ID: 1158265754

View in Genome Browser
Species Human (GRCh38)
Location 18:55659287-55659309
Sequence CAGATTAAACTTCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158265754_1158265757 -9 Left 1158265754 18:55659287-55659309 CCTTCCTCCTGAAGTTTAATCTG 0: 1
1: 0
2: 0
3: 16
4: 236
Right 1158265757 18:55659301-55659323 TTTAATCTGTTTCCCTCCCCAGG 0: 1
1: 0
2: 0
3: 33
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158265754 Original CRISPR CAGATTAAACTTCAGGAGGA AGG (reversed) Intronic
901750754 1:11406176-11406198 AAGAATAAACTTCAGGAAAAAGG - Intergenic
903403128 1:23072361-23072383 CACATTAAAATACAGGAGCAGGG - Intronic
904972796 1:34432262-34432284 CTGGTTAAACTTGAAGAGGAGGG + Intergenic
907229760 1:52985319-52985341 CAGTTTAAGCAACAGGAGGATGG - Intronic
907315106 1:53564003-53564025 AAGAATAAGCTTCAGGAAGAAGG + Intronic
908468538 1:64418966-64418988 AAGATTAAAATTCAGGAAGAAGG - Intergenic
910571650 1:88711802-88711824 CAGTCAAAATTTCAGGAGGAAGG + Intronic
911974543 1:104474852-104474874 CAGATTATACTTCAGGAGACAGG - Intergenic
912254976 1:108049081-108049103 AAGATTGAAGTACAGGAGGAAGG - Intergenic
913429167 1:118770658-118770680 CAGTTAATACTCCAGGAGGAAGG - Intergenic
914202070 1:145494274-145494296 AAGATGAAACTTCTGGAAGATGG + Intergenic
915610076 1:156984764-156984786 AATATTAGTCTTCAGGAGGATGG - Intronic
917527341 1:175800662-175800684 CAGATTTGACTGCAGGAGGGTGG + Intergenic
918526934 1:185474918-185474940 CAGATTATGCTGCAGGAGGGAGG - Intergenic
918950866 1:191135241-191135263 CTGATAAAACTTCAGCAGGTTGG - Intergenic
919033954 1:192282052-192282074 ATGATTCAACTTCATGAGGAAGG - Intergenic
919415229 1:197300235-197300257 CTGATTAAGCTTATGGAGGAAGG + Intronic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
921462257 1:215443474-215443496 CAAATTAAGCTTCATAAGGAAGG - Intergenic
922624164 1:227020833-227020855 ATGATTAAACTTAATGAGGAAGG - Intronic
924535311 1:244930798-244930820 CACAATCAACTTCAGGGGGATGG + Intergenic
1064757941 10:18588558-18588580 CAGATGAAGCTTCCAGAGGAAGG + Intronic
1065065953 10:21964657-21964679 AAGACTAAACTTCAGGGAGAAGG - Intronic
1065177107 10:23088353-23088375 CAGAGTATAGTTCAGAAGGAAGG + Intergenic
1068008958 10:51423716-51423738 CAGATAAACCCTCAGGAGGTTGG - Intronic
1069428181 10:68308901-68308923 AAGATTAAAATTCAAGAGAATGG - Intronic
1069640314 10:69950654-69950676 CAGACAAAACTTCAGGCCGATGG + Intronic
1070237704 10:74647207-74647229 CAGATTAAATTGGAGAAGGAAGG + Intronic
1070887354 10:79915358-79915380 CAGATTCAGCTTGAGGAGGGTGG + Intergenic
1071850575 10:89565068-89565090 CAGCTTACACTTAAGGAGTAGGG - Intergenic
1072245684 10:93542056-93542078 CAGAATAAATTTCAGGGTGAAGG + Intergenic
1072976039 10:100059183-100059205 CAGATTAGACTTCATGAAAATGG + Intronic
1073403236 10:103275964-103275986 AAGATTAAACTCCAGGAGTGGGG - Intergenic
1075172034 10:120124651-120124673 CAGTTCAAACTTAAGGAGAAGGG + Intergenic
1075432401 10:122399096-122399118 CAATTTAAACTTCAGGAAGCAGG - Intronic
1076468484 10:130702281-130702303 CTGATTAAACTCGATGAGGAAGG - Intergenic
