ID: 1158261441

View in Genome Browser
Species Human (GRCh38)
Location 18:55610303-55610325
Sequence GTAAGGCATAGGGAAAAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 285}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158261441_1158261448 -5 Left 1158261441 18:55610303-55610325 CCGACCTTTTCCCTATGCCTTAC 0: 1
1: 0
2: 3
3: 20
4: 285
Right 1158261448 18:55610321-55610343 CTTACTCCTGCGGGTTAATTTGG 0: 1
1: 0
2: 0
3: 4
4: 41
1158261441_1158261450 6 Left 1158261441 18:55610303-55610325 CCGACCTTTTCCCTATGCCTTAC 0: 1
1: 0
2: 3
3: 20
4: 285
Right 1158261450 18:55610332-55610354 GGGTTAATTTGGTTTGAGTTTGG 0: 1
1: 0
2: 2
3: 24
4: 206
1158261441_1158261451 10 Left 1158261441 18:55610303-55610325 CCGACCTTTTCCCTATGCCTTAC 0: 1
1: 0
2: 3
3: 20
4: 285
Right 1158261451 18:55610336-55610358 TAATTTGGTTTGAGTTTGGTTGG 0: 1
1: 2
2: 1
3: 28
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158261441 Original CRISPR GTAAGGCATAGGGAAAAGGT CGG (reversed) Intronic
900903680 1:5535420-5535442 GTCAGGCATTGGGGAAAAGTGGG + Intergenic
901328758 1:8388208-8388230 GCAAGCCATAAGGAAAAGGAGGG + Intronic
901408193 1:9064298-9064320 TTAGGGCATAAGGAAAAGGGAGG + Intronic
901657069 1:10775503-10775525 GGAAGGGAGAGGGAGAAGGTGGG + Intronic
902184199 1:14712849-14712871 AGAAAGCACAGGGAAAAGGTGGG - Intronic
903052811 1:20614144-20614166 GGGAGGCACAGGGAAAAGATGGG + Intronic
903165845 1:21519896-21519918 AGAAGGCCTAGGGAACAGGTGGG - Intronic
904007215 1:27369689-27369711 GTAAGACAGGGGGAAAAGCTGGG - Intronic
904981809 1:34510065-34510087 TCAAGGCAGAGGGCAAAGGTGGG - Intergenic
905875674 1:41430865-41430887 GCAAGGGCTGGGGAAAAGGTGGG + Intergenic
907168786 1:52441239-52441261 GAAGGGCAGAGGTAAAAGGTGGG + Intronic
907251722 1:53143870-53143892 GTGGGGCATAGGGGAGAGGTGGG + Intergenic
907808097 1:57841442-57841464 GTAATGCAGAGGGGAAATGTGGG - Intronic
908090688 1:60682327-60682349 GTAAGGTAAAGGGGAAAAGTGGG + Intergenic
910357273 1:86374445-86374467 CTAAAGCAAAGAGAAAAGGTAGG - Intronic
910502296 1:87906643-87906665 GTAAGTTACAGGGAAAAGGAAGG - Intergenic
910616604 1:89205327-89205349 GCAATGCAGAGGGAAAAAGTGGG + Intergenic
910895393 1:92064158-92064180 GAAAGGGAGAGGGAAAAGGAAGG + Intergenic
910979960 1:92950226-92950248 CTAAGGCAAAGAGGAAAGGTGGG + Intronic
912315760 1:108666497-108666519 GTAAGGGTTAGAGAAAGGGTTGG + Intergenic
912734609 1:112139285-112139307 GTAAGGACTAGGGAATAGGGTGG - Intergenic
912760462 1:112361581-112361603 GTCAGGGAGAGGGAGAAGGTGGG - Intergenic
913268938 1:117073684-117073706 GTAAGGCAGAGGGGAAACGCTGG + Exonic
913427930 1:118755560-118755582 GTAAGGCATGGTGATAAGCTAGG - Intergenic
914991432 1:152502543-152502565 GTGAGGAAGAGGGAGAAGGTGGG + Intergenic
916300842 1:163272234-163272256 CTAAAACATAGGCAAAAGGTAGG - Intronic
916910566 1:169341457-169341479 GCAATGCAGAGGGAAAATGTGGG + Intronic
