376 6:44711380-44711402 TAACTAGGATGTATGGAGTATGG - Intergenic
1008454887 6:51697958-51697980 TACCTAGGAGATAGGAAGTAAGG + Intronic
1010351276 6:74877737-74877759 TAATCAGGAGGTAAGTAGTAAGG + Intergenic
1012273272 6:97241020-97241042 TAACTTGGAGGTAAGCTATGAGG - Intronic
1018654256 6:166018802-166018824 TAATGAGGTGGTAAGGTGTAGGG - Intergenic
1020664858 7:11027312-11027334 TAACTAGGCAGTAGGATGTCAGG + Intronic
1020821567 7:12974488-12974510 TAAGTAGGAGCTAAGCTATAAGG - Intergenic
1024422018 7:49179256-49179278 AAACAAGAAGGTAAGATGGAAGG - Intergenic
1027848053 7:83410393-83410415 TAAGTGAGAGGTATGATGTAAGG + Intronic
1029799849 7:102934967-102934989 TAAATTGGAGTTAAGATGAAAGG - Intronic
1032440130 7:131936323-131936345 TAACCAAGAGGTAAGAGGAAAGG - Intergenic
1037240603 8:16772929-16772951 GAAGTAGGGGGTAAGATGTTTGG - Intergenic
1037432397 8:18827516-18827538 TAACTAGGTGGTATTATGGAAGG + Intronic
1041263846 8:56045144-56045166 TAACTAGAAGGAATGAGGTAAGG - Intergenic
1041341554 8:56851625-56851647 TAAATTGGATGTAAGGTGTAAGG + Intergenic
1042834083 8:73062134-73062156 AAATTAGGAGGTAAAATATAAGG - Intergenic
1043261859 8:78210381-78210403 AAACTAGGAGGTATGCTGAAAGG - Intergenic
1043605513 8:81993836-81993858 AAGCTAGTAGGTAAGAGGTAAGG - Intergenic
1045878402 8:107009926-107009948 TAAGTAGGAGGTAAGCTATGAGG + Intergenic
1046393488 8:113608534-113608556 TTACTAGGAGGTAAGTTACATGG + Intronic
1046495208 8:115005245-115005267 TAACTATGAGAAAAGATGAATGG - Intergenic
1046897004 8:119483912-119483934 TTTCTAGGAGGTATGATGCAGGG - Intergenic
1047488479 8:125354387-125354409 TAATTTGGAAGTAATATGTAGGG - Intronic
1047648124 8:126890374-126890396 TAAGTGGGAGGTAAGCTATAAGG + Intergenic
1050272258 9:3958931-3958953 TAACTATGAGGTGAGAAGTCTGG + Intronic
1052055660 9:23904458-23904480 CAACTAGGAGGAAAGATTTATGG - Intergenic
1052351465 9:27463379-27463401 TAAGTAGGTGGTAAGAGGTTTGG - Intronic
1054940991 9:70741755-70741777 TAACTGGGAGCTAAGCTGTGAGG + Intronic
1056914770 9:90736546-90736568 TTAGAAGGAAGTAAGATGTAGGG + Intergenic
1057525262 9:95793629-95793651 GATCTAGGTGGTAAGATATAAGG + Intergenic
1058159891 9:101558234-101558256 TAAGTAGGAGCTAAGCTGTGAGG - Intronic
1061450112 9:130663213-130663235 GAACTAGGAGGCAAGAAGGAAGG + Intergenic
1186472653 X:9833501-9833523 TAATTAGGAGGTCCGATGCAGGG - Intronic
1186582413 X:10834543-10834565 TAAGTAGTAGATAAAATGTAAGG - Intergenic
1186614302 X:11170646-11170668 GAACTAGGAAGGAAGAAGTAGGG + Intronic
1186920389 X:14272265-14272287 AAACTAGTAGCTATGATGTAAGG - Intergenic
1190851696 X:54250562-54250584 AAAGTAGCAGTTAAGATGTAGGG - Intronic
1192399053 X:70816137-70816159 TAAGTGGGAGCTAAGATGTGAGG - Intronic
1193097658 X:77569158-77569180 TAACTATGATGTTAGCTGTAAGG - Intronic
1193111978 X:77739196-77739218 TAAGTAGGAGCTAAGCTATAAGG - Intronic
1193689025 X:84616813-84616835 CAACTAGGAGTTATGATGAATGG - Intergenic
1195483854 X:105379816-105379838 TAGCTAGGAGGTAGTATGTCAGG + Intronic
1197805438 X:130394181-130394203 TCACTAGGGGGTAAGATTTGTGG + Intergenic