ID: 1158264129

View in Genome Browser
Species Human (GRCh38)
Location 18:55640897-55640919
Sequence GGATGGACTCAACACTAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158264126_1158264129 30 Left 1158264126 18:55640844-55640866 CCAAATGAAAATTCTAGAGTTGC 0: 1
1: 1
2: 26
3: 108
4: 500
Right 1158264129 18:55640897-55640919 GGATGGACTCAACACTAGAGTGG 0: 1
1: 0
2: 3
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158264129 Original CRISPR GGATGGACTCAACACTAGAG TGG Intronic
900236911 1:1597418-1597440 GGAGTGACTCATCCCTAGAGGGG - Intergenic
904404830 1:30279827-30279849 AGATGGACTGAATAGTAGAGTGG + Intergenic
908575818 1:65458959-65458981 TGATGGACTCAGCAGTAGACTGG - Intronic
908696636 1:66849793-66849815 GGATGGGCTCAACAGCAGAATGG + Intronic
908816270 1:68038487-68038509 AGATGGACTTAATAGTAGAGTGG - Intergenic
908840684 1:68277211-68277233 GGATGGCCTCTATACCAGAGAGG + Intergenic
910529190 1:88216207-88216229 GGATGGGCTCAGTATTAGAGTGG - Intergenic
910548557 1:88449536-88449558 GGATGGGCTCAACAGTAAAATGG - Intergenic
914349442 1:146827543-146827565 GGATGGGCTCAACAACACAGAGG + Intergenic
915032077 1:152889021-152889043 GGATGGATTCAAGACTTCAGTGG - Intergenic
915862626 1:159462435-159462457 GTATGTACTCAACACTAGACAGG - Intergenic
919420504 1:197364663-197364685 GAATGGGCTCAATACTAGATGGG - Intronic
924074335 1:240317548-240317570 TGAGGCACTCAACACTTGAGTGG - Intronic
1063606670 10:7528514-7528536 GGATGCACTCATCACTGGATGGG - Intergenic
1067241503 10:44498825-44498847 GGATGGATTCAATGGTAGAGTGG + Intergenic
1067727569 10:48782134-48782156 GGCTGGACTTATCATTAGAGAGG + Intronic
1073161682 10:101403505-101403527 GGATGGTCTCAACAGCAGAATGG - Intronic
1073337903 10:102724326-102724348 GGATGGACTCATCAGTAGACTGG - Intronic
1077924474 11:6667137-6667159 TGATGGACTCATCAGTAGACTGG - Intergenic
1078404087 11:11054030-11054052 GGATGGGCTCAACAGCAGAATGG - Intergenic
1081508345 11:43741819-43741841 GGATGGAGTGAACCCAAGAGGGG - Intronic
1084754428 11:71226184-71226206 GGATGGACTCAACAGCAGAATGG + Intronic
1085060296 11:73439744-73439766 GGAGGTACTCAACACTTTAGAGG + Intronic
1087859151 11:103132262-103132284 GGATGGACTCAATAGCAGAGTGG - Intronic
1089303015 11:117509858-117509880 GGCTGGACTCCACAGTAAAGAGG - Intronic
1094799863 12:34021144-34021166 GCATGGACTCAACAATAAAATGG + Intergenic
1102642045 12:114375423-114375445 GGATGAACTCAACTCAATAGTGG + Intronic
1104245478 12:127036165-127036187 GGATAGGCTCAATAGTAGAGTGG + Intergenic
1107495990 13:40926421-40926443 GGATGGCCTCGACATTAGATTGG - Intergenic
1107689438 13:42937729-42937751 TGATGGACTCAAGACTTCAGTGG - Intronic
1109822421 13:67675382-67675404 AGATAGACACAACACTAGTGGGG - Intergenic
1112577999 13:100653979-100654001 CGATGGAGTCACCACCAGAGTGG - Intronic
1114808532 14:25868212-25868234 GGTTGGGCTCAACAGTAGATTGG - Intergenic
1116379064 14:44241802-44241824 GCATGGAAGCAACAATAGAGTGG + Intergenic