917112426 1:171562347-171562369 GTAGGGCCTATGGAAGAGGTGGG + Intronic
918884909 1:190180015-190180037 GTAAAGATTAGGGAAAAGGAGGG - Intronic
919890922 1:201973673-201973695 GTCAAACATAGGGAAAAGGAGGG - Intergenic
920031145 1:203038198-203038220 TTAAGTGATGGGGAAAAGGTTGG + Intronic
920199533 1:204250987-204251009 TTAAGACATAGGGGAATGGTCGG + Intronic
920391150 1:205603167-205603189 ATAAGGAATAAGGAAAAGGCAGG + Intronic
920750500 1:208670263-208670285 ATAGAGCATAGGGAAGAGGTGGG + Intergenic
920823897 1:209406406-209406428 CTAAGGCTGAGGGAAAAAGTGGG + Intergenic
922466125 1:225846457-225846479 GTAAGCTATGGGGAACAGGTTGG - Exonic
923002422 1:230018501-230018523 GGAAGGTAAAGGGAAAAGGGGGG - Intergenic
1062820854 10:533574-533596 CTAAGCTAAAGGGAAAAGGTAGG + Intronic
1063375517 10:5552081-5552103 AGGAGGCAAAGGGAAAAGGTTGG + Intergenic
1063504970 10:6589512-6589534 GTAGGGGATAGGTAATAGGTAGG + Intergenic
1064070483 10:12224956-12224978 GGAAGAAATAGGGAAAAGGAAGG - Intronic
1064342829 10:14501917-14501939 GTGAGACAATGGGAAAAGGTGGG + Intergenic
1067356664 10:45534710-45534732 GTGAGGCAGTAGGAAAAGGTAGG + Intronic
1068391284 10:56400422-56400444 GGAAGGCATAGCAAAAAGGAGGG + Intergenic
1068799870 10:61128118-61128140 GTAAAGAATAAGCAAAAGGTAGG + Intergenic
1069759697 10:70800206-70800228 GTGAGCCAAAGGGAAAAGGGAGG - Intergenic
1071169706 10:82849771-82849793 GTAAGGGAGAGGGGAAAGGTAGG + Intronic
1071869151 10:89773207-89773229 CAAAGGCTTAGGGGAAAGGTGGG - Intronic
1074907578 10:117878627-117878649 CTGAGGCATAGGGAAGAGGCTGG - Intergenic
1075806287 10:125191210-125191232 GTCAGGCATAGGGAAAGGGCTGG + Intergenic
1077437620 11:2550381-2550403 AAAAGGCATAGGTAGAAGGTGGG + Intronic
1078970825 11:16409237-16409259 GTTAGGGATAGAGAAAATGTTGG - Intronic
1080053154 11:27877403-27877425 GTAAGCCATAGGGAAAATTGAGG + Intergenic
1081456850 11:43232050-43232072 GTAAGGCAGTGGGAACAGGAAGG - Intergenic
1085745061 11:79108016-79108038 TTAATTCATGGGGAAAAGGTTGG + Intronic
1085822959 11:79812659-79812681 GTAAGGCATACAGAAAAGGGAGG - Intergenic
1086562450 11:88183764-88183786 GTAAGGGATAGGAAAAAGCAGGG - Intergenic
1088946291 11:114516776-114516798 GTAACCCAGAGGAAAAAGGTGGG - Intergenic
1090439987 11:126717429-126717451 GTAAGGCATAGCCAACAGCTGGG - Intronic
1093214664 12:16348695-16348717 GAAAAGCATATGCAAAAGGTAGG - Intronic
1093940804 12:25051822-25051844 GAAAGGAATGGGGTAAAGGTAGG - Intronic
1095429654 12:42119450-42119472 GAAAGGCAAAGGGAAAGGGAGGG + Intronic
1095821566 12:46484503-46484525 TTAAGCCAAAGGGAAAAGCTGGG + Intergenic
1096100447 12:48967866-48967888 GAGAGGCATAGGGAAATGATAGG - Intronic
1096117568 12:49064263-49064285 ATAAGGAATAGGAACAAGGTAGG + Intergenic
1096918453 12:55058461-55058483 GGAAGAAATAGAGAAAAGGTAGG + Intergenic
1097608898 12:61792209-61792231 GTGAAGGATAGGGAAAAGGATGG + Intronic
