ID: 1158284022

View in Genome Browser
Species Human (GRCh38)
Location 18:55858768-55858790
Sequence TGGAGTCGGGTTTTAGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158284016_1158284022 22 Left 1158284016 18:55858723-55858745 CCGTTCTGCATGAACGGAAATGT No data
Right 1158284022 18:55858768-55858790 TGGAGTCGGGTTTTAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158284022 Original CRISPR TGGAGTCGGGTTTTAGCATA AGG Intergenic
No off target data available for this crispr