ID: 1158277344

View in Genome Browser
Species Human (GRCh38)
Location 18:55782306-55782328
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158277337_1158277344 4 Left 1158277337 18:55782279-55782301 CCTATCCTAATAATAACCTGTAT No data
Right 1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG No data
1158277336_1158277344 17 Left 1158277336 18:55782266-55782288 CCAGACAATATCTCCTATCCTAA No data
Right 1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG No data
1158277338_1158277344 -1 Left 1158277338 18:55782284-55782306 CCTAATAATAACCTGTATTCGTA No data
Right 1158277344 18:55782306-55782328 AATGGCCTCTTTAACACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158277344 Original CRISPR AATGGCCTCTTTAACACTGG GGG Intergenic
No off target data available for this crispr