1098407548 12:70142045-70142067 GTGAGCCAAAGGGAAAAGGAAGG - Intergenic
1100673867 12:96845642-96845664 GTTAGGCAGAGGGAGAAGCTGGG - Intronic
1100687999 12:97007634-97007656 TGAAGGAATAGAGAAAAGGTAGG + Intergenic
1100961164 12:99964498-99964520 GGAAGGCACAGTGGAAAGGTAGG + Intronic
1103496574 12:121367390-121367412 ACAAAGCACAGGGAAAAGGTGGG + Intronic
1104038952 12:125116932-125116954 GAAAGGCAAAGGGAAAAAGGAGG - Intronic
1105452680 13:20514194-20514216 GTATGGAAGAGGGAAAAGTTAGG + Intronic
1106672597 13:31922603-31922625 GTAAGACAGAGGAAAAAGTTTGG - Intergenic
1109130862 13:58583809-58583831 AAAAGTCATAGGAAAAAGGTAGG - Intergenic
1109386540 13:61635458-61635480 GTTTGGCATACAGAAAAGGTAGG - Intergenic
1109616228 13:64837287-64837309 GCAATGCAGAGGGAAAACGTGGG + Intergenic
1109830349 13:67778430-67778452 GTAAGGCATATAGAAATGTTTGG - Intergenic
1110035653 13:70679523-70679545 GTTAGCCATAATGAAAAGGTAGG + Intergenic
1110481350 13:75981210-75981232 TTCAAGCATAGGTAAAAGGTAGG + Intergenic
1114438966 14:22730879-22730901 GTGAGCCAAAGGGAAAAGGAAGG + Intergenic
1117732982 14:58742685-58742707 GTAAGGCATGAGGAAAAAGGAGG + Intergenic
1117780698 14:59228774-59228796 GAAAGGCAGAGGGAAAAGGTAGG - Intronic
1120627415 14:86845586-86845608 GAAAGGCATAGACAAAAGTTTGG - Intergenic
1122387385 14:101358388-101358410 GTAGGACATAGGGATAAAGTGGG - Intergenic
1125355480 15:38813227-38813249 GAAGGCCTTAGGGAAAAGGTAGG + Intergenic
1126526814 15:49665349-49665371 ATAAGGAATGGGGAAAAAGTGGG - Intergenic
1126650193 15:50912429-50912451 GTTATGCATTTGGAAAAGGTTGG + Intronic
1128306979 15:66605166-66605188 GTAAGGTGTAGGGAATGGGTGGG + Intronic
1128392278 15:67190388-67190410 GTAAGAAATAGGGAAAGGGGTGG - Intronic
1129160732 15:73746304-73746326 AGAAGGCAAAGGGAAAAGGGAGG + Intronic
1130243903 15:82225142-82225164 GTAAGGGAAAGGGGAAAGTTGGG - Intronic
1130456575 15:84116145-84116167 GTAAGGGAAAGGGGAAAGTTGGG + Intergenic
1130680673 15:85993472-85993494 GGAAGGGAGAGGGAAAAGGCAGG + Intergenic
1131721453 15:95172839-95172861 GTCAGGCAAAGGGATAATGTGGG - Intergenic
1134280554 16:12813294-12813316 CTAAGGCAAAGGGAAAAGTCAGG + Intergenic
1134343029 16:13362662-13362684 ATAAGGCTTAGGGACAAGATGGG - Intergenic
1135082675 16:19449852-19449874 GGAAGGCATAGGGGAAAGAAGGG - Intronic
1136318597 16:29468053-29468075 GGATGGCATAGAAAAAAGGTGGG - Intergenic
1136433169 16:30207399-30207421 GGATGGCATAGAAAAAAGGTGGG - Intronic
1137380257 16:47991822-47991844 ATAATTCATTGGGAAAAGGTGGG + Intergenic
1137826982 16:51506596-51506618 GTGAGGCATAGGAAGAAGGACGG - Intergenic
1138215802 16:55204344-55204366 GAAGGGCAGAGGGAAAAGGAGGG - Intergenic
1138766977 16:59616849-59616871 GCAAGCCATATGGAAAAGGGGGG - Intergenic
1139132462 16:64162838-64162860 GAAAAGCATAGGGCAATGGTGGG - Intergenic
1139349331 16:66325484-66325506 GGAAGGCCGAGGGAAATGGTAGG + Intergenic
