ID: 1158265639

View in Genome Browser
Species Human (GRCh38)
Location 18:55658068-55658090
Sequence CAAGTTAGCCCCATTCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158265639_1158265640 -10 Left 1158265639 18:55658068-55658090 CCAATTTGAATGGGGCTAACTTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1158265640 18:55658081-55658103 GGCTAACTTGTGTAACCACTAGG 0: 1
1: 0
2: 2
3: 16
4: 107
1158265639_1158265644 7 Left 1158265639 18:55658068-55658090 CCAATTTGAATGGGGCTAACTTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1158265644 18:55658098-55658120 ACTAGGATATTGCGGAATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 60
1158265639_1158265643 6 Left 1158265639 18:55658068-55658090 CCAATTTGAATGGGGCTAACTTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1158265643 18:55658097-55658119 CACTAGGATATTGCGGAATCAGG 0: 1
1: 0
2: 0
3: 0
4: 35
1158265639_1158265641 -1 Left 1158265639 18:55658068-55658090 CCAATTTGAATGGGGCTAACTTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1158265641 18:55658090-55658112 GTGTAACCACTAGGATATTGCGG 0: 1
1: 3
2: 9
3: 37
4: 110
1158265639_1158265645 28 Left 1158265639 18:55658068-55658090 CCAATTTGAATGGGGCTAACTTG 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1158265645 18:55658119-55658141 GGTCTGTGACTTCTAAGTCTAGG 0: 1
1: 0
2: 2
3: 55
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158265639 Original CRISPR CAAGTTAGCCCCATTCAAAT TGG (reversed) Intronic
909638941 1:77850318-77850340 CAGGTTAGCCCTATTCAATGTGG + Intronic
910960270 1:92754788-92754810 CAAGTCAGCCCTATTCAACATGG + Intronic
915659328 1:157389125-157389147 AACATTAGCCCCATTCCAATGGG + Intergenic
917495052 1:175532960-175532982 CAGGTTAGCCCCATTTAATGAGG + Intronic
918346584 1:183612859-183612881 TAAGTTAACCTCATTAAAATGGG + Intergenic
1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG + Intergenic
1066717200 10:38298826-38298848 CAAGTAAGCCCCATGAAAACAGG + Intergenic
1067143567 10:43676803-43676825 CAAATTCGCCGCATTCAAGTGGG - Intergenic
1075009697 10:118857076-118857098 CAACTTAGCCCAATATAAATAGG + Intergenic
1078288162 11:9979167-9979189 CCAATTAGCCCCACTAAAATGGG + Intronic
1079588978 11:22159263-22159285 CAAGGTAATGCCATTCAAATGGG - Intergenic
1093923742 12:24888943-24888965 CAAGATAGCTCCAATCAACTAGG + Intronic
1096646950 12:53044010-53044032 CAAGTTAGCCCTTTTGAAGTAGG - Intergenic
1100718621 12:97331519-97331541 CAGTTTTGCCCAATTCAAATGGG - Intergenic
1100813113 12:98360004-98360026 CAAGGCAGCCCCTTACAAATGGG + Intergenic
1108365946 13:49712943-49712965 TTAGTTAGGCCCATTCACATAGG - Intronic
1109800277 13:67368356-67368378 CAAGTTATCACCATATAAATGGG + Intergenic
1112951976 13:105009794-105009816 CAAAATATTCCCATTCAAATTGG - Intergenic
1113550280 13:111187515-111187537 CAAGTAAACCCAACTCAAATTGG - Intronic
1114922346 14:27348574-27348596 CAAAGTAGCCCCATTAAAACAGG - Intergenic
1116306217 14:43260132-43260154 CAAGTTTGCCGCAGTGAAATAGG - Intergenic
1117393057 14:55280948-55280970 CTAGTTAGCCACATTAAAAAAGG + Intronic
1125486845 15:40117056-40117078 CAAGTGAACCCTTTTCAAATGGG - Intergenic
1140799757 16:78475500-78475522 CAAGTCAGCCTTATTAAAATAGG - Intronic
1155611442 18:27672168-27672190 CACATTTGCCCCCTTCAAATTGG - Intergenic
1155657058 18:28204728-28204750 GTAGTTACCCCCATTGAAATGGG - Intergenic
1157963750 18:52184823-52184845 CAAGTTCACACAATTCAAATTGG - Intergenic
1158265639 18:55658068-55658090 CAAGTTAGCCCCATTCAAATTGG - Intronic
1159946767 18:74449716-74449738 AAAGTCAGCCCCAGGCAAATAGG - Intronic
1160446614 18:78932821-78932843 AAATTTAACCCCAATCAAATCGG + Intergenic