1078875655 11:15393110-15393132 AAGAATAAACTTCTGGAAGAAGG + Intergenic
1080674079 11:34408610-34408632 CAGATTAGAATGGAGGAGGATGG + Intergenic
1081652856 11:44836138-44836160 ATGATTAAACTTCATAAGGAAGG + Intronic
1083827077 11:65210019-65210041 CAGGTCAAACTTCCGGAAGATGG - Exonic
1085218210 11:74850531-74850553 AAGACTAAAGTTCAGGAGGGAGG + Intronic
1086101854 11:83108973-83108995 CAGATTAGATTTAAGCAGGAGGG - Intergenic
1086796374 11:91109241-91109263 CAGATTTAACTTCAGAGTGAGGG - Intergenic
1086842105 11:91699003-91699025 TAGATTAAAGTTCAGCTGGAAGG - Intergenic
1088547591 11:110975645-110975667 CAGATAAAAGTTCAGGAAAATGG - Intergenic
1093690073 12:22100758-22100780 AAAATTAAAATTCAGGAGGATGG - Intronic
1097642338 12:62197296-62197318 CTGCTTAGACTTGAGGAGGATGG - Intronic
1097818768 12:64105485-64105507 AAGATTAAACTTCTTGAGGCCGG + Intronic
1099054555 12:77822971-77822993 CAGTTTATACTTAAGGTGGAGGG - Intergenic
1099782882 12:87221698-87221720 CACATTCAAATTCAAGAGGAGGG + Intergenic
1100201020 12:92297915-92297937 CTGCTGAAAATTCAGGAGGAAGG + Intergenic
1101234229 12:102772144-102772166 CAGATTAAACTAAATGGGGATGG + Intergenic
1101460193 12:104883697-104883719 GAGATGAAACTTCCAGAGGAAGG - Intronic
1103502767 12:121416587-121416609 CAGGTCAAAGTTCAGGAGAAAGG - Intronic
1104221751 12:126791252-126791274 CTGAATAAACTTCAGGCAGATGG + Intergenic
1104520641 12:129471637-129471659 ATGATTAACCTTCATGAGGAAGG + Intronic
1106625010 13:31411238-31411260 CGGATTAAAGCTCAGGAGAAAGG + Intergenic
1107136564 13:36950926-36950948 CAGATAAAGTATCAGGAGGAAGG + Intronic
1108404436 13:50085599-50085621 CATTATAAACTTCAGCAGGAGGG - Intronic
1111090962 13:83446419-83446441 AAGATAAAACTTCATGAGGCAGG + Intergenic
1111285112 13:86080727-86080749 CAGATTTTATTTCAGGACGATGG + Intergenic
1111784714 13:92771827-92771849 AAGATTGAACTTCAGGAGAGAGG - Intronic
1112152888 13:96783339-96783361 CAAACTAAACATCAGGAGGCTGG + Intronic
1113844748 13:113380464-113380486 CAGAGTTCACTTCGGGAGGATGG - Intergenic
1114745414 14:25140853-25140875 CTGAAGAAACTTCTGGAGGAAGG - Intergenic
1115204559 14:30887951-30887973 TTGATTAAAGTTCAGGAGGCTGG + Intronic
1117986487 14:61390993-61391015 GAGAATAAAATTCAAGAGGAAGG + Intronic
1118154743 14:63228333-63228355 AAGATAAAATTTCAGAAGGAAGG - Intronic
1118184827 14:63527558-63527580 CAGATTAAATTCCAGAAGGCAGG - Intronic
1119021928 14:71123678-71123700 CAGATTCCACTTCAGGAGGGAGG - Intergenic
1119330387 14:73789138-73789160 CAGCTTACACTTAAGGAGGGAGG - Intronic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1119977518 14:79041677-79041699 AACATTAAACTTAAGCAGGAAGG + Intronic
1120387242 14:83862101-83862123 CAGATTAGAAGGCAGGAGGAGGG - Intergenic
1125106165 15:35973993-35974015 CAGATTGAAGTTAAGGAGGGAGG - Intergenic
1126234877 15:46372224-46372246 CAGATTAAACTACAGTATAAAGG + Intergenic
1128693829 15:69745552-69745574 AAGATTACTCTTCAGGAGCAGGG + Intergenic
1129072361 15:72961939-72961961 CAGATTTAGCTTCAAGAGGAGGG - Intergenic