1140146306 16:72313434-72313456 ATAAGGTATAGGCAAATGGTAGG + Intergenic
1141067680 16:80927278-80927300 GCCAGGCAATGGGAAAAGGTTGG + Intergenic
1141255396 16:82397347-82397369 GTAAGGAAGTGGGAAAAGCTAGG - Intergenic
1144037551 17:11381203-11381225 GTAAGGGGTAGGGGAAAGGGTGG - Intronic
1146698582 17:34932381-34932403 GTAAGGCATCAGCAAAAGCTTGG + Exonic
1147501402 17:40967560-40967582 AAAAGCCATGGGGAAAAGGTAGG + Intergenic
1149007082 17:51817397-51817419 GTAAGGCCTAGGGCAGAGGTTGG - Intronic
1149310995 17:55393529-55393551 CAAAGGCATAGAGAAAAAGTTGG + Exonic
1151203107 17:72483446-72483468 GAGAGGTATAGGGAAAAGCTGGG - Intergenic
1152261127 17:79267872-79267894 GCAAGGCAGAGAGAAAAGGACGG + Intronic
1153506378 18:5803607-5803629 GTAATGCAGAGGGGAAATGTGGG + Intergenic
1154946079 18:21162498-21162520 GGAAGGTATAGGTAAAAGGCTGG + Intergenic
1155150816 18:23121521-23121543 TTTAGGCATAGGGAGAAAGTCGG + Intergenic
1155868165 18:30992449-30992471 GTGAGCCATAGAGAAGAGGTTGG + Exonic
1157454028 18:47810304-47810326 GTAAGTGGTAGGGAAGAGGTGGG - Exonic
1157602586 18:48903049-48903071 GAGAGGCATAGGGACATGGTTGG - Intergenic
1158261441 18:55610303-55610325 GTAAGGCATAGGGAAAAGGTCGG - Intronic
1158927961 18:62289798-62289820 TTGATCCATAGGGAAAAGGTAGG + Intronic
1159037951 18:63295743-63295765 GGATGGCTTAGGAAAAAGGTTGG - Intronic
1159408448 18:68037211-68037233 GTAATGCCTAGGAAATAGGTGGG - Intergenic
1159461726 18:68729767-68729789 GCAAGTCAAAGGGAAAAGATTGG + Intronic
1160573867 18:79837488-79837510 GTAAAGCAGAGGGGAAATGTGGG - Intergenic
1162350414 19:10145458-10145480 GGAAGGCATCTGGAAAACGTTGG + Intronic
1164462706 19:28462600-28462622 GGAAGGCATAGGGAATGAGTAGG + Intergenic
1164538111 19:29101761-29101783 GTAAGGTATGGGGAAAGGGATGG - Intergenic
1165538751 19:36472747-36472769 GTTAGGTAAAGGGGAAAGGTAGG + Intronic
1165984053 19:39751994-39752016 GTAAAGCAGAGGGAAAAGCAAGG + Intergenic
1166170651 19:41025726-41025748 GTACGGCTTAGGAAGAAGGTGGG + Intergenic
1166392848 19:42419539-42419561 GTAAGGACTAGGGGAGAGGTAGG + Intronic
1167555400 19:50191891-50191913 GGAAGGCAGAGTGAAAAGGAAGG + Intronic
926715075 2:15917959-15917981 CTACAGCATAGAGAAAAGGTTGG - Intergenic
927132642 2:20073416-20073438 GAAAAGCAGAGGGATAAGGTAGG - Intergenic
928554503 2:32409551-32409573 GGACTGCATAGGGAAAAGTTTGG + Intronic
929412255 2:41710147-41710169 GTTAGCCATGGGGAAAATGTTGG + Intergenic
931906017 2:66844818-66844840 GTAAAGCATATGGAAATGGTTGG + Intergenic
932176470 2:69607355-69607377 GTAAGGCAGAGGTAAGAGGAGGG + Intronic
932343565 2:70981615-70981637 GTGAGGCATAGGGAAAGGGCAGG + Intronic
932428564 2:71659414-71659436 GTAAGGCTGAGGGTATAGGTTGG + Intronic
933277391 2:80298680-80298702 TGAAGGCAGAGAGAAAAGGTTGG + Intronic
933323276 2:80804273-80804295 GTCAGGGATTGTGAAAAGGTAGG + Intergenic
