ID: 1158278085

View in Genome Browser
Species Human (GRCh38)
Location 18:55790599-55790621
Sequence CTATAGAAATAGAGAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158278077_1158278085 12 Left 1158278077 18:55790564-55790586 CCCCAGGGGCAGGGTAAGAGGAG No data
Right 1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG No data
1158278080_1158278085 10 Left 1158278080 18:55790566-55790588 CCAGGGGCAGGGTAAGAGGAGGG No data
Right 1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG No data
1158278078_1158278085 11 Left 1158278078 18:55790565-55790587 CCCAGGGGCAGGGTAAGAGGAGG No data
Right 1158278085 18:55790599-55790621 CTATAGAAATAGAGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158278085 Original CRISPR CTATAGAAATAGAGAGCAGG AGG Intergenic
No off target data available for this crispr