1117009218 14:51453234-51453256 AGATGGATTCAAAACCAGAGAGG + Intergenic
1117855236 14:60024363-60024385 GGATGTAGTCAACAATAGATAGG + Intronic
1118229980 14:63938739-63938761 GGAAAGCCTCAACACCAGAGAGG + Intronic
1118504809 14:66399664-66399686 GGATGGACTCCATACTCAAGGGG + Intergenic
1118562128 14:67097192-67097214 GGATGCACGCAACTCTTGAGGGG + Intronic
1119126391 14:72131065-72131087 GGGTGGACACAACACAAGATGGG - Intronic
1124623254 15:31291974-31291996 GGATGGACTCAATAACAGAATGG - Intergenic
1124723180 15:32131451-32131473 GGCTGGGCTCAATAGTAGAGTGG - Intronic
1125005166 15:34808622-34808644 GGATGGGCTCAATAATACAGTGG + Intergenic
1125326775 15:38543666-38543688 GGATGGGCTTAATACTATAGTGG - Intronic
1126401496 15:48275929-48275951 GCATGGACTCAGGACTAGAATGG + Intronic
1127234439 15:57033049-57033071 GGATGGACTCAATAACAGAATGG + Intronic
1129148067 15:73668041-73668063 GGATGGATTTAACATTAGACAGG - Intergenic
1135750074 16:25051045-25051067 GGATGGATTCAACACCAGCCTGG + Intergenic
1136929917 16:34409691-34409713 GGATGGCCTCAAAAATGGAGTGG - Intergenic
1136974657 16:35002114-35002136 GGATGGCCTCAAAAATGGAGTGG + Intergenic
1139984594 16:70888011-70888033 GGATGGGCTCAACAACACAGAGG - Intronic
1140099995 16:71907751-71907773 GTATGGACTAAACACCAGAATGG - Intronic
1142116974 16:88362977-88362999 GGATGGGCTCTACAGTAGAATGG - Intergenic
1144759280 17:17698306-17698328 GGTGGGACTCAACTCTTGAGTGG - Intronic
1145069747 17:19794079-19794101 TGATGGACTCATCAGTAGACTGG + Intronic
1148459244 17:47828778-47828800 AGCTAGACTCAACACAAGAGTGG + Intronic
1152212985 17:79012986-79013008 GAATGGATTAAACACTACAGGGG + Intergenic
1158248734 18:55462702-55462724 GGATGAACTAAACAATTGAGGGG + Intronic
1158264129 18:55640897-55640919 GGATGGACTCAACACTAGAGTGG + Intronic
1164706819 19:30325919-30325941 GGAGGGGCTCCACAGTAGAGAGG - Intronic
925595718 2:5553558-5553580 GGCTGGACTCTAGACTAGACTGG - Intergenic
925758613 2:7160998-7161020 TGATGGACTCATCAGTAGACTGG - Intergenic
926772459 2:16390694-16390716 GGATCGACTCAACCATGGAGAGG + Intergenic
927230188 2:20815162-20815184 GGATGGGCTCAATAGTGGAGTGG + Intronic
927614642 2:24580535-24580557 GGATGGATGCAACAGTAGAATGG - Intronic
928662818 2:33520751-33520773 GGATGGACTCAGAACAAGTGGGG - Intronic
929090438 2:38211437-38211459 GGATGGGCTCAACAGCAGAATGG + Intergenic
931811149 2:65856345-65856367 GGATGCACCCAACACTTGACTGG - Intergenic
932266060 2:70367780-70367802 GGCAGGACTCAACTCTGGAGGGG + Intergenic
933872025 2:86576023-86576045 GGATGGGCTCAACAGTATATTGG + Intronic
933892049 2:86781050-86781072 GAATGGATCCAACACTTGAGCGG - Intergenic
934989093 2:98908727-98908749 TGATGGAGGCAACACCAGAGAGG - Intronic
935409289 2:102742250-102742272 TGATGGACTCATCAGTAGATTGG + Intronic
937240421 2:120457458-120457480 GGATGAGCTCAACAGTAGAATGG + Intergenic
937350600 2:121158219-121158241 GAATGGATTCAACAGTAGAATGG - Intergenic
940079671 2:149786963-149786985 GGATGGGCTCAATAGTAGAATGG - Intergenic