933334314 2:80937338-80937360 GGAAGGCATGGGAAAAAGGAAGG - Intergenic
934018483 2:87917172-87917194 GTAAGCAAAAAGGAAAAGGTAGG + Intergenic
934924808 2:98374809-98374831 GCAACGCATAGGGAAAAAATGGG + Intronic
946020672 2:216637774-216637796 GTCAGGCAGAGGGAAGAGGGAGG + Intronic
946268692 2:218570701-218570723 GGAAGGCACAGGGAAAAGAGTGG - Intronic
947244054 2:228027335-228027357 GTAAGTGCTAGGGAAAGGGTCGG + Intronic
948242420 2:236448729-236448751 GTAAGGCAGCGGGACAAGGCTGG + Intronic
948412180 2:237772580-237772602 GTAGGGGGTAGGGAAAAGGGCGG - Intronic
1169078290 20:2776593-2776615 TGAAGACATAGGGAGAAGGTAGG - Intergenic
1169525531 20:6421152-6421174 GTAAGGAATAGGAAAAAGAGTGG + Intergenic
1169693102 20:8355636-8355658 GTAAGGCAAAGTGCAAAGTTTGG + Intronic
1172439167 20:34953525-34953547 GAAAGGGAAAGGGAAAAGGAAGG - Intronic
1172919769 20:38471818-38471840 GGAAGGAAGAGGGAAAAGGAGGG - Intergenic
1177419010 21:20831340-20831362 GTAAGGGATAGGGGGAAGGAAGG - Intergenic
1177803250 21:25848816-25848838 GCAATGCAGAGGGAAAATGTGGG + Intergenic
1178794441 21:35730924-35730946 ATAAGGCAGAGGAAAAAGGCAGG + Intronic
1181958332 22:26604637-26604659 AGAAGGCATAGGCAAAAGCTGGG + Intronic
1182596748 22:31427205-31427227 GTAACTCATAGGAAAAAGGAGGG - Intronic
1182920057 22:34071020-34071042 GTAGGGCAAAGGGAAGAGGAAGG - Intergenic
949334803 3:2962682-2962704 GTAAGACACAGGGAAAGGGAGGG + Intronic
950320473 3:12048010-12048032 GTAAGTCAGAAGTAAAAGGTTGG - Intronic
951240289 3:20278556-20278578 GCAAGGCAAGGAGAAAAGGTAGG + Intergenic
951735396 3:25858008-25858030 GAAAGGCATGGGGCAAAGGTGGG - Intergenic
953247526 3:41208557-41208579 GTGAGGAACAGGGAAAAGCTTGG - Intronic
953550152 3:43895826-43895848 GGAAGGCAGAGGGAAAATGAGGG - Intergenic
954342490 3:49966465-49966487 GTTAGGCAAAGGGAAGAAGTTGG + Intronic
954675103 3:52311306-52311328 CTGAGGCATAGGGCAAAGCTAGG - Intergenic
955061308 3:55493807-55493829 GTAAGGCCAAGGGAAAAAGTGGG - Intergenic
955488914 3:59462971-59462993 GGAAGCCAAAGGGAAAAGGGGGG + Intergenic
955771978 3:62394474-62394496 GGAAGGCTTAGGCAAGAGGTTGG - Intergenic
956613841 3:71151791-71151813 ATAGGGCAGTGGGAAAAGGTAGG - Intronic
957412827 3:79862560-79862582 GCAATGCAGAGGGAAAATGTGGG + Intergenic
958781670 3:98550765-98550787 GTGAGGCAGAGAGGAAAGGTAGG + Intronic
958783074 3:98566219-98566241 GTAGGGCACAGGGAGAGGGTGGG + Intronic
960357187 3:116668031-116668053 GTAAGGAATAAGGAAGAGGGAGG - Intronic
962227032 3:133621767-133621789 GTAAGTCATAGGGAAAGCTTTGG + Intronic
962865900 3:139447929-139447951 GGAAGGCAGAGGGAAGAGGAAGG - Intergenic
963010796 3:140768396-140768418 GTGAGGTACAGGGAGAAGGTGGG + Intergenic
963254631 3:143132582-143132604 GTAATGGATGGGGAAAAAGTAGG + Intergenic
964677818 3:159303372-159303394 GTAAGTTTTAGGGAAAAGGTTGG + Intronic
965152629 3:164999378-164999400 GAAAGGCAGAGGGAAAAGAAAGG - Intronic
