ID: 1158284062

View in Genome Browser
Species Human (GRCh38)
Location 18:55859313-55859335
Sequence CAATTTTGCCTGCGTGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158284062_1158284066 15 Left 1158284062 18:55859313-55859335 CCCAGTGCACGCAGGCAAAATTG No data
Right 1158284066 18:55859351-55859373 TCTTGGAAATATCTAGTAACAGG No data
1158284062_1158284067 29 Left 1158284062 18:55859313-55859335 CCCAGTGCACGCAGGCAAAATTG No data
Right 1158284067 18:55859365-55859387 AGTAACAGGTGCAGTCAGATAGG No data
1158284062_1158284065 -2 Left 1158284062 18:55859313-55859335 CCCAGTGCACGCAGGCAAAATTG No data
Right 1158284065 18:55859334-55859356 TGGTGTGTGAGTGAGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158284062 Original CRISPR CAATTTTGCCTGCGTGCACT GGG (reversed) Intergenic
No off target data available for this crispr