1130698509 15:86155489-86155511 CAGATAAAAAGTCAGGAGGGTGG + Intronic
1132043068 15:98541480-98541502 CAGATTAAAGATCTGGAGGATGG - Intergenic
1133444870 16:5851412-5851434 CAGAGGAAAATTAAGGAGGAGGG - Intergenic
1135893805 16:26380312-26380334 CAGATTTAGCTTCAGAAGGTAGG + Intergenic
1137851714 16:51752299-51752321 CTGATTAATCTTCAGGAGAAAGG - Intergenic
1141501264 16:84445705-84445727 CATATTAAATTTCATGGGGAGGG - Intronic
1144370696 17:14588773-14588795 CAGATTAAACATCTAGATGATGG - Intergenic
1145352952 17:22104665-22104687 GAGATTACAGTTCAGGAGAAAGG + Intergenic
1146595808 17:34167496-34167518 CCGATTAAACTATAGGAGGCTGG + Intronic
1147272247 17:39282515-39282537 AAAAATAAACTTGAGGAGGAGGG - Intronic
1148337068 17:46849112-46849134 CAGTTCTAACATCAGGAGGAGGG + Intronic
1148576109 17:48712481-48712503 CATTTTAAAATTCAAGAGGAAGG - Intergenic
1151027441 17:70695095-70695117 GTGATTAAACTTAGGGAGGAAGG + Intergenic
1152069830 17:78128914-78128936 CAGCTCAGACCTCAGGAGGAGGG - Intronic
1152147107 17:78574986-78575008 CGGCTTGAACTTCAGGACGATGG + Exonic
1152402232 17:80074014-80074036 ATGATTAAGCTTCATGAGGAAGG + Intronic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1158212049 18:55062543-55062565 ATGATTAAGCTTCATGAGGAAGG - Intergenic
1158265754 18:55659287-55659309 CAGATTAAACTTCAGGAGGAAGG - Intronic
1159931719 18:74319085-74319107 CATATTATACTTTAGCAGGAAGG - Intronic
1164876511 19:31694331-31694353 GAGTTGAAACTTCAGCAGGAGGG + Intergenic
1165374303 19:35430921-35430943 TGGATTCAACTGCAGGAGGACGG + Intergenic
925760009 2:7175643-7175665 CATATTAAATTTCAGAATGATGG - Intergenic
926760926 2:16278417-16278439 GAGATTAAAGTTGAGGAGAAGGG - Intergenic
928712474 2:34022771-34022793 CAGAGGAAACTTCAAGAGGCTGG + Intergenic
929209651 2:39341360-39341382 CTGAAAAAACTTCAGGAGGCCGG + Intronic
930733937 2:54756040-54756062 CAGCCTAAACTTAAGGAAGAGGG - Intronic
932102663 2:68914823-68914845 CAGATTAGAAAGCAGGAGGAGGG - Intergenic
933787437 2:85854694-85854716 TATATTCAACTTCAGGGGGAAGG - Intronic
933980979 2:87550520-87550542 CAGTTCAAGCTTCAGGAGAAGGG - Intergenic
936312852 2:111400265-111400287 CAGTTCAAGCTTCAGGAGAAGGG + Intergenic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
937213862 2:120297885-120297907 CAGAATAATCTTCAGAAGAATGG - Intergenic
941051213 2:160736209-160736231 GAGATTAGACTGCAGGAAGAAGG + Intergenic
941629999 2:167873911-167873933 CAGTTTACATTTCAAGAGGAAGG - Exonic
942151366 2:173078722-173078744 CAAATTGAACTTTAGGTGGATGG + Intronic
942230047 2:173852493-173852515 CAGACTTCAGTTCAGGAGGAGGG + Intergenic
942934917 2:181543510-181543532 CAGATCAAACTTCATGAAGATGG + Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944875180 2:203957049-203957071 AAGACTAAAGGTCAGGAGGAAGG + Intronic
946909840 2:224449150-224449172 CAGAATATACTTCAGTAGGAAGG - Intergenic
947819398 2:233059833-233059855 CAGAGCAAACTTGAGGGGGAGGG - Intergenic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1169574314 20:6941378-6941400 CAGATTAGAATTCAGGTGGTAGG - Intergenic