940853770 2:158713893-158713915 TGATGGACTCAACAAGAGAATGG - Intergenic
940894570 2:159068197-159068219 GCATGGACTCAACATATGAGTGG - Intronic
945197852 2:207253990-207254012 GGATAGACTCAACAGCAGTGAGG + Intergenic
946838403 2:223795821-223795843 TGCTGGACTCTACACTATAGAGG - Intronic
948001882 2:234574599-234574621 GGATGGGCTCAATAGTAGAGTGG + Intergenic
1169237225 20:3940312-3940334 GGATGGGCTCAACAGCAGAATGG + Intronic
1172312829 20:33931572-33931594 GGCTGGCTTCAAGACTAGAGGGG + Intergenic
1172858329 20:38025817-38025839 GGATGGGCTCAACAGCAGAATGG + Intronic
1173268541 20:41510059-41510081 GGATGGAGTCAGCACCAGAATGG - Intronic
1175039532 20:56034408-56034430 GGATGGACTTAATACTATAATGG + Intergenic
1183746684 22:39695739-39695761 GGAGAGACTCCACACCAGAGAGG + Intergenic
953038112 3:39230857-39230879 GGATGGGCTCAACACCAGAATGG - Intergenic
953089654 3:39712219-39712241 GGATGAGCTTAACAATAGAGTGG + Intergenic
953340552 3:42130928-42130950 TTATGGACACAACTCTAGAGTGG - Intronic
955119331 3:56040938-56040960 GGAAGGACTCAACGGTAGAGTGG - Intronic
961657351 3:128450507-128450529 GGATGGACTCAACACTTCTCTGG - Intergenic
962847855 3:139287012-139287034 GGCTGGACCCAACTCTGGAGTGG - Intronic
964089121 3:152852032-152852054 AGATGGACTCAACAGCAGAGTGG + Intergenic
964546796 3:157843188-157843210 GGATAGATTGAACACAAGAGGGG + Intergenic
966730853 3:183150246-183150268 GCAGGGACTCAACACTTGGGTGG + Intronic
967579864 3:191139434-191139456 GGATGGACTCTAAGCTTGAGAGG + Intergenic
968325402 3:197809680-197809702 GGATGGGTTCAACAGCAGAGCGG - Intronic
970330145 4:14974128-14974150 GGATGGACTCAACAGCTGAATGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
980144758 4:128968346-128968368 AGATGGACTCAAAAATAGATTGG - Intronic
982210440 4:153030495-153030517 GGATGGGCTCAACAGCAGAATGG + Intergenic
985815215 5:2123376-2123398 GGATGGGCTCAACAGTAAAGTGG - Intergenic
988660027 5:33255784-33255806 GTAAGGACTCAACACTTGTGAGG - Intergenic
988663042 5:33294256-33294278 GGATGGGCTCAACAGCAGAATGG + Intergenic
990778261 5:59328574-59328596 CGATGGACTCTACACTTCAGAGG + Intronic
995312030 5:110724252-110724274 GGATGGCATCAACTCCAGAGAGG - Intronic
999250957 5:150182053-150182075 GGATGGCCTCAACATCAGACAGG - Intronic
1000263155 5:159609333-159609355 GGATGGGCTTAACATTAGACTGG - Intergenic
1001896258 5:175384365-175384387 GGATGGGCTCAACAGCAGAATGG + Intergenic
1001943544 5:175758024-175758046 GGATGGGCTCAGCAGTAGAATGG + Intergenic
1003027988 6:2575725-2575747 GAATGGGCTCAACACCAGAATGG - Intergenic
1005078733 6:21935210-21935232 GGATGAACTCAAAAGCAGAGTGG - Intergenic
1005171660 6:22992905-22992927 GAATGGACTCAACAGTAGAGTGG - Intergenic
1006052196 6:31353768-31353790 TGATGGACTCAACACCAAATGGG + Intronic
1007679222 6:43622888-43622910 TGAGGGACTCAACCCTAGAAGGG - Intronic
1007882847 6:45186509-45186531 GGATGCACTCAATGTTAGAGTGG + Intronic
1008328743 6:50219970-50219992 GGATTGAAGTAACACTAGAGAGG - Intergenic
