ID: 1158282896

View in Genome Browser
Species Human (GRCh38)
Location 18:55847288-55847310
Sequence GTGTGTAAGTAAATTCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158282896_1158282897 14 Left 1158282896 18:55847288-55847310 CCAAGATGAATTTACTTACACAC No data
Right 1158282897 18:55847325-55847347 ACACATTGCTAAAAGCTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158282896 Original CRISPR GTGTGTAAGTAAATTCATCT TGG (reversed) Intergenic
No off target data available for this crispr