ID: 1158274081

View in Genome Browser
Species Human (GRCh38)
Location 18:55747699-55747721
Sequence TTGTGGAAATGCAAAGTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158274076_1158274081 17 Left 1158274076 18:55747659-55747681 CCCTCCAATACATTTTTTCTCTG No data
Right 1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG No data
1158274077_1158274081 16 Left 1158274077 18:55747660-55747682 CCTCCAATACATTTTTTCTCTGT No data
Right 1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG No data
1158274078_1158274081 13 Left 1158274078 18:55747663-55747685 CCAATACATTTTTTCTCTGTAGG No data
Right 1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158274081 Original CRISPR TTGTGGAAATGCAAAGTCAA AGG Intergenic
No off target data available for this crispr