965368174 3:167825070-167825092 GAAAGGGAAAGGGAAAAGGAAGG + Intronic
967004362 3:185369596-185369618 GTAAGGCATAGTTAATGGGTGGG + Intronic
967360476 3:188624699-188624721 GAAAGGGAAAGGGAAAAGGAAGG - Intronic
970167797 4:13258102-13258124 GTAAGGCATAGGAAAGACGTGGG + Intergenic
970216475 4:13763954-13763976 TGAAGGCAGAAGGAAAAGGTGGG - Intergenic
970345324 4:15147471-15147493 GTAAGGCATGGGGATATGGGAGG - Intergenic
970454985 4:16214663-16214685 GTAATGCACTGGGAAGAGGTGGG - Intronic
970500975 4:16676890-16676912 GTAGGGCAAAGGGCAGAGGTGGG + Intronic
970518455 4:16858656-16858678 GTAAGGTACAGGAAAAAGGTGGG + Intronic
971224437 4:24737987-24738009 GGCAGGCATAGGGGAAATGTGGG + Intergenic
971392441 4:26198649-26198671 CTAAGGCACAGAGAAAAGTTTGG + Intronic
971569152 4:28187737-28187759 GAGAGACAAAGGGAAAAGGTGGG - Intergenic
972190319 4:36583642-36583664 GTAATGAAGAGGGAAAAGGTGGG + Intergenic
973878729 4:55247525-55247547 GTAAGGAATAGGGAAAAGGCAGG + Intergenic
973911099 4:55581539-55581561 ATAAGGCAGAGGGACATGGTGGG + Intronic
974492790 4:62588577-62588599 GTAGTGCAAAGGGAAAATGTAGG - Intergenic
976780020 4:88748478-88748500 GTAAGTCATACAGAAAAGGTTGG - Intronic
977672484 4:99712124-99712146 GTAAAGCAAAGCAAAAAGGTGGG + Intergenic
978847136 4:113286927-113286949 GAAAGGCATGGAGAAAAGATGGG - Intronic
979951316 4:126897194-126897216 GTAACGCAAAGGGGAAATGTGGG - Intergenic
982258493 4:153472936-153472958 CTAAGGCTTAGGGACAAGGGAGG + Intronic
982778520 4:159466310-159466332 GAAAGGGAAAGGGAAAAGGAAGG - Intergenic
984382404 4:179012559-179012581 GTAAGTCAAAGGGAAAAGTTAGG + Intergenic
986720579 5:10558300-10558322 GGAAGTGATAGGGAAAAGGGTGG + Intergenic
987109510 5:14672232-14672254 GTAATGCATAGGGAAATAATGGG + Intronic
987636198 5:20545366-20545388 GCAATGCAGAGGGAAAATGTGGG - Intronic
987758687 5:22130511-22130533 TTTAGTCATAGGGAAAATGTGGG + Intronic
988579777 5:32458798-32458820 GCAATGCAGAGGGAAAATGTGGG - Intergenic
988674554 5:33418480-33418502 TTAAGGGAGGGGGAAAAGGTGGG + Intergenic
989746855 5:44839520-44839542 GCAAGGCATAGGGGAAATGTGGG + Intergenic
991122558 5:63032799-63032821 GCAATGCAGAGGGAAAATGTAGG + Intergenic
991619824 5:68533941-68533963 GTAAGGTACAGGGAAATGGTGGG - Intergenic
991641679 5:68760634-68760656 ATAAGGCAAAGGTAGAAGGTGGG - Intergenic
992743151 5:79793961-79793983 GTAAGAGATAGGGAAGAGGGAGG + Intronic
993617468 5:90131416-90131438 GGAAGGCAGAGGGGAAAGGTTGG - Intergenic
994241105 5:97422547-97422569 GTGGGGCTTAGGGAAAAGGAAGG - Intergenic
994472834 5:100231082-100231104 GTAAGGCATAGGCAAATGCCTGG + Intergenic
995446265 5:112247429-112247451 GAAAGGCACAGGGAAATGGCGGG - Intronic
995484382 5:112625100-112625122 GTAAGGTAAAGAGAAAAGTTGGG - Intergenic
995494752 5:112729511-112729533 CTAAGGCATAAGAAAGAGGTAGG + Intronic