1169923021 20:10755605-10755627 GAAATGAAGCTTCAGGAGGATGG + Intergenic
1171563193 20:26148817-26148839 AAGATTACAGTTCAGGAGAAAGG + Intergenic
1173065062 20:39702897-39702919 CACATTAACCTTCAGCAGCATGG + Intergenic
1173076984 20:39828667-39828689 AAGATTAACCTTCAGGCTGAGGG + Intergenic
1173339322 20:42139523-42139545 CAGAAGGAACTTCAGGAGAACGG + Intronic
1174183675 20:48690628-48690650 CAAATAAAACCTCAGGCGGAGGG + Intronic
1177748452 21:25250770-25250792 CAGAGAAAACCTCAGGATGAAGG - Intergenic
1179450962 21:41468069-41468091 CAGATTAAAATTCAGGATGGGGG - Intronic
1182290580 22:29275742-29275764 AAAATTAAACTTCAGAAGAAAGG + Intronic
1184933322 22:47698078-47698100 CAGATAAAACTTCAGGGAGTAGG + Intergenic
1185203806 22:49525155-49525177 CAGATTACACTTTGGGAGGTGGG + Intronic
949450094 3:4175319-4175341 GAGATGAAACTTCCAGAGGAAGG + Intronic
950396140 3:12735559-12735581 CAGCCTAAACTTCTGGAAGAGGG + Exonic
951670463 3:25175830-25175852 CAGTTTGAACTTCAGAAGCATGG - Intronic
951906628 3:27713649-27713671 CAGAAAGAACTTGAGGAGGAGGG - Intergenic
952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG + Intergenic
952501782 3:33970038-33970060 CAGATGAAGCTTCCAGAGGAAGG - Intergenic
952635673 3:35527343-35527365 ATGATTAAACTTAATGAGGAAGG - Intergenic
955638922 3:61060762-61060784 CAGATTAAGCTCCAGATGGAAGG + Intronic
956561978 3:70588651-70588673 CAGATTAAAATGCAAGAGAAGGG + Intergenic
957216430 3:77325851-77325873 CAGATTATACTCCTGGAAGATGG + Intronic
959026834 3:101248971-101248993 CAGATCAAACGACAAGAGGAAGG + Intronic
959234760 3:103706123-103706145 CTGATTGAAATTCAAGAGGAAGG + Intergenic
962160510 3:132994713-132994735 CAGAACAAACTTCAGTAGGCTGG + Intergenic
962781512 3:138723183-138723205 CAGATCAAACTTCAGGAAATGGG - Intronic
963081367 3:141397555-141397577 ATGATTAAGCTTCATGAGGAAGG - Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
964035310 3:152188525-152188547 GAGATTAAACTTAGTGAGGAAGG + Intergenic
965378465 3:167957148-167957170 AAGATTAAACTTGAGCAAGATGG - Intergenic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
966446955 3:180011237-180011259 CAGATGAAACTTCAGAACCAAGG + Intronic
967102615 3:186228744-186228766 AGGATGAAACTTCAGGAGGAAGG - Intronic
967265161 3:187684493-187684515 CACATAAAATTTCAGGCGGATGG + Intergenic
967605275 3:191437965-191437987 CAGATTGAATTTCAATAGGAAGG - Intergenic
970359863 4:15298245-15298267 GAGATTTAACTTCATGAGAAAGG - Intergenic
971456667 4:26851531-26851553 CACCTCAAACTTCAGGTGGAGGG + Intergenic
971883333 4:32410145-32410167 CAGATGAAGCTTCCAGAGGAAGG + Intergenic
971988255 4:33855969-33855991 GAGATTACAGTTCAGGAGAAAGG - Intergenic
974622281 4:64374186-64374208 CAGTTTAAAATTCTTGAGGAAGG - Intronic
974846908 4:67362663-67362685 CAGATTAAGCTTCATGATGTGGG - Intergenic
976036967 4:80835352-80835374 CAGATTAAAATTCAAGAAGCAGG - Intronic
976683694 4:87786719-87786741 AAAATTAGCCTTCAGGAGGAGGG - Intergenic
979228651 4:118320868-118320890 GAGTTTAAAATTCAAGAGGAAGG + Intronic
