ID: 1158276368

View in Genome Browser
Species Human (GRCh38)
Location 18:55772576-55772598
Sequence CTAGTCCTGCCCTTGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158276368_1158276371 -2 Left 1158276368 18:55772576-55772598 CCATGTGTCAAGGGCAGGACTAG No data
Right 1158276371 18:55772597-55772619 AGGTGGAGATAATTGAAACATGG No data
1158276368_1158276374 3 Left 1158276368 18:55772576-55772598 CCATGTGTCAAGGGCAGGACTAG No data
Right 1158276374 18:55772602-55772624 GAGATAATTGAAACATGGGGTGG No data
1158276368_1158276373 0 Left 1158276368 18:55772576-55772598 CCATGTGTCAAGGGCAGGACTAG No data
Right 1158276373 18:55772599-55772621 GTGGAGATAATTGAAACATGGGG 0: 9
1: 631
2: 1344
3: 3411
4: 7193
1158276368_1158276372 -1 Left 1158276368 18:55772576-55772598 CCATGTGTCAAGGGCAGGACTAG No data
Right 1158276372 18:55772598-55772620 GGTGGAGATAATTGAAACATGGG 0: 10
1: 632
2: 1404
3: 3423
4: 7262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158276368 Original CRISPR CTAGTCCTGCCCTTGACACA TGG (reversed) Intergenic
No off target data available for this crispr