997126664 5:131233982-131234004 GTAAGGAAAGAGGAAAAGGTAGG - Intergenic
997591577 5:135076476-135076498 GAAAGGCAAAGAGAAAAGGGGGG - Intronic
997806690 5:136924724-136924746 GAAAGGCAAAGAGAAAAGGCTGG - Intergenic
997859747 5:137405698-137405720 GCAAGGGAAAGAGAAAAGGTTGG + Intronic
998091577 5:139373995-139374017 GTGAGGCCTAGGAAAAAGGAGGG - Intronic
998162213 5:139820048-139820070 GTTGGGCAGAGGGGAAAGGTCGG + Intronic
998831102 5:146160086-146160108 GAAAGGTAATGGGAAAAGGTAGG + Intronic
999827237 5:155285504-155285526 GTCAGGCATAGGGAAGTGTTCGG + Intergenic
1001532868 5:172476829-172476851 GTATGGCATAAGGAAAGCGTGGG + Intergenic
1002100459 5:176855201-176855223 GTAAGGCTGAGGGTAAAGGCAGG - Intronic
1003099492 6:3166151-3166173 TTAAGTCAAAGGGAAAAGCTTGG + Intergenic
1003237900 6:4315100-4315122 AAAAGGCATAGGGAATTGGTGGG - Intergenic
1004815116 6:19304265-19304287 CTAAGACCTAGAGAAAAGGTAGG - Intergenic
1005404899 6:25476205-25476227 GGAAAGCAGAGGGAAAAAGTAGG - Intronic
1005939075 6:30547311-30547333 GTAAGGGAAAGAGAGAAGGTGGG - Intronic
1007025694 6:38570714-38570736 GCAAGGCATAGGAGAAATGTGGG - Intronic
1007975253 6:46094850-46094872 GCAATGCAGAGGGAAAATGTGGG - Intergenic
1008413826 6:51215978-51216000 GTAAGCCAGAGGAAAAAGGTGGG + Intergenic
1010821724 6:80422393-80422415 GCAATGCAGAGGGAAAAGGTGGG + Intergenic
1012343992 6:98164801-98164823 ATAAGGAATGGGGAAAAGATGGG - Intergenic
1013401098 6:109797011-109797033 CTGAGGGATAGGGAAGAGGTTGG + Intronic
1013638715 6:112053023-112053045 GTAAGGCAGCAGGAAAAGGAGGG + Intergenic
1013911951 6:115286360-115286382 TTAAGGGAAAGGGAAGAGGTTGG - Intergenic
1017443036 6:154482165-154482187 CTTAGGCATAGGGAGAATGTGGG - Intronic
1022141361 7:27495739-27495761 GTACTGCATGGGGAAACGGTTGG + Intergenic
1022550521 7:31235115-31235137 GAAAGTCAAAGGGAAGAGGTCGG - Intergenic
1023337007 7:39180835-39180857 GGAAGGCAAAGGGAAAAGGTTGG - Intronic
1027164609 7:75825501-75825523 GGAAGGCAAAAGGAAGAGGTGGG + Intergenic
1027909823 7:84236119-84236141 TGAAGGCATAGGGGAAAGTTTGG - Intronic
1028757618 7:94455969-94455991 GTAAGGGAAAGGGAAAGGGAAGG + Intergenic
1029448608 7:100628177-100628199 GTTAGGCATTGGGGAGAGGTGGG - Intronic
1029812208 7:103060840-103060862 GTAGGGGATAGGGAAATGGAAGG - Intronic
1030242652 7:107345555-107345577 GTAAGGGGTAGGGAAATGGGAGG + Intronic
1030964858 7:115979123-115979145 GTCAGGGATAGGGAACAGCTGGG - Intronic
1033380822 7:140816565-140816587 GAATGGCAAAGGGAAAAGATAGG - Intronic
1033980304 7:147156048-147156070 GTAAGGCGTGAGGAAAAAGTAGG - Intronic
1034834826 7:154342416-154342438 TTAATGCATTGAGAAAAGGTAGG - Intronic
1038350233 8:26769970-26769992 GTAGGGCACAGGGAAGAGGGAGG - Intronic
1038961679 8:32527010-32527032 CTGGGGCATAGGGGAAAGGTTGG - Intronic
1039364185 8:36913325-36913347 GAAAGGCAAAGAGAAAAGGAAGG + Intronic
1039364189 8:36913364-36913386 GAAAGGCAAAGAGAAAAGGAAGG + Intronic