979667610 4:123329485-123329507 ATGATTAAGCTTCACGAGGAAGG + Intergenic
981101642 4:140835403-140835425 CAGAGTCCACTTCAGAAGGAAGG + Intergenic
981716103 4:147753868-147753890 CAAATTAAGCATCAAGAGGAAGG - Intronic
982883339 4:160747125-160747147 GTGATGAAACTTCAAGAGGAAGG + Intergenic
983369133 4:166836889-166836911 AAGATAAAACATCAGGAGTAAGG - Intronic
983528295 4:168783383-168783405 CAGTTTGGTCTTCAGGAGGAGGG + Intronic
983587765 4:169374654-169374676 CTGATTTTACTTCAGAAGGAAGG + Intergenic
987261872 5:16212532-16212554 AAGAATAAGTTTCAGGAGGAAGG - Intergenic
987529393 5:19097773-19097795 ATGATTAAGCTTCATGAGGAAGG + Intergenic
987593591 5:19965705-19965727 CAGGTTACATTTAAGGAGGAAGG + Intronic
989224091 5:39005846-39005868 CAGTTGAAACTTCAGGTGGCAGG - Intronic
989365859 5:40654145-40654167 CACATTAACTTTCTGGAGGAAGG + Intergenic
989768714 5:45117171-45117193 CAGAATAAGCTTCCAGAGGAAGG - Intergenic
989786262 5:45334998-45335020 CAAATTAAAGGTCAGCAGGATGG + Intronic
991366858 5:65877591-65877613 GTGATTAAGCTTCATGAGGAAGG + Intergenic
992197015 5:74350432-74350454 GAGATGAAACTTCCAGAGGAAGG - Intergenic
992574158 5:78094606-78094628 CAGAATAAAGTTATGGAGGAGGG - Intronic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993054522 5:82967033-82967055 CAAATTAAAATTCATGAGTAGGG + Intergenic
993705803 5:91168651-91168673 CAGATGAACCTTCAGGATAAAGG - Intergenic
994138946 5:96320909-96320931 CATATTAAATTTCTGGGGGAAGG - Intergenic
994517453 5:100788597-100788619 ATGATTAAACTGCATGAGGAAGG - Intergenic
995023626 5:107394544-107394566 TAGAGTAAACTTCAGGACAAGGG + Intronic
997009053 5:129855375-129855397 CATATTAAGCATCAGGAGGTAGG - Intergenic
997780005 5:136647401-136647423 GAGATAAAACTTTAGGTGGAGGG + Intergenic
997872373 5:137516956-137516978 CAGAGGCAAGTTCAGGAGGAGGG + Intronic
998565456 5:143212468-143212490 CAGAATAAAGTTCAGGACAAGGG - Intronic
998644688 5:144048861-144048883 AAGATGAAGCTTCTGGAGGAAGG + Intergenic
999695443 5:154184928-154184950 CAGAATATACTTCAGCAAGAAGG - Intronic
1000171011 5:158703153-158703175 CAGCATAAGCTTCAGGAGAAAGG + Intronic
1001589222 5:172854082-172854104 GAGATTAAACTACAGCAGGCAGG + Intronic
1004624410 6:17361440-17361462 CAGATTAAACTTCACAATGATGG - Intergenic
1005307188 6:24525191-24525213 CAGATTATATTTGGGGAGGAAGG + Intronic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1006309933 6:33250234-33250256 CTGAAAAACCTTCAGGAGGAAGG + Intergenic
1007106387 6:39285991-39286013 GAAGATAAACTTCAGGAGGATGG - Intergenic
1008034520 6:46732267-46732289 GAGATGAAACCTCAGGAAGATGG - Intronic
1008925747 6:56890713-56890735 CACATAACACTTCAAGAGGATGG + Intronic
1011715460 6:90100447-90100469 CAGATTACTCTTCATGAGGTGGG + Intronic
1011921716 6:92585897-92585919 CAGATTAAACATCAGGACAGAGG + Intergenic
1013885472 6:114959755-114959777 AAGATTAAAATTCAGGATGATGG + Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014330093 6:120053553-120053575 CAGGTTAAATTTCACGAGGTGGG - Intergenic
1016081618 6:139864153-139864175 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1020493145 7:8814310-8814332 CATATTTAACTTCATGAGAAGGG - Intergenic