929191712 2:39146441-39146463 CAAGTCATCCCCATTCAATGTGG + Intergenic
935440602 2:103090974-103090996 TAAATTAACACCATTCAAATAGG - Intergenic
1168829537 20:837797-837819 CAAGTCACCCCCATTCAAGCTGG - Intronic
1169402317 20:5293479-5293501 CAAGAAAGCCTCATTGAAATGGG + Intergenic
1178329772 21:31677783-31677805 CAAGGTAGCCCCACTCCAACAGG - Intronic
1185028650 22:48430002-48430024 CCTGTTAGGGCCATTCAAATGGG + Intergenic
951040359 3:17982615-17982637 CTAGCTAGCCCTAGTCAAATGGG - Intronic
954462475 3:50635207-50635229 CAAGTTGGCCTCCTTCACATAGG - Intronic
955857909 3:63293959-63293981 CAATTTAGCCCCTAACAAATGGG + Intronic
958546265 3:95555423-95555445 CAAGTTAGCACCCTTAAAAATGG - Intergenic
959563285 3:107807316-107807338 CAACTTAACCCCATTCATGTAGG + Intronic
965188286 3:165494454-165494476 AAAATTATCCTCATTCAAATGGG - Intergenic
965462017 3:168977692-168977714 CATGCTTGCCCCTTTCAAATAGG + Intergenic
972619111 4:40729862-40729884 CAAGTTAGCATCATTGAAAGGGG - Intergenic
979150071 4:117300646-117300668 GAAGTCAGCTGCATTCAAATAGG + Intergenic
979787834 4:124739030-124739052 CAAGTTAGCCAGATTCAGAGTGG + Intergenic
984889576 4:184479002-184479024 AAAGTTGACCCCTTTCAAATGGG + Intergenic
991216300 5:64160367-64160389 CAAGTTATCCCCTTTCCACTTGG + Intergenic
992213670 5:74505220-74505242 CAAATTAGCAGCAGTCAAATGGG + Intergenic
994671977 5:102773011-102773033 CAAGTAACACCCATTAAAATTGG - Intronic
995236925 5:109839741-109839763 GAAGTTAGCTCCATTCAAGTTGG + Intronic
995613737 5:113938643-113938665 CTATTTAGGCCCATTCAAACTGG + Intergenic
999703415 5:154249345-154249367 CAAGTGAGCTCCATTCCAGTGGG + Intronic
1005525972 6:26649401-26649423 CAAGGTAGCCACATGAAAATAGG + Intronic
1007477906 6:42131388-42131410 CAAAACAGCCCCATGCAAATTGG + Intronic
1008418162 6:51267308-51267330 CAGGTTAGCCCAATTCCAAAGGG + Intergenic
1010746347 6:79566335-79566357 CAAACATGCCCCATTCAAATAGG + Intergenic
1014883871 6:126756274-126756296 CAATTTATCCCAATTGAAATGGG - Intergenic
1017053993 6:150421558-150421580 CAAGTCAGCCTTATTCAAAGTGG - Intergenic
1017830424 6:158123097-158123119 CAAGTTAGCAGAATTCAAATTGG + Intronic
1021210222 7:17841617-17841639 CAAGTGTGGCCCATTCAAAGAGG + Intronic
1021745141 7:23732992-23733014 GAAGTTATCACCAATCAAATGGG - Intronic
1024262065 7:47580725-47580747 CAAGTAAACCTCATTCAAAAGGG + Intronic
1024634159 7:51273748-51273770 CAAGTTAGCTATTTTCAAATAGG - Intronic
1024967634 7:55038254-55038276 CAAGTTAGCAGCCTTCAAACTGG - Intronic
1027600047 7:80228735-80228757 AAAGTTAGACCCTTTAAAATAGG + Intergenic
1032722309 7:134560295-134560317 CAAGTTAGCCTCATGGAAAACGG + Intronic
1038791700 8:30673786-30673808 CAAGTTTGCCCCAGTCACCTTGG - Intergenic
1041187442 8:55315510-55315532 CAAGTTATTCCCATTCAAACGGG - Intronic
1041197289 8:55412675-55412697 CTAGTCAGCCTGATTCAAATAGG + Intronic
1041606878 8:59792511-59792533 CAAATTAGCCACAGTAAAATAGG + Intergenic
1045601043 8:103717063-103717085 CAAGTTTTCCCATTTCAAATTGG + Intronic
1048831375 8:138480507-138480529 CAAGTTGTCCACACTCAAATAGG + Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1055082815 9:72283783-72283805 CAAGTCAGCCCTATTCAATATGG + Intergenic
1059692413 9:116698595-116698617 CATGTTGGCCCCCTCCAAATTGG + Exonic
1059795593 9:117693117-117693139 CAAATCAGCCCCATGCAAACAGG - Intergenic
1061158458 9:128879560-128879582 CAAGTTAGACCCATTCAGTCTGG - Intronic
1188459134 X:30402827-30402849 CAAGGAAGCCACATTAAAATAGG - Intergenic
1194042100 X:88953728-88953750 CAAATTAACACAATTCAAATTGG + Intergenic
1195777618 X:108425074-108425096 AAAGTATGCACCATTCAAATGGG + Intronic
1200006948 X:153092754-153092776 CAATTTTCCCCCTTTCAAATTGG - Intergenic