ID: 1158259091

View in Genome Browser
Species Human (GRCh38)
Location 18:55588072-55588094
Sequence CATGAACGCCGCCTCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158259091 Original CRISPR CATGAACGCCGCCTCGGCGC CGG (reversed) Intronic
904701809 1:32362285-32362307 CGTGGACGCCGCCTCGCGGCGGG - Exonic
923315277 1:232773813-232773835 CCTGAATGCTGCCTTGGCGCCGG + Intergenic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1072915641 10:99535938-99535960 CAGAAACGCCGGCTGGGCGCCGG + Exonic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1081770817 11:45649747-45649769 CAAGATCGCCGCCTCGGAGGAGG - Exonic
1084519261 11:69653595-69653617 CACGCACGCGGCCTCGGGGCCGG - Exonic
1086451027 11:86916938-86916960 CATGAACTGAGCCTCGGTGCTGG - Intronic
1118477997 14:66136313-66136335 CATTAACCCCTCCTGGGCGCAGG + Intergenic
1123427153 15:20182055-20182077 AATGAACGCCTCCTCGGGGATGG - Intergenic
1123536382 15:21188564-21188586 AATGAACGCCTCCTCGGGGATGG - Intergenic
1132947175 16:2538093-2538115 CATGGGCCCCGCGTCGGCGCGGG - Exonic
1136857145 16:33667781-33667803 AATGAACGCCTCCTCGGGGATGG + Intergenic
1139378684 16:66516689-66516711 CATGAGCACCGCCTCCGTGCCGG + Intronic
1203118718 16_KI270728v1_random:1516272-1516294 AATGAACGCCTCCTCGGGGATGG + Intergenic
1146371165 17:32266227-32266249 GATGCGCTCCGCCTCGGCGCAGG - Exonic
1151858270 17:76737955-76737977 CCTGACCGCAGCCGCGGCGCCGG - Exonic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160508884 18:79442312-79442334 CAGGACCGACGCCTCGGCGAGGG - Intronic
1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG + Exonic
1167163332 19:47781343-47781365 CATCAAAGCCGCCTTGGCTCAGG + Exonic
1168317801 19:55491621-55491643 CATTCACGCCCCCTCAGCGCGGG + Intronic
1168553722 19:57320850-57320872 CAGGATGGCAGCCTCGGCGCAGG + Exonic
943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG + Intergenic
1173856063 20:46251451-46251473 CCTGAACGCCGCCCAGCCGCGGG + Exonic
1180719486 22:17896777-17896799 CGAGAACGCCGCCTTGGTGCGGG - Exonic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950100018 3:10350912-10350934 CATGAACGCCTCCTCAGATCTGG + Intronic
950131756 3:10552146-10552168 CACGGCCGCCGCCTCGGTGCCGG + Intronic
968372729 4:10881-10903 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372734 4:10910-10932 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372739 4:10939-10961 GACGGACGCCGCCGCGGCGCAGG + Intergenic
968372744 4:10968-10990 GACGGACGCCGCCGCGGCGCAGG + Intergenic
974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG + Intronic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
985462652 4:190121598-190121620 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462662 4:190121656-190121678 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462667 4:190121685-190121707 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462672 4:190121714-190121736 GACGGACGCCGCCGCGGCGCAGG - Intergenic
985462677 4:190121743-190121765 GACGGACGCCGCCGCGGCGCAGG - Intergenic
991686897 5:69189720-69189742 GCTGCACGCCGCCTGGGCGCCGG - Exonic
1008598367 6:53065403-53065425 CATGCTCGGCGCGTCGGCGCAGG + Intronic
1019371517 7:664357-664379 CATGAACACAGCCTCTGCCCTGG + Intronic
1023939744 7:44761914-44761936 CAGCACCGCCCCCTCGGCGCAGG - Intronic
1024356027 7:48414204-48414226 CATGAACGGCGCCTCTGCAGCGG + Intronic
1049356662 8:142192558-142192580 CATGAAGGCAGCCTCAGCACTGG + Intergenic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1188480328 X:30630585-30630607 CATGAAAGCCGCCATGGCCCCGG + Intergenic