1039590464 8:38742261-38742283 GTGAGCCTTAGGCAAAAGGTTGG + Intronic
1040674056 8:49727422-49727444 GAAAGGCATATGAAAAATGTCGG - Intergenic
1041013855 8:53571356-53571378 GTAATGCAGAGGGGAAATGTGGG + Intergenic
1045081987 8:98635878-98635900 GTAAGTAATAGGGGAAAGATTGG - Intronic
1048096439 8:131300454-131300476 GAAATGCAGAGGGAAAATGTGGG - Intergenic
1051301676 9:15658173-15658195 GTAGAGCTTAGGGAAAAGTTTGG + Intronic
1052322584 9:27184179-27184201 TGAAGGCAAAGGGAAGAGGTGGG - Intronic
1052462125 9:28778285-28778307 ATAAGTCATAAGGAAAAGGATGG + Intergenic
1053027665 9:34743751-34743773 CTAAGACATAGGGAAAGGGTGGG - Intergenic
1054892066 9:70261416-70261438 GTGAGGCATGGGGGAAAGGGAGG + Intronic
1055192805 9:73547078-73547100 GCATGGCAGAGGGAAAAGTTGGG - Intergenic
1055698668 9:78917393-78917415 GCAATGCAGAGGGAAAATGTGGG + Intergenic
1057188901 9:93075271-93075293 GGAAAGCATAGGTCAAAGGTTGG - Intronic
1057771135 9:97969024-97969046 GTAAGGAATTGAGAAAAAGTAGG - Intergenic
1059834359 9:118134081-118134103 GTTAGTCATTTGGAAAAGGTTGG - Intergenic
1186488544 X:9953035-9953057 GTAGTGCACAGGGAAAATGTAGG - Intergenic
1186901382 X:14060908-14060930 ATAAAGGAAAGGGAAAAGGTAGG - Intergenic
1188440401 X:30210263-30210285 CTAAGCCAAAGGGAAAAGCTGGG + Intergenic
1188498659 X:30803361-30803383 GTAAGGCACAAGGCAAAGCTAGG - Intergenic
1188651065 X:32632482-32632504 GCAATGCAGAGGGAAAATGTGGG - Intronic
1188710376 X:33389747-33389769 GCAAATCATAGGGAAAAGGATGG + Intergenic
1190522481 X:51294413-51294435 GTAGGGTAAAGGGAAAAGGAAGG + Intergenic
1190543770 X:51504062-51504084 GTAGGGTAAAGGGAAAAGGAAGG - Intergenic
1192435549 X:71141450-71141472 GTATGGAATAGGGTAGAGGTGGG + Intronic
1193450456 X:81658586-81658608 CTGAGGCATAAGCAAAAGGTGGG - Intergenic
1193669136 X:84362344-84362366 ATAAGGCATCAGGAAAAGCTAGG + Intronic
1193876587 X:86869254-86869276 GAAAAGCATAGGGAAAAGTAAGG - Intergenic
1194115331 X:89889211-89889233 GAAAGGGACAGTGAAAAGGTAGG - Intergenic
1194495849 X:94615942-94615964 GCAATGCAAAGGGAAAATGTGGG - Intergenic
1195669600 X:107458530-107458552 GCACAGCATAGGGAAAAGGCTGG + Intergenic
1196004037 X:110816622-110816644 GTGAGGGATAAGGACAAGGTAGG + Intergenic
1196141244 X:112265753-112265775 GGAAGGGAAAGGGAAAAGGGAGG - Intergenic
1199126048 X:144121966-144121988 GTAAGCAAAAAGGAAAAGGTAGG - Intergenic
1199219200 X:145297406-145297428 GTAATGCTGAGTGAAAAGGTGGG - Intergenic
1199545886 X:149006994-149007016 CTAAGGCACAGAGAAAAGGATGG - Intergenic
1200468123 Y:3546350-3546372 GAAAGGGACAGTGAAAAGGTAGG - Intergenic
1200708466 Y:6463077-6463099 GTAAGGCATAGAATAAAGGGAGG - Intergenic
1201025646 Y:9701631-9701653 GTAAGGCATAGAATAAAGGGAGG + Intergenic
1202182456 Y:22151184-22151206 GTAAGGCATAGAATAAAGGGAGG - Intergenic
1202208904 Y:22435218-22435240 GTAAGGCATAGAATAAAGGGAGG + Intergenic