1022951390 7:35341590-35341612 AAGGTTAAACTTAGGGAGGAAGG + Intergenic
1023067292 7:36390247-36390269 CAGATAAAACTCAGGGAGGAAGG + Intronic
1024113492 7:46170754-46170776 CATATAAAGTTTCAGGAGGATGG + Intergenic
1024378744 7:48669780-48669802 CAGATCAAACATGAGCAGGAAGG + Intergenic
1024438285 7:49384853-49384875 CAGAAAAAACTTGAGGAGGAGGG - Intergenic
1025274534 7:57565548-57565570 GAGATTACAGTTCAGGAGAAAGG - Intergenic
1027701000 7:81470094-81470116 CAGAATAGAATCCAGGAGGAAGG + Intergenic
1027864478 7:83629167-83629189 CAGATGAAGCTTCCAGAGGAAGG - Intronic
1028086004 7:86638679-86638701 GACTGTAAACTTCAGGAGGAGGG - Intergenic
1028908339 7:96179264-96179286 TAGATTAAACCTCAGTAGGAGGG - Intronic
1034136387 7:148774430-148774452 CAAAATAAAGTTCAGGAGAAGGG + Intronic
1038593590 8:28864383-28864405 AAGATTATATTTCAGGAAGAAGG + Intronic
1039572467 8:38598762-38598784 AAGCTAAAAATTCAGGAGGAAGG - Intergenic
1040879115 8:52185759-52185781 CACAATAAACTCCAGAAGGATGG + Intronic
1041388135 8:57326268-57326290 GAGATGAAGCTTCTGGAGGAAGG - Intergenic
1042962432 8:74318639-74318661 GACATTAAACTGGAGGAGGAAGG - Intronic
1043051202 8:75387886-75387908 TAGATCAAACTTCTTGAGGAAGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1050049885 9:1588736-1588758 CAGATGTAACTTCCAGAGGAAGG - Intergenic
1050694957 9:8268453-8268475 CACAGTTCACTTCAGGAGGAAGG + Intergenic
1051061737 9:13053142-13053164 CAAATGAAACATCAGTAGGATGG + Intergenic
1055062361 9:72083074-72083096 AAGATTTACCTTCAGGTGGAAGG + Intergenic
1055761840 9:79617226-79617248 CAGGTTATCTTTCAGGAGGAAGG + Intronic
1056244177 9:84677757-84677779 CAGATTAAACTTCATGCAGTGGG + Intronic
1057508710 9:95659744-95659766 CAAATTAAAGTTCTGAAGGAGGG + Intergenic
1060244482 9:121932759-121932781 GAGTTTATACTTCAAGAGGATGG + Intronic
1061764614 9:132873956-132873978 CAGAGTAAACTGCACCAGGAAGG + Intronic
1186004910 X:5058939-5058961 TAGATAACACTGCAGGAGGATGG + Intergenic
1186030461 X:5363670-5363692 CAAAATACCCTTCAGGAGGAAGG - Intergenic
1187274983 X:17809287-17809309 GGGACTAAACTTCATGAGGACGG + Intronic
1187483691 X:19681896-19681918 AAGACTAAACTCCAGGGGGATGG + Intronic
1187760134 X:22574079-22574101 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1189942624 X:46141320-46141342 ATGATTAAACTTGATGAGGAAGG + Intergenic
1190577717 X:51857930-51857952 AAGATTAAACTTCAGATTGAAGG - Intronic
1190653200 X:52587635-52587657 CAGAATGAACTTAAGGAAGAAGG + Intergenic
1194130542 X:90075427-90075449 TAGATTTAAGTACAGGAGGAAGG - Intergenic
1194782082 X:98036061-98036083 CAGATTGAAATCCAGGAGTAGGG - Intergenic
1196904542 X:120418815-120418837 GAGATTGAACTTCAGTGGGATGG - Intergenic
1198040911 X:132851549-132851571 CACATTAACCCTCAAGAGGAGGG - Intronic
1199098402 X:143768393-143768415 CAGATAAAAATTCAGGAGACGGG - Intergenic
1199462130 X:148096399-148096421 CAGATAAAATTTTGGGAGGAGGG + Intergenic
1199531036 X:148847902-148847924 CTGTGTACACTTCAGGAGGAAGG - Intronic