1011357936 6:86491800-86491822 GGATGGATCCAGCAGTAGAGTGG - Intergenic
1017239208 6:152148177-152148199 GGATGGAGTCCACACTAGCCGGG + Exonic
1018691888 6:166353096-166353118 GGATAGCCTCAGCATTAGAGGGG + Intergenic
1019226492 6:170514835-170514857 AGATGGACTCAACAGCAGAATGG + Intergenic
1019582833 7:1775995-1776017 GGATGGGCTCAATATTAGAATGG - Intergenic
1021338097 7:19428952-19428974 TGATGGGCTCATCACTAGACTGG + Intergenic
1022856257 7:34317690-34317712 GTACGGCCTAAACACTAGAGAGG - Intergenic
1027159683 7:75793200-75793222 GTAAGGACACAATACTAGAGAGG + Intergenic
1027533027 7:79359215-79359237 GGATGGACTTAATAATAGAATGG + Intronic
1028066361 7:86390210-86390232 GGATGAACTCAAGAGTAGAATGG - Intergenic
1028706939 7:93859896-93859918 GGATGGACTCAGTAGTACAGTGG + Intronic
1029856205 7:103519459-103519481 GGATGAACTCAGCATTAGTGAGG + Exonic
1034031073 7:147764224-147764246 GGAGGGACTCTACACTGTAGAGG - Intronic
1034715711 7:153239463-153239485 GGATGCACTCAAGAACAGAGTGG + Intergenic
1038825124 8:30991112-30991134 GGATGGGCACAGCAATAGAGTGG + Intergenic
1038947560 8:32378010-32378032 GGATGAACACAAAAGTAGAGTGG + Intronic
1039006753 8:33046589-33046611 GGATGGACTCAACAACAGAATGG + Intergenic
1039797329 8:40926478-40926500 TGATGGAACCAGCACTAGAGAGG - Intergenic
1041681191 8:60593997-60594019 GAATGGACTCAACAGCAGAATGG + Intronic
1042421891 8:68601494-68601516 GGATGGATTCAACAGTAGAGTGG - Intronic
1042465090 8:69120419-69120441 GAATGGACTTAATATTAGAGTGG - Intergenic
1043200135 8:77358257-77358279 GGATGTACTCAACAGCAGAATGG - Intergenic
1045582246 8:103494831-103494853 GGTTGGAGGCAACGCTAGAGAGG + Intergenic
1048054179 8:130847632-130847654 GGGTAGACTGAACCCTAGAGGGG + Intronic
1053188664 9:36040699-36040721 GGGTTGACTCAAGAGTAGAGTGG + Intronic
1053434791 9:38067837-38067859 GTAGAGACTCAACACCAGAGCGG + Intronic
1053869321 9:42473646-42473668 GGATGATCTCAACACAAGACTGG - Intergenic
1056388207 9:86116807-86116829 GGATGGAAAGAACACAAGAGTGG + Intergenic
1058339987 9:103883122-103883144 GGATTGACTCAATAGTAGAATGG - Intergenic
1187673052 X:21687398-21687420 GGCTGGACTCTACACTTGAGAGG + Intergenic
1188457511 X:30383531-30383553 TGATGTACTCATCAGTAGAGTGG - Intergenic
1189943336 X:46151528-46151550 GGATGGGATCAATAGTAGAGTGG - Intergenic
1190080232 X:47351163-47351185 GGATGGGCTCAATAGTAGAATGG - Intergenic
1190389173 X:49914737-49914759 GGATGGGCTCAACAGCAGAATGG + Intergenic
1191923354 X:66280629-66280651 GGATGGGCTGAACAGTAGAATGG + Intergenic
1192014882 X:67318548-67318570 GGATGGGCTCAACAGGAGAATGG - Intergenic
1192256454 X:69464563-69464585 AGATGGGTTCAATACTAGAGTGG - Intergenic
1192582350 X:72294865-72294887 GGATGGACTCAATAATAGAGTGG - Intronic
1192950562 X:76011842-76011864 GGATGGACTCTCAACTGGAGGGG + Intergenic
1194140376 X:90201929-90201951 GGATTGGCTCAATAGTAGAGTGG - Intergenic
1199692974 X:150322798-150322820 GGATAGACTCAATAGTAGATTGG + Intergenic
1200486122 Y:3770897-3770919 GGATTGGCTCAATAGTAGAGTGG - Intergenic